None
Dataset | CCT_mtr3_mt1_raw

Galaxy Dataset ' CCT_mtr3_mt1_raw'

Annotation: None

This dataset is large and only the first megabyte is shown below. | Show all
@HWUSI-EAS1795_0092:3:1:2816:1058#0/1
TTCGACACGTCAGAATATTCTTGAGGATANTTG
+HWUSI-EAS1795_0092:3:1:2816:1058#0/1
ggggfggfaefeggggcggcggfgagc\^Ba^V
@HWUSI-EAS1795_0092:3:1:3212:1052#0/1
TACAGTTTCGTGTATANGCTTAAATANCTNGTC
+HWUSI-EAS1795_0092:3:1:3212:1052#0/1
gggg]gggggg_V]VYBV\\Z^`_BBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3635:1057#0/1
CATTGGACAAACGTGTTTTGCAGCCAAAGNCAC
+HWUSI-EAS1795_0092:3:1:3635:1057#0/1
ca^a\a_acddafffffc\Pca`a^aaBBBBBB
@HWUSI-EAS1795_0092:3:1:6690:1053#0/1
CTGGCTTACACCGGTTNGAACTCAGANCANGTA
+HWUSI-EAS1795_0092:3:1:6690:1053#0/1
ea_fcf_fafff`^]`BZZ]ZYb``BBBBBBBB
@HWUSI-EAS1795_0092:3:1:7123:1059#0/1
TAGAATAGCAATTTCTTCCACGACGCCGCNCAG
+HWUSI-EAS1795_0092:3:1:7123:1059#0/1
hhhhhhhhhghhhhghhhhhhhhhhhhddBaaW
@HWUSI-EAS1795_0092:3:1:7361:1053#0/1
GCTGATCCTCCTTTAGNCGCTAGTGTNAANTGG
+HWUSI-EAS1795_0092:3:1:7361:1053#0/1
hghhhhhhhhhheeedBb`a^`__a_B_BBBBB
@HWUSI-EAS1795_0092:3:1:9550:1058#0/1
CTGCAATACCCCATGCCGTAGCCTCATAGNATG
+HWUSI-EAS1795_0092:3:1:9550:1058#0/1
hhhhhhhhhhhhhhhdhhhhhhhhhhhddB``[
@HWUSI-EAS1795_0092:3:1:12038:1058#0/1
CACCAATCCACCAGTTCAGCCAGACTCTGNACA
+HWUSI-EAS1795_0092:3:1:12038:1058#0/1
gggggggggggggdggggdggffgggg^_B_a^
@HWUSI-EAS1795_0092:3:1:12446:1056#0/1
GGCAGAAACAACAACANCGTCCCAGGNGANGAA
+HWUSI-EAS1795_0092:3:1:12446:1056#0/1
hhhhhghhhhhgeeeeB``]bbdaaaBBBBBBB
@HWUSI-EAS1795_0092:3:1:12585:1055#0/1
GACAAAGTGGCAGAGTNGCAGAGTGGNACNATG
+HWUSI-EAS1795_0092:3:1:12585:1055#0/1
ggfgggggggggcaa^B``b`BBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12825:1052#0/1
CCGGCAAGAAGCCCCANTCCGTGCTGNCCNAGC
+HWUSI-EAS1795_0092:3:1:12825:1052#0/1
gggggggfggggedddBW_BBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13300:1056#0/1
GCCACATCTCATATGGNGTCTTTGAANTANCAA
+HWUSI-EAS1795_0092:3:1:13300:1056#0/1
fffcffaaddd_`Z__B\_a^aa[aaBVZB^Z]
@HWUSI-EAS1795_0092:3:1:15673:1057#0/1
GTTGGAGATGGGCACCGAGCAGCCGTNGTNCCG
+HWUSI-EAS1795_0092:3:1:15673:1057#0/1
ggggggggeeggegggggeadf`]`BBBBBBBB
@HWUSI-EAS1795_0092:3:1:19478:1053#0/1
CAAGCATCTGAAAGAANGCATTGTTTNATNGTA
+HWUSI-EAS1795_0092:3:1:19478:1053#0/1
hghhhhhhhhhhebd_B_caaaa`d_BBBBBBB
@HWUSI-EAS1795_0092:3:1:19764:1055#0/1
AGCCAAGTCCCGAACTNGGGGTCGGANTCNACC
+HWUSI-EAS1795_0092:3:1:19764:1055#0/1
_]cZ_cBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:19791:1055#0/1
CCCTAGTTGGTTTTTTNCTTGATTACNTTNCCA
+HWUSI-EAS1795_0092:3:1:19791:1055#0/1
ffcdffffffffccc^Bbbb^`\]]\B^^B^^T
@HWUSI-EAS1795_0092:3:1:1657:1063#0/1
CGCACGTTGGTCAGGGGGTTCAGGCGGGGCACG
+HWUSI-EAS1795_0092:3:1:1657:1063#0/1
UPFHWMTaIX\I`^^BBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:1733:1065#0/1
AAAGAGCATCCCAATCCTCTTCGCTCTCTTTGA
+HWUSI-EAS1795_0092:3:1:1733:1065#0/1
fffaf]^cRcccddddd[c^^cffffccdf[ff
@HWUSI-EAS1795_0092:3:1:1849:1059#0/1
CACCAGCGCAATCTGGGCATGTCCATGAANGTG
+HWUSI-EAS1795_0092:3:1:1849:1059#0/1
cfcf\[ffc_f]ddaddcacaadadadBBBBBB
@HWUSI-EAS1795_0092:3:1:1872:1068#0/1
TGCTGAGCCGCAAAACAACTAAGAAAGAATTCT
+HWUSI-EAS1795_0092:3:1:1872:1068#0/1
^fdYdcccdcaddfffcc`fdd\cfcdfccf_c
@HWUSI-EAS1795_0092:3:1:2881:1061#0/1
TGGGAACCCTGCTGATTTCCAAGATCCGCGAGG
+HWUSI-EAS1795_0092:3:1:2881:1061#0/1
hhhhhhhhhehhhggahhhhfgghehahfhdga
@HWUSI-EAS1795_0092:3:1:3345:1061#0/1
TGCCAATGATCGCTACTACGCAATAGAAAACCG
+HWUSI-EAS1795_0092:3:1:3345:1061#0/1
hhhhhdghhfhhhhhghhhhfhhdhghhhhhhg
@HWUSI-EAS1795_0092:3:1:3380:1063#0/1
AGACGCGAGAGATGCTGACGCACTTGCTCCAGA
+HWUSI-EAS1795_0092:3:1:3380:1063#0/1
eggfgggggfgeaffffcfgccf_f_fdggggg
@HWUSI-EAS1795_0092:3:1:3437:1069#0/1
GTTTTTGTAGTCAATCAACTGATTGGAAGCCGC
+HWUSI-EAS1795_0092:3:1:3437:1069#0/1
ggggggccffffgfgggggeggdgaggfffffg
@HWUSI-EAS1795_0092:3:1:3538:1060#0/1
GTGGCACCCGAGGAGCACCCCGTGCTGCTNACC
+HWUSI-EAS1795_0092:3:1:3538:1060#0/1
gggggggggegfgfef]fffcfWee`e^^B``_
@HWUSI-EAS1795_0092:3:1:4640:1066#0/1
CGGAAGACGGCCAAACGGGAGGCACGCAAAGAA
+HWUSI-EAS1795_0092:3:1:4640:1066#0/1
fff]fffRddR[``a\aaaPa[FUSZScccWf]
@HWUSI-EAS1795_0092:3:1:5726:1065#0/1
GATGGTGGTGGAGTATCATCGCACCGTTAATGC
+HWUSI-EAS1795_0092:3:1:5726:1065#0/1
hdhhhhhhhhhgghfgffhhhchhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5806:1066#0/1
CCGTGGTCAAGAAGGTTGTTAACCAGCTGTTCG
+HWUSI-EAS1795_0092:3:1:5806:1066#0/1
cccffffdfdggffaffKeeceaWaaadcdd^a
@HWUSI-EAS1795_0092:3:1:6027:1062#0/1
GCGCATGCCGCGAAGAGTGTTCCCCTTGTACTG
+HWUSI-EAS1795_0092:3:1:6027:1062#0/1
fggdggggggffgfgggegfggggdggdff]fd
@HWUSI-EAS1795_0092:3:1:6473:1069#0/1
GTTCAAAGCGGTGGCTCCCTGATGACCATGCTG
+HWUSI-EAS1795_0092:3:1:6473:1069#0/1
hhhhhfhfhgdgchghhhhghdeegdhfghhhh
@HWUSI-EAS1795_0092:3:1:7549:1061#0/1
TGAAGAAACCGCGCTTCGATGTCTCAAAGCTTC
+HWUSI-EAS1795_0092:3:1:7549:1061#0/1
hhhhghhhhhhhhhhhhhfhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:7600:1070#0/1
TTTTTACCATCAAATGCTTGCCATATATGTATG
+HWUSI-EAS1795_0092:3:1:7600:1070#0/1
hhhhhhhhhhWhfffffhhhhhghghhhghghh
@HWUSI-EAS1795_0092:3:1:7671:1062#0/1
CGGCAAGACCCTGATCGATGCCCTCGATGCCAT
+HWUSI-EAS1795_0092:3:1:7671:1062#0/1
hghhhhhhhhhhhdhhhghghhhdhhhghggfg
@HWUSI-EAS1795_0092:3:1:8103:1070#0/1
CGTCTCCAAGAGGCAGGAATGTCGATCGAATTT
+HWUSI-EAS1795_0092:3:1:8103:1070#0/1
hhhhhhhhhhhhhfhhhghacfhhhdhhhhhhg
@HWUSI-EAS1795_0092:3:1:9173:1059#0/1
CTTTGACAAGGAGAACACTAAGAACCTGGNCAC
+HWUSI-EAS1795_0092:3:1:9173:1059#0/1
hhhhhhhhhhhhghhhhhhhhfhhhhhdbBdf^
@HWUSI-EAS1795_0092:3:1:9420:1068#0/1
CCTGATCAGCCTATCGGAGCGGAACGAGCGTCT
+HWUSI-EAS1795_0092:3:1:9420:1068#0/1
hhhhhhhhhhhhhghhhhhhhghhhfhghhghf
@HWUSI-EAS1795_0092:3:1:9945:1062#0/1
GAAAGTTGTGTTTTTCGTACATTTTGCCAATTC
+HWUSI-EAS1795_0092:3:1:9945:1062#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:10307:1063#0/1
GCAGGGAGGTGCCGGTACCGCCGCACATCGACA
+HWUSI-EAS1795_0092:3:1:10307:1063#0/1
aWd`d``^ZTa[\YYQ[^d^^^aacccbcacbW
@HWUSI-EAS1795_0092:3:1:10632:1066#0/1
GTTCATGCATTTCCTGTTCTCCTCCTCGGGCGT
+HWUSI-EAS1795_0092:3:1:10632:1066#0/1
hhhhhhhhhhhfhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10887:1063#0/1
GCTAACCAAATATGATTCGGTTGGCGAAGATGA
+HWUSI-EAS1795_0092:3:1:10887:1063#0/1
`b]ddddfcffcaa^Rc^\\Y\^c^W^BBBBBB
