NGS Pipeline for Single End reads

Annotation:

StepAnnotation
Step 1: Input dataset
select at runtime
Step 2: FastQC
Output dataset 'output' from step 1
select at runtime
select at runtime
Step 3: Trim Galore!
Single-end
Output dataset 'output' from step 1
User defined adapter sequence
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
3
Full parameter list
20
1
0.1
10
Not available.
Not available.
False
Do not output unpaired reads
Use defaults (no RRBS)
Step 4: FastQC
Output dataset 'trimmed_reads_single' from step 3
select at runtime
select at runtime
select at runtime
False
Not available.
7
Step 5: Map with BWA-MEM
Use a built-in genome index
hg19_rCRS_pUC18_phiX174
Single
Output dataset 'trimmed_reads_single' from step 3
Set read groups (Picard style)
True
True
True
ILLUMINA
MiSeq
Empty.
Empty.
Not available.
Empty.
1.Simple Illumina mode
Use default job resource parameters
Step 6: MarkDuplicates
Output dataset 'bam_output' from step 5
Comments
False
True
SUM_OF_BASE_QUALITIES
Empty.
100
Empty.
Lenient
Step 7: BamLeftAlign
Locally cached
Output dataset 'outFile' from step 6
hg19_rCRS_pUC18_phiX174
5
Step 8: Filter
Output dataset 'output_bam' from step 7
Conditions
Condition 1
Filters
Filter 1
mapQuality
>=20
Filter 2
reference
chrM
False
Step 9: FreeBayes
Locally cached
Run individually
Output dataset 'out_file1' from step 8
Homo_sapiens_nuHg19_mtrCRS
Limit to region
chrM
1
16569
5. Full list of options
Do not provide additional inputs
Use defaults
Set population model options
0.001
1
True
True
Use defaults
Set alleic scope options
False
False
True
True
0
3
5
0
False
False
Set input filters
False
20
20
0
0
No mismatch filters (default)
1000
False
0.2
2
0
1
0
Use defaults
Use defaults
Use defaults
Use default job resource parameters
Step 10: VCFfilter:
Output dataset 'output_vcf' from step 9
more filters
more filters 1
Info filter (-f)
QUAL > 20
more filters 2
Info filter (-f)
DP > 1
False
False
False
False
False
False
False
Empty.