@HWUSI-EAS1795_0092:3:1:11081:1066#0/1
TTGTTGAGTGGAAGCAAACCAGCTACTTCTTGC
+HWUSI-EAS1795_0092:3:1:11081:1066#0/1
cfce__[fcYfffffafgegggfacffadda[f
@HWUSI-EAS1795_0092:3:1:11826:1065#0/1
TGGGAGCACACAGCACAAGGCAAGAAAAATGCG
+HWUSI-EAS1795_0092:3:1:11826:1065#0/1
hhhhhhhhhhhhghfhhggeffhcghhhhgfgh
@HWUSI-EAS1795_0092:3:1:11881:1060#0/1
CTTCTCTGGACACAGCGGCAAGCAGCGCANCAA
+HWUSI-EAS1795_0092:3:1:11881:1060#0/1
hhghhhhghhhfhhhhhfghhfgdcffaBBBBB
@HWUSI-EAS1795_0092:3:1:11963:1063#0/1
GGCTTCGCTGTCCACCTTCCAGCAGATGTGGAT
+HWUSI-EAS1795_0092:3:1:11963:1063#0/1
fccgeggefgcgfacffgggg_ggg_ggdg_]e
@HWUSI-EAS1795_0092:3:1:12535:1066#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12535:1066#0/1
gggggggggggfacfffdgggegggggecggcg
@HWUSI-EAS1795_0092:3:1:14472:1067#0/1
GTTTTGATGAGGATCAGGTGCAACAGCGTCCTG
+HWUSI-EAS1795_0092:3:1:14472:1067#0/1
dcfffcfcddffgagggfefffggfgggbggge
@HWUSI-EAS1795_0092:3:1:14553:1070#0/1
GCTGTTCACCGACACCCTGACATTTGCCCAGCC
+HWUSI-EAS1795_0092:3:1:14553:1070#0/1
hhhhhggchhhhcefghhhhhghffhhhggehh
@HWUSI-EAS1795_0092:3:1:15002:1070#0/1
GGGAGCACTTCTTCGAATGCGAGTCCGCTTGAA
+HWUSI-EAS1795_0092:3:1:15002:1070#0/1
ggfegggfffdffggggegccfcafffffdffg
@HWUSI-EAS1795_0092:3:1:15394:1060#0/1
CTAGAGTCAAAGGAAACCGTGGCTATGCCNGCA
+HWUSI-EAS1795_0092:3:1:15394:1060#0/1
gggfggcgggfgfgggggdggfggggga^B^\T
@HWUSI-EAS1795_0092:3:1:15764:1070#0/1
CCTCGTTTGTGTATCGCGCCAGCTCCGAAATGT
+HWUSI-EAS1795_0092:3:1:15764:1070#0/1
hhhhhhhhggghhhhhhgghahdhhhhhhhfcc
@HWUSI-EAS1795_0092:3:1:15851:1062#0/1
TCGCCTCTGCGCTACATCGACATTGCCATTCCG
+HWUSI-EAS1795_0092:3:1:15851:1062#0/1
hhhhhhhhhhhhhhhhhhhhgdhhehfhhhhhh
@HWUSI-EAS1795_0092:3:1:16184:1066#0/1
TCCAGAGCCTGCATCTCAGAGTCTTCTTCATCG
+HWUSI-EAS1795_0092:3:1:16184:1066#0/1
gggggcgggedgccfcffeddcggffggggefg
@HWUSI-EAS1795_0092:3:1:17237:1066#0/1
GCTCAGGGTGCAAAACGAGCAGCGCGAGAAGGC
+HWUSI-EAS1795_0092:3:1:17237:1066#0/1
hhhhhhhhdhhhhhhhhggehhhhggfgfeffa
@HWUSI-EAS1795_0092:3:1:17664:1061#0/1
CCTCATCGTCGTCCTCGTCCTCATCGTCANCAC
+HWUSI-EAS1795_0092:3:1:17664:1061#0/1
]\Xaa]_fffffffcffcffff]Xb^BBBBBBB
@HWUSI-EAS1795_0092:3:1:17810:1060#0/1
GGGGAAGTGGATGAGGAGTGGATGCATAANTGC
+HWUSI-EAS1795_0092:3:1:17810:1060#0/1
hhhhhghhhhhhhdhhhheghhdggggBBBBBB
@HWUSI-EAS1795_0092:3:1:18075:1060#0/1
GTCGTACAACAGAGCAAGAAGAATGTTAGNAAA
+HWUSI-EAS1795_0092:3:1:18075:1060#0/1
hhhhhfhghhhhhhhhhghhhhhhhhhabBbb_
@HWUSI-EAS1795_0092:3:1:19100:1064#0/1
TGCTGGCCGAGATCCTCTGCCTGCTGGTTCCAG
+HWUSI-EAS1795_0092:3:1:19100:1064#0/1
gggeggggggfggggggggggcdffffggggeg
@HWUSI-EAS1795_0092:3:1:19681:1061#0/1
ATTTTCTTCGACCTGTGAAAAGGCTTTTTACCC
+HWUSI-EAS1795_0092:3:1:19681:1061#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:1541:1071#0/1
GGCTGCGAGCCGGAGTGAATAGCTGCTCTTTAT
+HWUSI-EAS1795_0092:3:1:1541:1071#0/1
\c`S_S`dd]dcYNYSY]a]`YJ\aaZd]ffff
@HWUSI-EAS1795_0092:3:1:2793:1077#0/1
GTTCGAGCTGAAGCCAAGATTCGATTTCGCTCT
+HWUSI-EAS1795_0092:3:1:2793:1077#0/1
f`ffdfdgggfggggggffaffgdgggffKafb
@HWUSI-EAS1795_0092:3:1:3088:1076#0/1
CCTCGGTATTTTCATCCTCACCGCATGCTGTAA
+HWUSI-EAS1795_0092:3:1:3088:1076#0/1
eggfgfggggag_eceeff_df[cc^_c```ef
@HWUSI-EAS1795_0092:3:1:3273:1074#0/1
CTCCAAGTGAGCTTTCCCCCAAAAAAGATCTGG
+HWUSI-EAS1795_0092:3:1:3273:1074#0/1
\fefa^dfff[ad_acccfeffffacc`cff_^
@HWUSI-EAS1795_0092:3:1:3947:1073#0/1
ACGCAATTTACCGCCCAGACATGGCGGGCACTT
+HWUSI-EAS1795_0092:3:1:3947:1073#0/1
ffffffdfgggggggegcgggeegcgebXcdaf
@HWUSI-EAS1795_0092:3:1:4837:1079#0/1
AAAATGAGCGAAAATGCATATTCTGCCATTCCA
+HWUSI-EAS1795_0092:3:1:4837:1079#0/1
effffffgggfggfggggeggggggggggcggf
@HWUSI-EAS1795_0092:3:1:5081:1078#0/1
TGGGCATTGTGCTCTTCCTGCATTTTAAATCTC
+HWUSI-EAS1795_0092:3:1:5081:1078#0/1
_W\_^^Z^\ddcfff_fff_f[dccacc_accf
@HWUSI-EAS1795_0092:3:1:5609:1077#0/1
TGCTTGGGTACATGGAAATTCGTGTGTTTGCGG
+HWUSI-EAS1795_0092:3:1:5609:1077#0/1
_cR\cccebffd_ed[dc]fcfdfffaggggg[
@HWUSI-EAS1795_0092:3:1:5823:1078#0/1
GTACGGTGGACATGAGCATTACGGGAATGTTCT
+HWUSI-EAS1795_0092:3:1:5823:1078#0/1
ddXdddbeeeeefhhhhgghhhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6388:1071#0/1
GCTCTGGAGAGCACCAACGCCCGTCTGGCGCTG
+HWUSI-EAS1795_0092:3:1:6388:1071#0/1
ffd\adaaaccaNYSVSb]b`aQSQX\JZVPSd
@HWUSI-EAS1795_0092:3:1:7090:1073#0/1
CGGGCGGCAGGGGAGCAGAGCTGTACTGTACCA
+HWUSI-EAS1795_0092:3:1:7090:1073#0/1
hhhhghhhhhhhhahegghgfghfhhcggghgh
@HWUSI-EAS1795_0092:3:1:7341:1072#0/1
CGGTGACATAACGCAAGATGATGCGCCCGAGTT
+HWUSI-EAS1795_0092:3:1:7341:1072#0/1
hhhhhhhhhhhghhhhhgghgehghhhfhhcfd
@HWUSI-EAS1795_0092:3:1:7965:1078#0/1
GTTTTTAATATATTTTCTTTATTCTCGAGTAGA
+HWUSI-EAS1795_0092:3:1:7965:1078#0/1
]S^aU[[^^aZ\ddd``cd]cfJ^a^\ffff_a
@HWUSI-EAS1795_0092:3:1:10138:1081#0/1
CAACAACAAGCATATAACCAACATCATAATGCA
+HWUSI-EAS1795_0092:3:1:10138:1081#0/1
hhhhhhhhhhghhhhhhhhhhhgfhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:10511:1078#0/1
CGGGCTTCTTGATGATCAGACCATCCTTGATAA
+HWUSI-EAS1795_0092:3:1:10511:1078#0/1
hhhhhhhhhhhfhhhhhhghhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10951:1082#0/1
ATTTGATGTCCGTAAAGCGTCTCCAAGAGGCAG
+HWUSI-EAS1795_0092:3:1:10951:1082#0/1
hhhhhhghhhhhhhhhhhhehhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11693:1074#0/1
GAATTAACAATTAACAATGCCGCAGAATGAGTA
+HWUSI-EAS1795_0092:3:1:11693:1074#0/1
ggffggfggggggggggagggdfdf[fffffdf
@HWUSI-EAS1795_0092:3:1:11935:1072#0/1
CCTCCTTCTCTGCGCAATATTCCTGGCGTAATT
+HWUSI-EAS1795_0092:3:1:11935:1072#0/1
hhhhhhhhhhhhhghhhhhehhhfghhhhhhhh
@HWUSI-EAS1795_0092:3:1:11983:1080#0/1
AAGGGCTGCATGGAATGGGTGGTCACCCTGTTC
+HWUSI-EAS1795_0092:3:1:11983:1080#0/1
hhhhhghghhhhhhhehhhdhhghhhhhgfhhh
@HWUSI-EAS1795_0092:3:1:12275:1073#0/1
CAGAAAAACAAGCGCAAGCGCCTGTCGAAAACC
+HWUSI-EAS1795_0092:3:1:12275:1073#0/1
ggdcfefcgggggfgge`ffffLWSYW__^BBB
@HWUSI-EAS1795_0092:3:1:12313:1071#0/1
CTTAAAGTCCGGCTGCATGCACCAGGCGCAACC
+HWUSI-EAS1795_0092:3:1:12313:1071#0/1
dggggggfggggfddfcfffffgggcgcafffg
@HWUSI-EAS1795_0092:3:1:12911:1074#0/1
GTCGAAGTGCTGTGGCTAATCACTGATTGTGCA
+HWUSI-EAS1795_0092:3:1:12911:1074#0/1
c[fcffffcfa]accaaaaZ^`fc]fa\ZVZ^d
@HWUSI-EAS1795_0092:3:1:13090:1071#0/1
CCCAGCTTGAACACCTGCGTCTGCAGACGACGC
+HWUSI-EAS1795_0092:3:1:13090:1071#0/1
hghhhhhhhhhghchhgggehcdffdhhghheg
@HWUSI-EAS1795_0092:3:1:13185:1082#0/1
GATAGCGACAGCGAGCAACAACAACATACTGCC
+HWUSI-EAS1795_0092:3:1:13185:1082#0/1
hhfhhhhhghhhhgfgfhhhfhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:13222:1078#0/1
GAGCAGTTGCGGCTTGGGTTTCTCATTACTTGG
+HWUSI-EAS1795_0092:3:1:13222:1078#0/1
ggfc]fffffcaQdcdddbdfQYT[Y_BBBBBB
@HWUSI-EAS1795_0092:3:1:13475:1077#0/1
CTCGTATTCTGACTCCACAATGTGATGGAATAA
+HWUSI-EAS1795_0092:3:1:13475:1077#0/1
hghhhhfhhhahhhhhffhhgggahfhfhe_gf
@HWUSI-EAS1795_0092:3:1:13988:1082#0/1
GGACGATTCCTTAGAACTGGCCGTCGCTACCCC
+HWUSI-EAS1795_0092:3:1:13988:1082#0/1
\\\W\Z^da\^da_ccc\`ba`VJUM]RIaYVd
@HWUSI-EAS1795_0092:3:1:14292:1078#0/1
AAAAAAATGTTGTCTACACATCCGTGCAGGTTC
+HWUSI-EAS1795_0092:3:1:14292:1078#0/1
gggeg`gggggfggggggggfgggggegggggf
@HWUSI-EAS1795_0092:3:1:14372:1082#0/1
TATTACTGATTATGGAGTGTGCGACCTTATAGA
+HWUSI-EAS1795_0092:3:1:14372:1082#0/1
gggggggggggggggc]ffeffafdffgggg_c
@HWUSI-EAS1795_0092:3:1:14594:1082#0/1
GATGGTGCTGCTGCTGTTGTGCGTGGTTGTGGC
+HWUSI-EAS1795_0092:3:1:14594:1082#0/1
gcgfgegfafffggcggf_caR\Sa^W^ZW[_f
@HWUSI-EAS1795_0092:3:1:15020:1078#0/1
AGCTTGTCCAGGTTGATCTCGGGCCTGAACTCG
+HWUSI-EAS1795_0092:3:1:15020:1078#0/1
]fffafdab`]]]^[^^c^a^_^bb]`b]b`BB
@HWUSI-EAS1795_0092:3:1:15094:1079#0/1
GTTGGTTGTCAGCCAGAAGGTCTTGTCATTTCT
+HWUSI-EAS1795_0092:3:1:15094:1079#0/1
gggggcggggggggcfecffZcbadbbggggca
@HWUSI-EAS1795_0092:3:1:15511:1072#0/1
CTCGTAGTCCACATTGCGTGCCTTGATCTGCTT
+HWUSI-EAS1795_0092:3:1:15511:1072#0/1
hhhhhhhhhhhhhhhghhghhhhdhehhhhhhh
@HWUSI-EAS1795_0092:3:1:15554:1077#0/1
AAAATACCAGAGCGGACAACATCAGGCCACAGA
+HWUSI-EAS1795_0092:3:1:15554:1077#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhchhhhhgh
@HWUSI-EAS1795_0092:3:1:15658:1081#0/1
CACACAACGTGCGAAAGAAGGAACGGGGAAGAA
+HWUSI-EAS1795_0092:3:1:15658:1081#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15912:1071#0/1
CTTCAATCCAGGTGCGCCGGGGAAGCCATCCTG
+HWUSI-EAS1795_0092:3:1:15912:1071#0/1
hhhhhhhhhhhhhhhhhhhghhhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:16002:1071#0/1
AAATAAACTACTAAATGATGGCAGTGCCTCAAT
+HWUSI-EAS1795_0092:3:1:16002:1071#0/1
ghhhhhhhhhhhhhhhhhghghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16038:1071#0/1
CTTAAATAACTTATTTAACTTAACATTATTCGG
+HWUSI-EAS1795_0092:3:1:16038:1071#0/1
hghghhhhhhhffhhhghhhhhhghghhhhhgf
@HWUSI-EAS1795_0092:3:1:16091:1074#0/1
CTGACGACGACATGGGCTTCGGTCTGTTCGACT
+HWUSI-EAS1795_0092:3:1:16091:1074#0/1
fggggffggcgggggdggggggafffegggggf
@HWUSI-EAS1795_0092:3:1:16588:1077#0/1
CCTCGATCTTCTCCTGCAGCAAATCGATGGACA
+HWUSI-EAS1795_0092:3:1:16588:1077#0/1
fggggggggggcffcffggggggfgcggge_gf
@HWUSI-EAS1795_0092:3:1:17157:1075#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17157:1075#0/1
ffffadfffdafadaeedffffRdedcf_fffg
@HWUSI-EAS1795_0092:3:1:17358:1074#0/1
TTTCTATCAATTTCACTACCAGCCCAATCAGAA
+HWUSI-EAS1795_0092:3:1:17358:1074#0/1
_cff`ca`Y`cca^YYafdffa]d^dd[ddcca
@HWUSI-EAS1795_0092:3:1:17420:1076#0/1
AAGCTCTACAACTTGAGCAAGGAAGATGATGTG
+HWUSI-EAS1795_0092:3:1:17420:1076#0/1
hhhhhhhhhghgfffhhhghghehhhdfhgggd
@HWUSI-EAS1795_0092:3:1:17902:1081#0/1
ATAAAACAGAACGGCTGACTCGGATTCGGAATC
+HWUSI-EAS1795_0092:3:1:17902:1081#0/1
gggggggggcggggggaffdfffaeeeggaggc
@HWUSI-EAS1795_0092:3:1:19735:1080#0/1
AAAAGCCGACCTGGTCATCCTTGGCAAGCAGGC
+HWUSI-EAS1795_0092:3:1:19735:1080#0/1
ggggggcffffc]fffffffff_fddf^da^Wd
@HWUSI-EAS1795_0092:3:1:1315:1085#0/1
TGACAGGCATCTTATATAATGGCTATTTCTTGG
+HWUSI-EAS1795_0092:3:1:1315:1085#0/1
ffddafa\cedefaggceafd`fffffa_ffcg
@HWUSI-EAS1795_0092:3:1:1970:1090#0/1
AACGAGGCTATCTACGACATCTGCCGCCGCAAT
+HWUSI-EAS1795_0092:3:1:1970:1090#0/1
V]cRaRRaaa`a\\aIaT_BBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2904:1094#0/1
CCTGGTCAAAGGGATCCTCAATCGAGACGATGG
+HWUSI-EAS1795_0092:3:1:2904:1094#0/1
hhfffcffffffhhhhghhhhghfhachghghh
@HWUSI-EAS1795_0092:3:1:3370:1085#0/1
ACTTGAGCGGCGCACAACTCAACGGAATCAAGT
+HWUSI-EAS1795_0092:3:1:3370:1085#0/1
ffcSaca_W`__fffffffdff_a_a\`Qa_Wd
@HWUSI-EAS1795_0092:3:1:3760:1085#0/1
CGGGCTCGATGTTGATGGAGGTAATCTTCTTGA
+HWUSI-EAS1795_0092:3:1:3760:1085#0/1
gggdfgffaffffffa_ffffaffdfffddccf
@HWUSI-EAS1795_0092:3:1:3930:1094#0/1
CGCCCTTCATGAACACGTTTATGTCCTCCTCCA
+HWUSI-EAS1795_0092:3:1:3930:1094#0/1
^acccccZR]b^^VaXa]aaXV[aaaPccc_cc
@HWUSI-EAS1795_0092:3:1:4246:1089#0/1
TGCCCACGGTCCTTTCGCGAATCCGGGAGTCGG
+HWUSI-EAS1795_0092:3:1:4246:1089#0/1
hghhhhhhhhhhhhhhdhhghdhhhhghffhff
@HWUSI-EAS1795_0092:3:1:5010:1086#0/1
AGCCGGTTAGGTGCATAATTAGCTGGCGATAGT
+HWUSI-EAS1795_0092:3:1:5010:1086#0/1
dffcfcff_fdeccfff^ffddggggg_cgg_g
@HWUSI-EAS1795_0092:3:1:5047:1087#0/1
GAAAAATTGTAAAAGTGACCGAAAAAACTATAC
+HWUSI-EAS1795_0092:3:1:5047:1087#0/1
hhhhhhhhghhhffffchhghhhhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:5256:1088#0/1
CGATGCTGCCGTGCCTGCTCTAACCGCCACGGT
+HWUSI-EAS1795_0092:3:1:5256:1088#0/1
gggggggfggggggggggfggfggggggggggf
@HWUSI-EAS1795_0092:3:1:6253:1091#0/1
CCGTACCTGCGGTTCCTCTCGTACTACGCAGGA
+HWUSI-EAS1795_0092:3:1:6253:1091#0/1
ggggggggggggcgggefdfadgggggfggfgf
@HWUSI-EAS1795_0092:3:1:6303:1086#0/1
CTTGCCCTTTTTGGCCGACTTGGCCACCTTTTT
+HWUSI-EAS1795_0092:3:1:6303:1086#0/1
\ZZ\aaa[ddWaffcc[^d`d`ffaffceff[e
@HWUSI-EAS1795_0092:3:1:6598:1093#0/1
ATCAAGATGGCCACCGTAAACGTAAACCGCAGT
+HWUSI-EAS1795_0092:3:1:6598:1093#0/1
hhhhhhhdhhhhhhhhhhhhhhhhhhhhghcgh
@HWUSI-EAS1795_0092:3:1:6841:1092#0/1
CAGCTATGTAGTAGTTGCCCGGAAAATCAATTC
+HWUSI-EAS1795_0092:3:1:6841:1092#0/1
hhhhhhhhhhehhghhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7011:1084#0/1
GGGCGGTTGACGGTGTCGCGGGAGAAGTAGGCG
+HWUSI-EAS1795_0092:3:1:7011:1084#0/1
fffgggggggggfcfcffafffddfdebggg][
@HWUSI-EAS1795_0092:3:1:7068:1088#0/1
GTAATTGTAGGATCCCAGATTTAAGCAACGTGT
+HWUSI-EAS1795_0092:3:1:7068:1088#0/1
ggggggfggfgggggggcfffcggggggggeaf
@HWUSI-EAS1795_0092:3:1:7275:1083#0/1
CCCAGTTCTCCACACTCCTCGTTGTCCAAGTCA
+HWUSI-EAS1795_0092:3:1:7275:1083#0/1
hhhfhhhhhhhhhghhhhhhghghghhhhhhhh
@HWUSI-EAS1795_0092:3:1:7473:1094#0/1
CGAACTTGTTCACTTGTTTACAAAAAAGGTAGG
+HWUSI-EAS1795_0092:3:1:7473:1094#0/1
a^dddbb[dbd]^^^[^d``]ddd`XX\b]bbW
@HWUSI-EAS1795_0092:3:1:7919:1085#0/1
TTCAGGCCAAGGAACAGCAAAAGTGGTTAGAAA
+HWUSI-EAS1795_0092:3:1:7919:1085#0/1
hhhghhhhhghhghgghhhhhhhehhhUYUaab
@HWUSI-EAS1795_0092:3:1:8255:1091#0/1
GTGGTTCCCTATTTGCACGGACCCGTGGACAAT
+HWUSI-EAS1795_0092:3:1:8255:1091#0/1
gggggggggggaggaggggggggggegfggggg
@HWUSI-EAS1795_0092:3:1:8297:1083#0/1
AAAAACCCCACCTTTAACCCCCCGAAAAGAACC
+HWUSI-EAS1795_0092:3:1:8297:1083#0/1
gggedfgff_`c_fcdf_fdffdfffffWf`_f
@HWUSI-EAS1795_0092:3:1:9386:1087#0/1
TTCTTCTTGATGTAAGAGGACACTTCCTTCTTG
+HWUSI-EAS1795_0092:3:1:9386:1087#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9702:1083#0/1
CTGGCCCCACTCCGCACCAGGAACTGTATGATT
+HWUSI-EAS1795_0092:3:1:9702:1083#0/1
gggggggggggggfgggfdcgggdggggggagg
@HWUSI-EAS1795_0092:3:1:9919:1091#0/1
AAAAGAAGAGATCACCGTGGCATCGCACCGAGG
+HWUSI-EAS1795_0092:3:1:9919:1091#0/1
hhhhhfhhh]hhhhhhhhghghhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:10320:1094#0/1
CCCAGTCCAAGCTGACGAGCAGCTCCGCCGTGA
+HWUSI-EAS1795_0092:3:1:10320:1094#0/1
gdgggggcff_cb`bcdfffeedWbd`bbb]_d
@HWUSI-EAS1795_0092:3:1:10407:1093#0/1
TTCGACTGCGATCCTCAAACCAGCACAGCAAAA
+HWUSI-EAS1795_0092:3:1:10407:1093#0/1
hehhhhhhhgcghhgghhhhhhfghhdgdhhhf
@HWUSI-EAS1795_0092:3:1:10435:1090#0/1
TCCGTGCCGGCGAGTCCTCTCTGGAGGAGTGCA
+HWUSI-EAS1795_0092:3:1:10435:1090#0/1
gggggdgfafffafcffffaffafacdafddfg
@HWUSI-EAS1795_0092:3:1:11069:1086#0/1
ATTTTCGACTTCTCGAATGCTTTCCAGTACCTT
+HWUSI-EAS1795_0092:3:1:11069:1086#0/1
hhhhhhhhhhhhhhhhhefhhhghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:11305:1084#0/1
CTGGCATCGTTTATGGTTAGAACTAGGGCGGTA
+HWUSI-EAS1795_0092:3:1:11305:1084#0/1
hhhhhhhhhhhhhghhhhfchhhhhhhhfhg`h
@HWUSI-EAS1795_0092:3:1:11540:1093#0/1
GGATAAGAAGCCAGAGGTTGCTACAGAGGCTGA
+HWUSI-EAS1795_0092:3:1:11540:1093#0/1
WZaa^Zad`c]cWW___aadaaddd^daaaXba
@HWUSI-EAS1795_0092:3:1:11786:1090#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11786:1090#0/1
hhhhhhhhhhhefeghhhhhhghhhghgghhgh
@HWUSI-EAS1795_0092:3:1:11849:1087#0/1
TAGGCATGATACCGGTAGAAGCTCATGCATCGT
+HWUSI-EAS1795_0092:3:1:11849:1087#0/1
hghhhhghhhhhhhhhhghhhhfghgghhhhhg
@HWUSI-EAS1795_0092:3:1:11874:1087#0/1
AAAGTTTAGTATCACAACGACAAGTAATTTACC
+HWUSI-EAS1795_0092:3:1:11874:1087#0/1
fgdgggggggdgggggggggggggfgggfgggg
@HWUSI-EAS1795_0092:3:1:12051:1086#0/1
ATTTAACATGGAAAATTGTAATGCAGTTAGTAC
+HWUSI-EAS1795_0092:3:1:12051:1086#0/1
gggggggfgfaafffffdffffgggegggcggg
@HWUSI-EAS1795_0092:3:1:12989:1084#0/1
CTGAACACCATTGCACCACAGAATTTCGGGTAT
+HWUSI-EAS1795_0092:3:1:12989:1084#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhgghd
@HWUSI-EAS1795_0092:3:1:13017:1083#0/1
CAAGGCCAGGAACGACGACAGCAAGGTGAACAC
+HWUSI-EAS1795_0092:3:1:13017:1083#0/1
ggffcffgggggfdffdgfgggff]aa`dddbf
@HWUSI-EAS1795_0092:3:1:14303:1093#0/1
CCGGGGACTATTAAGCTAGGGAAGGTGTTAGTA
+HWUSI-EAS1795_0092:3:1:14303:1093#0/1
ggggaggggggggggggafffafffaafffffg
@HWUSI-EAS1795_0092:3:1:14332:1092#0/1
TCGGAAGATGGCGTCTAAATCGCTGGCGAAAAT
+HWUSI-EAS1795_0092:3:1:14332:1092#0/1
hhhhgfhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:14513:1087#0/1
CTCACGGTTCTTGCGCTTCCAAGCAGCACGCCT
+HWUSI-EAS1795_0092:3:1:14513:1087#0/1
hhhhhhghhhhhhhhhhhhhghfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14689:1093#0/1
GCAAGGACTTACTGTGCACCGTTCTCAAGGCGT
+HWUSI-EAS1795_0092:3:1:14689:1093#0/1
d_fcfff^aaadbdddaZ]]`Ydbb`bcfecfb
@HWUSI-EAS1795_0092:3:1:15058:1092#0/1
GTTTCTCCTCGTCGATTTCGGTCTGGCCCAGCA
+HWUSI-EAS1795_0092:3:1:15058:1092#0/1
hhhhhfhhhfchhhhhghhedghccagghhchf
@HWUSI-EAS1795_0092:3:1:15228:1087#0/1
GTTCACCTTCCTGGACAAGAAGTGCGAGCGCTC
+HWUSI-EAS1795_0092:3:1:15228:1087#0/1
hhhhhhhhhhhhhhhhhghhhhghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15828:1093#0/1
CTCCCTGACCCTTGCTGACTTTCAGGACGTTGA
+HWUSI-EAS1795_0092:3:1:15828:1093#0/1
hhhhhhhghhhhhhhhhfffffbddbdfffffh
@HWUSI-EAS1795_0092:3:1:15998:1092#0/1
GTGCGATCCCCGTCACGGCAAGTACATGGCCTG
+HWUSI-EAS1795_0092:3:1:15998:1092#0/1
ffgggggggggggggggggggg`fffcccfccd
@HWUSI-EAS1795_0092:3:1:16032:1090#0/1
GGCGAGTATGTGGTCTGAGTCAGTCGTCACCTG
+HWUSI-EAS1795_0092:3:1:16032:1090#0/1
hghhhhhfhghhhffhfhhhhhfhghhghhggh
@HWUSI-EAS1795_0092:3:1:17581:1085#0/1
ATGACGCAGTGCGTCGGTACATTGAATCGTGTA
+HWUSI-EAS1795_0092:3:1:17581:1085#0/1
dffffcff_acf^^a^aU^`[]`db``cfacbZ
@HWUSI-EAS1795_0092:3:1:18002:1083#0/1
GCATCGTACAGTACCATCGCACCGACGATTATC
+HWUSI-EAS1795_0092:3:1:18002:1083#0/1
hhhhhhhhhhhhhhghghhhhhhhahhhhhhgh
@HWUSI-EAS1795_0092:3:1:18039:1086#0/1
GCCAGCTGGCTGCGCTGTCCCGGCTAGCCTGGA
+HWUSI-EAS1795_0092:3:1:18039:1086#0/1
aggfcgcff[f_dddbbaadd[YQIYY`a^da`
@HWUSI-EAS1795_0092:3:1:18068:1084#0/1
ACGCTGACCACGCAGTTTGCCGGACACGACAAC
+HWUSI-EAS1795_0092:3:1:18068:1084#0/1
fffggdgggffgeagggagggggggggcgggag
@HWUSI-EAS1795_0092:3:1:18652:1083#0/1
CCTTAGCCTCGTACTTGGCAATCACATCGGCAT
+HWUSI-EAS1795_0092:3:1:18652:1083#0/1
ffcff[fd^d[^^YY[RYa``^`d`[`aXa[Oa
@HWUSI-EAS1795_0092:3:1:18981:1091#0/1
GCTAAACGTAATATTAAGCCGTTTGATGGCGAG
+HWUSI-EAS1795_0092:3:1:18981:1091#0/1
hchhhhhhhghhhdhghghghhhhhffhhghhg
@HWUSI-EAS1795_0092:3:1:19781:1089#0/1
CTTAACCTTACCGCGATGGCGAGCTGAGCGCTT
+HWUSI-EAS1795_0092:3:1:19781:1089#0/1
fbfdffc]]dddQ]TTVKWVWL]d`^BBBBBBB
@HWUSI-EAS1795_0092:3:1:1906:1094#0/1
CGGGAATAACTTCGCCAGCCGGGCCACGGTCAC
+HWUSI-EAS1795_0092:3:1:1906:1094#0/1
fgffaffffff]ffdfffgggggccgecfdede
@HWUSI-EAS1795_0092:3:1:1987:1099#0/1
AACGAGGCTATCTACGACATCTGCCGCCGCAAT
+HWUSI-EAS1795_0092:3:1:1987:1099#0/1
aa\Y\XS\N\X_c_c^^U\\^\caf_BBBBBBB
@HWUSI-EAS1795_0092:3:1:2360:1101#0/1
AAACCACAGCTCTAGACAAGTGCGAAAATCGAA
+HWUSI-EAS1795_0092:3:1:2360:1101#0/1
a^cfffffffcfffWffded^d\N\\_^^a^bf
@HWUSI-EAS1795_0092:3:1:2556:1105#0/1
GGAGCGCCTTTCCAGCAGGCCGGAGCGGGGGAC
+HWUSI-EAS1795_0092:3:1:2556:1105#0/1
ccaKScaaYaY\`ab]aLIY\\^a`aBBBBBBB
@HWUSI-EAS1795_0092:3:1:2943:1101#0/1
TGGTGGGGGAACACCTAATGCCGCTCGCCACCA
+HWUSI-EAS1795_0092:3:1:2943:1101#0/1
ggf_ffc`ggggfggggff[cf^a\d`ff[ffY
@HWUSI-EAS1795_0092:3:1:3083:1095#0/1
CTCGCGTTTCTTGTAGCTCAAATCCTTGGGCGT
+HWUSI-EAS1795_0092:3:1:3083:1095#0/1
ggdfcffaffaffcfac`edecX``]Z^d^`bc
@HWUSI-EAS1795_0092:3:1:3173:1099#0/1
CAGGAGCGAGTTGCCGCTTACGCCGCCAAGAAG
+HWUSI-EAS1795_0092:3:1:3173:1099#0/1
ggfddcf[c`afdff]eadffW]^H^^BBBBBB
@HWUSI-EAS1795_0092:3:1:3194:1105#0/1
CGGCGCACCGCCGTCGTGGCGTGCATCTCGTGT
+HWUSI-EAS1795_0092:3:1:3194:1105#0/1
affSfdffSfcffadff__BBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3320:1104#0/1
CTTCTCTTCCTCCAGCTCTCGCTGCATAGCCTC
+HWUSI-EAS1795_0092:3:1:3320:1104#0/1
a[]`V`]X`a]^cccaBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4334:1102#0/1
GCGGCTGCCATGGCCGCCGTCTGCCAAATGCAG
+HWUSI-EAS1795_0092:3:1:4334:1102#0/1
W^WZ]VUZ]]SV[^BBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:6820:1098#0/1
GCTTCGAGGACCTGCTCCTCGCTGATTGGGATG
+HWUSI-EAS1795_0092:3:1:6820:1098#0/1
hhhhhhhhhhhhghhhhhhhggghdhhefhhfg
@HWUSI-EAS1795_0092:3:1:6939:1105#0/1
AAAATTCACGTTTGGCGAATCCTAGAGATACCC
+HWUSI-EAS1795_0092:3:1:6939:1105#0/1
hhhhhhhhhhhhhhhhhhhghhghhhdhhhhhh
@HWUSI-EAS1795_0092:3:1:7455:1096#0/1
AAAACAGCTCCGAGAAGAAGGTGCAGGAGTACT
+HWUSI-EAS1795_0092:3:1:7455:1096#0/1
hhhhhhghhhhhhhfhfffhhchhghhhhgghh
@HWUSI-EAS1795_0092:3:1:7557:1101#0/1
TTCGGCTCGTCGACAACTGCTGCAGCTGGTGGC
+HWUSI-EAS1795_0092:3:1:7557:1101#0/1
gggfgggggggadfffff]fdfd]ddcddbefg
@HWUSI-EAS1795_0092:3:1:8434:1102#0/1
CGAAGACGATGTCACCGACGAAGACTCTGCCGA
+HWUSI-EAS1795_0092:3:1:8434:1102#0/1
ffdfffffcf__fffffcf_ffafdff]ccfff
@HWUSI-EAS1795_0092:3:1:9299:1096#0/1
GTCCGAGGAGAAAATATCGACACAACAGTATAT
+HWUSI-EAS1795_0092:3:1:9299:1096#0/1
hhhhhghhhehhhhchhhhhghhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:9439:1095#0/1
CAGCAGCAGAAGCAGGAGAAGAAGCCCAAGGAA
+HWUSI-EAS1795_0092:3:1:9439:1095#0/1
gggggfgggfgggggggggffgggggggggcgg
@HWUSI-EAS1795_0092:3:1:9965:1095#0/1
CGAGACCGCCACCCGTCATGTGCTCCTGCGCCA
+HWUSI-EAS1795_0092:3:1:9965:1095#0/1
[a\cccccdcddc__dccccdddWdda^^\aa]
@HWUSI-EAS1795_0092:3:1:10665:1096#0/1
GAAGAAGAAGTGGTCCAAGGGAAAAGTCAGGGA
+HWUSI-EAS1795_0092:3:1:10665:1096#0/1
hhhhhhhhhghhhghhhghhhhhhhhfhhhggh
@HWUSI-EAS1795_0092:3:1:10689:1104#0/1
GTGCACACAAACGCCGGGCCACCGGAGGCAAGC
+HWUSI-EAS1795_0092:3:1:10689:1104#0/1
gggggggggggefggfccffffgfeggfcga[e
@HWUSI-EAS1795_0092:3:1:11234:1099#0/1
TTGCAATGATATCAACTGGCGTATCGTACTTCT
+HWUSI-EAS1795_0092:3:1:11234:1099#0/1
hhhhhhhhhhhhhhhhhhhhghghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11974:1106#0/1
TTAAAACTAAACCTAAAAGAAATCTGTACATTA
+HWUSI-EAS1795_0092:3:1:11974:1106#0/1
ggffdffgggegfgaggf_ffccfdcffccfac
@HWUSI-EAS1795_0092:3:1:12176:1098#0/1
CGTGGATGAGAAGGATATCGAGCTGGTCATCAC
+HWUSI-EAS1795_0092:3:1:12176:1098#0/1
eccfdcffddefdffbcffaddcafcaggfggd
@HWUSI-EAS1795_0092:3:1:12482:1099#0/1
ATGCGCTCGTTGTAGCGCTTCACGGACTCCTCG
+HWUSI-EAS1795_0092:3:1:12482:1099#0/1
fceffffgggeggggg[ggggaBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12925:1105#0/1
AAGGAGTTTCGACGGATACGAATGCTAAATGCA
+HWUSI-EAS1795_0092:3:1:12925:1105#0/1
gggggggggefg_ffacfffcfWffffff]fff
@HWUSI-EAS1795_0092:3:1:13148:1104#0/1
GTGAAGTAGGGTATCCACAGGTCCTCGATGCTC
+HWUSI-EAS1795_0092:3:1:13148:1104#0/1
hhhhhghhhhhfhghhgfhhheghfghhghhhh
@HWUSI-EAS1795_0092:3:1:13171:1100#0/1
AGGGCCTGGAGCTGCAGGAAGTAAATCACCATC
+HWUSI-EAS1795_0092:3:1:13171:1100#0/1
hhhhhhhhhhhhhghhfhffh_fhheghhdhgh
@HWUSI-EAS1795_0092:3:1:13221:1101#0/1
ATCATGGATGTGGCCGACTTCGAGAAGTACATC
+HWUSI-EAS1795_0092:3:1:13221:1101#0/1
gfggffgfafafggggaggdggeegfeKa__Zb
@HWUSI-EAS1795_0092:3:1:13340:1099#0/1
CTCCTTGTCCTTTTCGTTGGCTTTTGTGTCCGT
+HWUSI-EAS1795_0092:3:1:13340:1099#0/1
ggggggggggfgggggdgcggggggggcefffd
@HWUSI-EAS1795_0092:3:1:13403:1102#0/1
CCAAAAACGGACAAAAGACAAATGGTTACGTGA
+HWUSI-EAS1795_0092:3:1:13403:1102#0/1
hhhhhhhhhhhhhhhhghhhhhghhghBBBBBB
@HWUSI-EAS1795_0092:3:1:14051:1102#0/1
TTGGTCGTCTTGCAGCAAACCCAATTTGTCTCG
+HWUSI-EAS1795_0092:3:1:14051:1102#0/1
hhhhhhfhhhffhfhfhhhfhhhhhhdcghhhh
@HWUSI-EAS1795_0092:3:1:14123:1104#0/1
CGCGGAAGAGCTTTCCGCTATAAACTTCCGGCA
+HWUSI-EAS1795_0092:3:1:14123:1104#0/1
dfgggggdacgggfgggcggggggggggggceg
@HWUSI-EAS1795_0092:3:1:14376:1101#0/1
CAAATTTTAAGTCTGTTCGACTTTTAAATTCTT
+HWUSI-EAS1795_0092:3:1:14376:1101#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:14441:1105#0/1
CTTGGCCACCGACTTCGCCGTTCTCGTGAAGTC
+HWUSI-EAS1795_0092:3:1:14441:1105#0/1
hhhchhhhhhhhhhhhhhhhhhgghhhghgffh
@HWUSI-EAS1795_0092:3:1:15260:1097#0/1
CTTTAGAGTTGCAGTGTTTGTTTTCGGATTCGG
+HWUSI-EAS1795_0092:3:1:15260:1097#0/1
hhhhfhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15534:1105#0/1
GGGGTTACGCTTGCGTCCCAGGGGCAGCACGTA
+HWUSI-EAS1795_0092:3:1:15534:1105#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhfg
@HWUSI-EAS1795_0092:3:1:15597:1101#0/1
GGGCGCTGTGTCCTTGTTGCTTCTTCAGTTTGG
+HWUSI-EAS1795_0092:3:1:15597:1101#0/1
cggfgggacddefffffg_gggfggfgcgfg]d
@HWUSI-EAS1795_0092:3:1:15774:1095#0/1
CTGGGAAGTCCCTTTTCAGTGTGTGATCGAAAA
+HWUSI-EAS1795_0092:3:1:15774:1095#0/1
hhhhhhhhhhhhhhhhhhghhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15876:1104#0/1
TGCAGACCCGCCCCGAATCCAAAAGTTGCGAAT
+HWUSI-EAS1795_0092:3:1:15876:1104#0/1
ffeccffffcfcfccaccffcccf]ca]bbW`d
@HWUSI-EAS1795_0092:3:1:16523:1101#0/1
GCGTGAAATTGACGGTGGCCTGGAGACAATCAA
+HWUSI-EAS1795_0092:3:1:16523:1101#0/1
ggggggggggeggggedcffdaffffafffdfd
@HWUSI-EAS1795_0092:3:1:16650:1096#0/1
TCACCATCGGCAACGAGCGTTTCCGCTGCCCCG
+HWUSI-EAS1795_0092:3:1:16650:1096#0/1
gggggggfgggggggggcgggggggcgffffc_
@HWUSI-EAS1795_0092:3:1:17422:1102#0/1
GGGCAACTGGCAGGCGCGCACAGCCACGAGCTG
+HWUSI-EAS1795_0092:3:1:17422:1102#0/1
gdgggggggggggegeaff_f__ffddaaccaf
@HWUSI-EAS1795_0092:3:1:17892:1099#0/1
CTGCCAAGAGGTCAGATTGTCGATCTGAAGTTG
+HWUSI-EAS1795_0092:3:1:17892:1099#0/1
hheehhhdfffdhghgefhhhhfhhhhhedech
@HWUSI-EAS1795_0092:3:1:18401:1099#0/1
GCCAGCTCCCGCCGTGAGTAGTTGCGCACGCGC
+HWUSI-EAS1795_0092:3:1:18401:1099#0/1
hhhhhhhhhhhhhhghhhdhfghghhhfhfged
@HWUSI-EAS1795_0092:3:1:18633:1102#0/1
GCACGGAAACAGCAACGAGCTGACTGTCCAAGC
+HWUSI-EAS1795_0092:3:1:18633:1102#0/1
ggfggfggfggggggggagaegfeffeg]ggeg
@HWUSI-EAS1795_0092:3:1:19173:1098#0/1
ACGAAAAGTCCGCTTTCCTCGCTCATTAGCGGC
+HWUSI-EAS1795_0092:3:1:19173:1098#0/1
ggfggg\ffffagcggffffffggggggggggg
@HWUSI-EAS1795_0092:3:1:19217:1098#0/1
CAGATATGGCCATCAGGTGCCGGTGAAGCGGAA
+HWUSI-EAS1795_0092:3:1:19217:1098#0/1
hhhhhhhhhhhhhhhhhfhghhfbfffhfhggh
@HWUSI-EAS1795_0092:3:1:19499:1103#0/1
GCGCGCTGGGAATGCGCGGACGCGACGACACGG
+HWUSI-EAS1795_0092:3:1:19499:1103#0/1
hhhhhhhhghhhghhhgggccgdfWdfW`cccc
@HWUSI-EAS1795_0092:3:1:19671:1094#0/1
CGGCGATTTATCGCTGGAAAAGAATGCCGAATA
+HWUSI-EAS1795_0092:3:1:19671:1094#0/1
hdcfcfafffffhchhfcfcffcfcffdfhhhf
@HWUSI-EAS1795_0092:3:1:1658:1111#0/1
CAGCAATTAGCACGGCATCCTGCGAGGGTAGGA
+HWUSI-EAS1795_0092:3:1:1658:1111#0/1
gfgeefgWeaeeccfcccfffffW_fffdfacg
@HWUSI-EAS1795_0092:3:1:1727:1107#0/1
CAGCAATCGCTGCAGCGTCAGCGAAAGCGAAAT
+HWUSI-EAS1795_0092:3:1:1727:1107#0/1
fffffffccRWda\\[\JYWTQa^aaBBBBBBB
@HWUSI-EAS1795_0092:3:1:1753:1107#0/1
ATGCCATTAAGGGCTATGTTAAGCAAGGCCTGA
+HWUSI-EAS1795_0092:3:1:1753:1107#0/1
fchfhfhehhhfahhhhghfhhhchhgdfa_ef
@HWUSI-EAS1795_0092:3:1:2780:1116#0/1
TGGTGTTGTTGGCTGCATTATGATGTTGGTTAT
+HWUSI-EAS1795_0092:3:1:2780:1116#0/1
cWZd`Y[^\U\[a^cffYZaaT\ccdda_^dac
@HWUSI-EAS1795_0092:3:1:4464:1116#0/1
GAAAAGTTCTACTATTGAAATTTTGTAATTGTA
+HWUSI-EAS1795_0092:3:1:4464:1116#0/1
ggggfgddfcfddggcggggggggfegfggdff
@HWUSI-EAS1795_0092:3:1:4904:1117#0/1
CACTCAACAACAACAACAACACGCAGTAGTAGC
+HWUSI-EAS1795_0092:3:1:4904:1117#0/1
hhhdchcfffffdhhhfghhhfghhhhfhhgfh
@HWUSI-EAS1795_0092:3:1:5044:1106#0/1
CCTGCATGTCCTTGGATGTCAGATCCTCATAGT
+HWUSI-EAS1795_0092:3:1:5044:1106#0/1
c_\Z^_aWVP^TJSSOS]]`\]Z\a^\aa[]c]
@HWUSI-EAS1795_0092:3:1:5324:1111#0/1
CAAAAGAAGAAGGAGGGATCCGGCGGCGGCAAG
+HWUSI-EAS1795_0092:3:1:5324:1111#0/1
hhhhhhghghhhhhhhhfhhhhfhhhhhehfdh
@HWUSI-EAS1795_0092:3:1:6076:1115#0/1
CCGCCTTGGTAACCGCGTGCTGGTCAATATCCT
+HWUSI-EAS1795_0092:3:1:6076:1115#0/1
hhhhhhhhhhfhhhhhghhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:6547:1114#0/1
GGCCATTCATATCAAATATAAAGTAGTGTTGTT
+HWUSI-EAS1795_0092:3:1:6547:1114#0/1
ebc_daefdff_b]d]eacdbbefffa^a_^cf
@HWUSI-EAS1795_0092:3:1:6747:1109#0/1
CCTAGCCTAGCAAAAAAAAAAAAAGTGGGTTGA
+HWUSI-EAS1795_0092:3:1:6747:1109#0/1
hhhhhhhhhhghhhhghhhghhc`c_fffcac`
@HWUSI-EAS1795_0092:3:1:7318:1109#0/1
GGTGATCAACGCCACGCTTCTGGGCAATGACTG
+HWUSI-EAS1795_0092:3:1:7318:1109#0/1
ffffffffffffdbW`adaa[dd`adBBBBBBB
@HWUSI-EAS1795_0092:3:1:7599:1111#0/1
GGTGGCAAGGGCGACAGCAAGGACAAGTAAGCT
+HWUSI-EAS1795_0092:3:1:7599:1111#0/1
hhehhhhhghhhhghhgehhhhhghhdghhhgh
@HWUSI-EAS1795_0092:3:1:7833:1108#0/1
TAAGGTTGCACCCCTGCTGAAACTATTGGAGCA
+HWUSI-EAS1795_0092:3:1:7833:1108#0/1
fggggffgfggggcggegafeggggggeacggc
@HWUSI-EAS1795_0092:3:1:8037:1116#0/1
CATAGCGGCTCGCAACAGTCGAAGACTTTGTTC
+HWUSI-EAS1795_0092:3:1:8037:1116#0/1
gggggggggdgcf]fWfZYa\^e^a[dffWfce
@HWUSI-EAS1795_0092:3:1:8410:1108#0/1
ATTTAACCAAGTCGATGACGGGAGCCTTGGTGC
+HWUSI-EAS1795_0092:3:1:8410:1108#0/1
fffffffggggfgeggfaggegcffafaf[aac
@HWUSI-EAS1795_0092:3:1:8656:1117#0/1
TCGTCGTCTACCTCATCGCATATGGTTCCGCGG
+HWUSI-EAS1795_0092:3:1:8656:1117#0/1
hhhhhhhhhhhhghhhhhhhfghhehghhfhhg
@HWUSI-EAS1795_0092:3:1:8805:1109#0/1
GCTGTTCTCGTCGCGCAAATCAATCTGTGTGCC
+HWUSI-EAS1795_0092:3:1:8805:1109#0/1
hhhhhhhhhhhhhhhhhhhhfghfhhghhghhh
@HWUSI-EAS1795_0092:3:1:8966:1112#0/1
CTCGGCACGCAGACGCTCGCGACGATCCTTCTT
+HWUSI-EAS1795_0092:3:1:8966:1112#0/1
ffffdffcffffaffcfg_fgedfaaeccaccf
@HWUSI-EAS1795_0092:3:1:9809:1114#0/1
GTGCACCCATCATTTCTACAACTAATTTATTGA
+HWUSI-EAS1795_0092:3:1:9809:1114#0/1
ffcafffcddaaddeccfffcfafcfdfdfYca
@HWUSI-EAS1795_0092:3:1:10480:1107#0/1
TGTTGCCTCCATAAGTGCACTCTTCTCTTCGAT
+HWUSI-EAS1795_0092:3:1:10480:1107#0/1
ggggfggcffffdffafggggfggeeggggggg
@HWUSI-EAS1795_0092:3:1:10507:1113#0/1
CTTCTCGACAACCGGACATCCGTTGTGTTTGTG
+HWUSI-EAS1795_0092:3:1:10507:1113#0/1
hhhhghhghhhhhhhchhhhhhhgefhhhgecg
@HWUSI-EAS1795_0092:3:1:10869:1117#0/1
CCCGAATTACTTGAAGAAGAACTTTCAGATTCA
+HWUSI-EAS1795_0092:3:1:10869:1117#0/1
gcgffgggggfgdffadc]eedgggcggagcgf
@HWUSI-EAS1795_0092:3:1:10892:1111#0/1
GCGTCATTAAGGCTGTCAACTTCAAGGATGCCT
+HWUSI-EAS1795_0092:3:1:10892:1111#0/1
hhhhhhhhhhhfhhhhhghhhhhhhhgdhhhhe
@HWUSI-EAS1795_0092:3:1:11558:1110#0/1
CTGGTCCCTTCACGTTTCGGATAATCTGGCGGT
+HWUSI-EAS1795_0092:3:1:11558:1110#0/1
ggf]cffggggcggggggggggggegcfefee_
@HWUSI-EAS1795_0092:3:1:12336:1113#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:12336:1113#0/1
hhhhhhhhhhhfhhhhhgghgfhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:13053:1113#0/1
TCCATCCGCAAGAGGCTCAAAGCATTCTTACCG
+HWUSI-EAS1795_0092:3:1:13053:1113#0/1
hhhhhhhhhhhhhhhhghhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13116:1107#0/1
GGGATTTCCAGCCAGACTGAGCTTAGTCAGCTC
+HWUSI-EAS1795_0092:3:1:13116:1107#0/1
gggfggfggggggggggggcegfgggfgggggg
@HWUSI-EAS1795_0092:3:1:13524:1114#0/1
CTAAGCTTACTTCTTCTTGGACACACCCACGGT
+HWUSI-EAS1795_0092:3:1:13524:1114#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhd
@HWUSI-EAS1795_0092:3:1:13585:1109#0/1
TAAAAAATGGGCGACAACGTGGTGACGGAACTA
+HWUSI-EAS1795_0092:3:1:13585:1109#0/1
hghhhhhhhhhhhhhhhhhhhfeghfhdhhhgh
@HWUSI-EAS1795_0092:3:1:14846:1113#0/1
TTCGAAAATGCTTGCCTCTCAAGAAATGAAATA
+HWUSI-EAS1795_0092:3:1:14846:1113#0/1
hhhhhhhhghhhhhhhhhhhghhhhehhhhhfh
@HWUSI-EAS1795_0092:3:1:15476:1109#0/1
CTGAGTAGGTTGAGGATGATTTCCCCACTGAGG
+HWUSI-EAS1795_0092:3:1:15476:1109#0/1
gefffdcffffc[ffcafafffgggggeggggg
@HWUSI-EAS1795_0092:3:1:16238:1115#0/1
CACGCCCTTCCGCCAGTGGTACGAGGCTCACTA
+HWUSI-EAS1795_0092:3:1:16238:1115#0/1
gggagfgcdffcffffad`^ed[a^_acfffdg
@HWUSI-EAS1795_0092:3:1:16313:1112#0/1
CTCTTCTCCACCACAATCTTGTTGGACTGCGCG
+HWUSI-EAS1795_0092:3:1:16313:1112#0/1
affcfa_ffffffdcf]]]^`URPS[TQQ]XXf
@HWUSI-EAS1795_0092:3:1:16663:1113#0/1
CACGAATATGGGCCTAGAAGACCAATTGGAAGA
+HWUSI-EAS1795_0092:3:1:16663:1113#0/1
_f^acd^YUYZY^dadccfYf_dddddacaacd
@HWUSI-EAS1795_0092:3:1:17130:1115#0/1
AAGGATCCGCATTGTGATCATTTGTGCGTCAAA
+HWUSI-EAS1795_0092:3:1:17130:1115#0/1
hfhhghhhhhhhhhchfhhghhhghhhhgghhh
@HWUSI-EAS1795_0092:3:1:18877:1113#0/1
CAGCTTAGAAACGCAGCTTCTGGAAGAACCACT
+HWUSI-EAS1795_0092:3:1:18877:1113#0/1
YccYc_YcccYYabKbYaW\WWPPPLYSV^BBB
@HWUSI-EAS1795_0092:3:1:19408:1107#0/1
CGCCCTCGATGATGACCTTGCCGAGCTTATAGC
+HWUSI-EAS1795_0092:3:1:19408:1107#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhghghgh
@HWUSI-EAS1795_0092:3:1:1278:1123#0/1
AACGTTTACGGTTTGTTGCAGATGATTAATCTG
+HWUSI-EAS1795_0092:3:1:1278:1123#0/1
dbe[ffccf_\fcccfcgffd^fdfdagfdgac
@HWUSI-EAS1795_0092:3:1:3313:1120#0/1
CAAAGAAGAGTTTAGTGTGTTGGGGGAAAAAAT
+HWUSI-EAS1795_0092:3:1:3313:1120#0/1
gggcfggggcfgffd_fgggggggfccgggggg
@HWUSI-EAS1795_0092:3:1:3538:1128#0/1
AGAAGACCGGCGAGGCCGACATCTTCGCGGCCA
+HWUSI-EAS1795_0092:3:1:3538:1128#0/1
fcffcfffcfffdT]`aLTSTL^]^^T^ZW^[a
@HWUSI-EAS1795_0092:3:1:3713:1122#0/1
TGCCGATCTCAAGGACGAGCTGTAAGATGGCCA
+HWUSI-EAS1795_0092:3:1:3713:1122#0/1
gghffchhhghhhfghg_ffffdcf]decdebg
@HWUSI-EAS1795_0092:3:1:4762:1119#0/1
CGAGGATCAGTTCACCTCCGGCCGCATCTTGGC
+HWUSI-EAS1795_0092:3:1:4762:1119#0/1
faff_ffafffffgcfggggggfgcggffgggg
@HWUSI-EAS1795_0092:3:1:5074:1127#0/1
CGTCAAGCTGCCGGGCAAGTCCGTGCTGGATGA
+HWUSI-EAS1795_0092:3:1:5074:1127#0/1
hhhhhhhhfghhhhhdhhfhhhhhhhhhhaggh
@HWUSI-EAS1795_0092:3:1:6227:1121#0/1
CAAAAACATGTCTTTTTGAATTATATATAAAGT
+HWUSI-EAS1795_0092:3:1:6227:1121#0/1
gggggggggggggggggcgggegggggggfgfg
@HWUSI-EAS1795_0092:3:1:6260:1129#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6260:1129#0/1
hhhhhhhhfhhhfchhhhhhgfhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:6509:1123#0/1
CCTATACTCAATTCTGACAATCGATTTGCACGT
+HWUSI-EAS1795_0092:3:1:6509:1123#0/1
gcgggggggggggegcfggggfgfgggacfffg
@HWUSI-EAS1795_0092:3:1:6682:1128#0/1
GCCCATTGAATTCTAGTTAATTTAGCAATGTAA
+HWUSI-EAS1795_0092:3:1:6682:1128#0/1
hhhhhhhhhhhhhhhhhhhhhhhhgfhhhghhh
@HWUSI-EAS1795_0092:3:1:7583:1123#0/1
GTTTCCGCCTCAAGATCTTCAATGAGAACAAGC
+HWUSI-EAS1795_0092:3:1:7583:1123#0/1
hhhhhhhhhhhhhhhhhfhghghhhghhhhhgd
@HWUSI-EAS1795_0092:3:1:8131:1122#0/1
CTCGAATCTATGGTGTGCAGCAGATGATTGGCC
+HWUSI-EAS1795_0092:3:1:8131:1122#0/1
hhhhhhghhhhhhghhfhhhghhhhhheahghh
@HWUSI-EAS1795_0092:3:1:8158:1121#0/1
TCTGGCTCCGCAGGTGCCGTCGGTGCCCCAAAC
+HWUSI-EAS1795_0092:3:1:8158:1121#0/1
hhhhhhhhhhhhhhghhhhfhghffhhhghhhg
@HWUSI-EAS1795_0092:3:1:8532:1122#0/1
CAAACGCTTGTTGACGTGTTGTAAGTACTCGGG
+HWUSI-EAS1795_0092:3:1:8532:1122#0/1
c\d]addfcaccffacc]^dc]^YYVZ^\a^^e
@HWUSI-EAS1795_0092:3:1:9548:1128#0/1
CTGGGACAGCGGTGCCCTTTGGGGCACTGGCAC
+HWUSI-EAS1795_0092:3:1:9548:1128#0/1
hhhhhhhhhhhhgghhhhhhghhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:9724:1118#0/1
TTTGGCGCTGGATTCGGAGGTAGTGGCGGGGGG
+HWUSI-EAS1795_0092:3:1:9724:1118#0/1
fcgfggggggg_fddffc]ccffeffffd`UcR
@HWUSI-EAS1795_0092:3:1:9756:1126#0/1
GCACGACGACGCGGCGACGCTTGTCGTAGGGCG
+HWUSI-EAS1795_0092:3:1:9756:1126#0/1
gggggggggggfggdggggegffbffbdff[]f
@HWUSI-EAS1795_0092:3:1:9993:1119#0/1
CCGGATAGAAGGTTCCACCTCTAAGGACACCAA
+HWUSI-EAS1795_0092:3:1:9993:1119#0/1
hhhhhhhfhhfhfhhhgfhhghhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:10046:1129#0/1
ATCACCAACGTCTGCCACTTTGCCCAGAACAAC
+HWUSI-EAS1795_0092:3:1:10046:1129#0/1
cccccc___ZXZ^aaa^Z^^aHYZSVP^ZZa\c
@HWUSI-EAS1795_0092:3:1:10478:1126#0/1
CGACAATGTTAATGTGAATCTTTTCCTTGCCCA
+HWUSI-EAS1795_0092:3:1:10478:1126#0/1
gggfgegeggcfaffffggggggegeggfgggg
@HWUSI-EAS1795_0092:3:1:10662:1118#0/1
CTCAACAACAACAACAACACGCAGTAGTAGCAG
+HWUSI-EAS1795_0092:3:1:10662:1118#0/1
hghhhhhhhhhhhhhhhhhhhhhhghhhhhhfg
@HWUSI-EAS1795_0092:3:1:10783:1123#0/1
ACCTCCTTCTCGAACTTCTCGATGGTACGCTTG
+HWUSI-EAS1795_0092:3:1:10783:1123#0/1
fgcegfggfgegfg_ggc_fffcffdffffaaf
@HWUSI-EAS1795_0092:3:1:11393:1122#0/1
GCCTTCAGCTCCTCCAGCTGCTTGAGAACCTTC
+HWUSI-EAS1795_0092:3:1:11393:1122#0/1
hhhhhhhhhhhhhhhhghhhgghhhghhhhhhg
@HWUSI-EAS1795_0092:3:1:11490:1127#0/1
GGCCTACGGTGCTGCTGTGCAGGCTGGCGTGCT
+HWUSI-EAS1795_0092:3:1:11490:1127#0/1
hhhhhhhhghhhhhhhhhfhhhhhhhhceeeea
@HWUSI-EAS1795_0092:3:1:11646:1123#0/1
GTGTTGTACTTGTTCTTGTCCTGAAATGTTAGG
+HWUSI-EAS1795_0092:3:1:11646:1123#0/1
hhhhhhhhhhhghhhhghhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11752:1118#0/1
CCTCTCGCAGTCGGTCGCTGCTCTGCCGCAAAT
+HWUSI-EAS1795_0092:3:1:11752:1118#0/1
ggggggggggggggfgefddf_fdfffggggge
@HWUSI-EAS1795_0092:3:1:12267:1127#0/1
GACAAAACCCCACGACCAGCACTTTGCACCACT
+HWUSI-EAS1795_0092:3:1:12267:1127#0/1
hhhhhhhhhhhhhhhhhgffhhhhhfhhhhhfg
@HWUSI-EAS1795_0092:3:1:12286:1124#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12286:1124#0/1
gfdggfggdcfdfdfffegfggggggffaggfg
@HWUSI-EAS1795_0092:3:1:12467:1119#0/1
CAAAGATGGTGAAACTAATTGCTAGCCTGCTCC
+HWUSI-EAS1795_0092:3:1:12467:1119#0/1
hhhhhghhhhhhhhhhhdhhghhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12547:1127#0/1
AAAAAAGGTGATCTATCGAAGTCTATCGTTCTT
+HWUSI-EAS1795_0092:3:1:12547:1127#0/1
hghhhhhhggghhhhhhhhfheh_hhhhhhghh
@HWUSI-EAS1795_0092:3:1:12567:1127#0/1
CGGAGATGTCGGCTTCTAGGGGAATATATTTGT
+HWUSI-EAS1795_0092:3:1:12567:1127#0/1
hghhfhhhhhchfcgggghhhhchhhfghhhhf
@HWUSI-EAS1795_0092:3:1:13160:1124#0/1
CCCAACCAGAACCAAAATGCGGGGCATACGACA
+HWUSI-EAS1795_0092:3:1:13160:1124#0/1
hhhhhhhhhhhhhhhhhgghhhhghhghhfhhd
@HWUSI-EAS1795_0092:3:1:13204:1120#0/1
GCGGTTAGGGAGCCATGGTGCATGAGCGCCTCG
+HWUSI-EAS1795_0092:3:1:13204:1120#0/1
hhhhhhhhhhhhhhhhhhfchhhhhhhhhhghf
@HWUSI-EAS1795_0092:3:1:13224:1128#0/1
CGCGCGTGCAGCCCAGGACATCTAAGGGCATCA
+HWUSI-EAS1795_0092:3:1:13224:1128#0/1
hhhghahhdhfghhghhhffhhehggdghechf
@HWUSI-EAS1795_0092:3:1:13366:1118#0/1
GCCAAATCAAGGTGTGGCGCATCATCACCGGTC
+HWUSI-EAS1795_0092:3:1:13366:1118#0/1
hhhhhhhhhhhhfhhhgffffdhhgghhehhdh
@HWUSI-EAS1795_0092:3:1:13479:1120#0/1
CGCTAAGATAGGACGTGTGTTGGCTGCGCCGCT
+HWUSI-EAS1795_0092:3:1:13479:1120#0/1
heffhhhhhhghhhhhhhggdhfheff_ffdfa
@HWUSI-EAS1795_0092:3:1:13707:1125#0/1
CAAGAATGAAAGAGAGCAAGGCAACATGAAAAT
+HWUSI-EAS1795_0092:3:1:13707:1125#0/1
hhhhhhhhhhgcfhghefhfgfhhhgehhhhgh
@HWUSI-EAS1795_0092:3:1:14542:1119#0/1
CTTATACGAATCTGTCTCGATCAGGTCCTGCTC
+HWUSI-EAS1795_0092:3:1:14542:1119#0/1
hhhhhhhhhhhhhhhhhhhehhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14575:1120#0/1
GCAGAGTGTCGCCCGGCTTGAGATCTTGATCGC
+HWUSI-EAS1795_0092:3:1:14575:1120#0/1
ggggggggggggggQegffddfcgggggffggg
@HWUSI-EAS1795_0092:3:1:15317:1124#0/1
CTACAATATTACAACGGTGGAGAACTTTGATCG
+HWUSI-EAS1795_0092:3:1:15317:1124#0/1
hhhhghhhhhhhhhhhhghhgfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15621:1119#0/1
CGATACGTTCGTGGTCGTGCTTATCACAGCAAC
+HWUSI-EAS1795_0092:3:1:15621:1119#0/1
hhhhhhhhhhhhhhghhhgghghghhhhhgghg
@HWUSI-EAS1795_0092:3:1:15743:1128#0/1
CCAGAGAGGAGATTGAATTTCTCGGACATACCA
+HWUSI-EAS1795_0092:3:1:15743:1128#0/1
ggggcagdffffggfggddffcggggcgeeggg
@HWUSI-EAS1795_0092:3:1:16018:1125#0/1
CGGGATTGGTGAAGTCTAGCGCCTCCACCTCGC
+HWUSI-EAS1795_0092:3:1:16018:1125#0/1
hhhhhhhhhhhhhhhhhhhhhhhehhhhhfhgg
@HWUSI-EAS1795_0092:3:1:16160:1126#0/1
GCCACAACTATCGTACAAACCCGGCGCCCAGCA
+HWUSI-EAS1795_0092:3:1:16160:1126#0/1
\^_daccdffffcRc^aedaaed[`^aW^_Z^_
@HWUSI-EAS1795_0092:3:1:16519:1124#0/1
CTCATTTTGTCCGTTATATCCTTGACGGTCAGG
+HWUSI-EAS1795_0092:3:1:16519:1124#0/1
fhgghfghhhhhhhhhhdhhhhhhgdghhhhhh
@HWUSI-EAS1795_0092:3:1:16768:1124#0/1
CGACACTTAAGGAACACATCGCAGTAGCCCTGG
+HWUSI-EAS1795_0092:3:1:16768:1124#0/1
hhhhhhhdhhhghhfdhhhhchghdf]fhhhhd
@HWUSI-EAS1795_0092:3:1:17287:1119#0/1
TAGAGGAGGAGGCATTCGTCCTGTGGAAGGAGG
+HWUSI-EAS1795_0092:3:1:17287:1119#0/1
hhhhhhhhhhhhhhhhhhhhhhdghhhhhhfhg
@HWUSI-EAS1795_0092:3:1:17864:1119#0/1
CCTTATCCTGGATCTTAGCCTTGACATTCTCGA
+HWUSI-EAS1795_0092:3:1:17864:1119#0/1
hhhhhhhhghhhghhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:18219:1124#0/1
CAAAAACACAAAAACGCAGAGAGAGGCAACGAC
+HWUSI-EAS1795_0092:3:1:18219:1124#0/1
gggggggggfgggffgggfcgggggggfggdgf
@HWUSI-EAS1795_0092:3:1:18289:1126#0/1
GCCTCGGCTTATGGACTCATCGATTCCGTGATT
+HWUSI-EAS1795_0092:3:1:18289:1126#0/1
hhhhghhhhhhhhghhhhghgfhhhhh_]fdfh
@HWUSI-EAS1795_0092:3:1:18670:1129#0/1
CCAACTTCCGTTCACTGCCTCCGTGATGTAGTC
+HWUSI-EAS1795_0092:3:1:18670:1129#0/1
hhhhhhhhhhhhhhghhhhfhhgfhhhfghhgh
@HWUSI-EAS1795_0092:3:1:18892:1128#0/1
GCGGATATTGGTACGGCCTGTTGAGAAGTTTGC
+HWUSI-EAS1795_0092:3:1:18892:1128#0/1
gggggdgggggfggggggfggggaggggcgage
@HWUSI-EAS1795_0092:3:1:1627:1136#0/1
GCTGGAACCACACAACATGCGCCCAAAACGATG
+HWUSI-EAS1795_0092:3:1:1627:1136#0/1
ZZZaaaaaafffW^a^^]affcbaaacBBBBBB
@HWUSI-EAS1795_0092:3:1:2260:1132#0/1
ATTCAGGTGGTTAGTTCGAAACAACATTGTAAT
+HWUSI-EAS1795_0092:3:1:2260:1132#0/1
feffacfffffffafffggggfgcggggagfgg
@HWUSI-EAS1795_0092:3:1:3064:1130#0/1
TGGACGCAGAGGACGCAGCTAAAATCGAGATAA
+HWUSI-EAS1795_0092:3:1:3064:1130#0/1
fgfccddffggggegggf_]cdfff`f`[dQef
@HWUSI-EAS1795_0092:3:1:3093:1137#0/1
GCCGGATCGATAATGTCCGGGCGATTGGTGGCT
+HWUSI-EAS1795_0092:3:1:3093:1137#0/1
hehhhgfhhhhhhhhhhhhggghghghedhhaa
@HWUSI-EAS1795_0092:3:1:3309:1138#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3309:1138#0/1
fggefeggggggggggffggggedgefgadgcd
@HWUSI-EAS1795_0092:3:1:3933:1131#0/1
GCGCGATCTGTCCCGTTTCGTTCGCTGGCCCAA
+HWUSI-EAS1795_0092:3:1:3933:1131#0/1
hhhhhhhhhghhhhfhhhhefhhhhghaghhhh
@HWUSI-EAS1795_0092:3:1:4034:1133#0/1
CGGAAACAAAAAAGGAAAAAAGAGTAAAAAAAA
+HWUSI-EAS1795_0092:3:1:4034:1133#0/1
hhhhhhhhhhhhhhgfhhhhgghhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:5616:1132#0/1
CACCAACACCTGTCCTGCGCAAGATGACCGATA
+HWUSI-EAS1795_0092:3:1:5616:1132#0/1
hhhhhhhhghgghghghghhghhdhhghdhhhh
@HWUSI-EAS1795_0092:3:1:5741:1131#0/1
GGGGAGGCAGGGAGGGATGATACTCGTGGGTAG
+HWUSI-EAS1795_0092:3:1:5741:1131#0/1
ggdffffccfff^c\^\de[WbdfffffffaW\
@HWUSI-EAS1795_0092:3:1:5834:1130#0/1
GCGGTGATCTCCTTCTGCATACGGTCGGCGATG
+HWUSI-EAS1795_0092:3:1:5834:1130#0/1
hhhhhhahhhhhhhhhhhhhhhhhhhhgdhdhh
@HWUSI-EAS1795_0092:3:1:5864:1138#0/1
GCCAGAGCATCTGCAGCGCCGGCATTCCGATCT
+HWUSI-EAS1795_0092:3:1:5864:1138#0/1
ff]cdccffcfcTQZYYWSa[\adW[d^Y^BBB
@HWUSI-EAS1795_0092:3:1:5999:1130#0/1
CACACACAGATACATGACCGCAGCCATACACAC
+HWUSI-EAS1795_0092:3:1:5999:1130#0/1
hhhhhhhhhgghghhhfhhhfhhhhghhhhghg
@HWUSI-EAS1795_0092:3:1:6737:1139#0/1
CATATCGATAAAAAAGATTGCGACCTCGATGTT
+HWUSI-EAS1795_0092:3:1:6737:1139#0/1
`ZWZ_ZZd^d[aUUUOKT_SZ_X^`Z]aYWY^R
@HWUSI-EAS1795_0092:3:1:6851:1133#0/1
CCTATACCCTGTTCGAATGCCTTAAGGACAACC
+HWUSI-EAS1795_0092:3:1:6851:1133#0/1
gfgggggcfafffegaff]affgcgg^afdffg
@HWUSI-EAS1795_0092:3:1:7108:1131#0/1
CGGAGATGGTGCTGTTGCCGTCCTCGCCGAACA
+HWUSI-EAS1795_0092:3:1:7108:1131#0/1
f^cc[cd\dbacfcfdRaacacfff]abacWbc
@HWUSI-EAS1795_0092:3:1:7140:1140#0/1
GTCCTTTTTCGAGGCCTGGTCCGTAGGCCTTGC
+HWUSI-EAS1795_0092:3:1:7140:1140#0/1
hhhhhhhhhhhhhhhhhgghhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:7731:1134#0/1
GTTGGGCACAAACTGGTAGCGCTCCAGAGTGGG
+HWUSI-EAS1795_0092:3:1:7731:1134#0/1
ffddffffgggcggggaffffcgggegdfaffd
@HWUSI-EAS1795_0092:3:1:7882:1135#0/1
TGGGCTTCCACAAGCCGCACATTAATTTCCGGT
+HWUSI-EAS1795_0092:3:1:7882:1135#0/1
ffcchchhhhhhhhghfhhhhghfhhdhhhdcg
@HWUSI-EAS1795_0092:3:1:8272:1140#0/1
TCCATTTATCGGCATACCTGGGTGGCATACATT
+HWUSI-EAS1795_0092:3:1:8272:1140#0/1
hhhhhhhgfhhhghghhhfhghghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8547:1139#0/1
GGCCTTCTCTGCCACAGTGGTGACACTTGACTT
+HWUSI-EAS1795_0092:3:1:8547:1139#0/1
gfhhhhhfhhehhhhgcehhefghhghhhhhhh
@HWUSI-EAS1795_0092:3:1:9735:1133#0/1
GGCCGATCGAATTGTGACTTCACTATAGCGTAG
+HWUSI-EAS1795_0092:3:1:9735:1133#0/1
hhhhhhhhhghhhhhhghhhghfhhehhghggh
@HWUSI-EAS1795_0092:3:1:9939:1130#0/1
TCCATTTCTCGATGTCGTTGATGGGCACATCGA
+HWUSI-EAS1795_0092:3:1:9939:1130#0/1
Yca^]bbcYYccacaY\a\W`VZa\aaZ\Z`Zc
@HWUSI-EAS1795_0092:3:1:10322:1135#0/1
TAATGATAAGCACGTTTTCAATAATTTGCGCTT
+HWUSI-EAS1795_0092:3:1:10322:1135#0/1
hhhhhhhhhhhghggghhhhhhhhhhhhhhhhe
@HWUSI-EAS1795_0092:3:1:10989:1138#0/1
TATGCCTGAGTTTTCACTAGATTTTCATTCATA
+HWUSI-EAS1795_0092:3:1:10989:1138#0/1
hfhhhhhhhhhhhhhhhfhgghhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:12139:1132#0/1
TGCCCCTCGCTGGGAAGGCGCTCCACTACACGG
+HWUSI-EAS1795_0092:3:1:12139:1132#0/1
gggggggggggggggggggdgeggggegggggg
@HWUSI-EAS1795_0092:3:1:12326:1130#0/1
GAAGGAGTACGAGGTCGTGGGCCTCAAGCGGCC
+HWUSI-EAS1795_0092:3:1:12326:1130#0/1
WXVSMXMT\__BBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12353:1139#0/1
GTCCAAAACATTGAAACTCGCTTGGCAGCGGCG
+HWUSI-EAS1795_0092:3:1:12353:1139#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13192:1136#0/1
TGTTGGTGTTATACTACTATTGTGTTCGCTGCT
+HWUSI-EAS1795_0092:3:1:13192:1136#0/1
hheghg_hhhhehhhghhghhchhhghhhhfhg
@HWUSI-EAS1795_0092:3:1:13291:1139#0/1
TCCCGGATCAATTGACTGCTATCGTCCGCCTGA
+HWUSI-EAS1795_0092:3:1:13291:1139#0/1
ggggdgaffcffedgggefgfWffdffgggggg
@HWUSI-EAS1795_0092:3:1:13349:1136#0/1
GCAGGATTGGATTCCTCACGGGGGACGCGGGCG
+HWUSI-EAS1795_0092:3:1:13349:1136#0/1
fdcfdf`cdfdcfffcfgggggfg[]eafdd[`
@HWUSI-EAS1795_0092:3:1:13560:1137#0/1
CTTGACCTTGCACAACTTGTACTTGGCCTCCTC
+HWUSI-EAS1795_0092:3:1:13560:1137#0/1
hhghhhhhhghhhgghhhhhhhhhhhhhghghg
@HWUSI-EAS1795_0092:3:1:13639:1134#0/1
AAGAAGAGCAAGGCCTCCTACCCGACCAAGACG
+HWUSI-EAS1795_0092:3:1:13639:1134#0/1
dd[be`ddbdf]ff_fcb`dddf[cff^^[^^]
@HWUSI-EAS1795_0092:3:1:14231:1137#0/1
CTGAGACCTGAGAGGCATGACGTGGGATCTTGT
+HWUSI-EAS1795_0092:3:1:14231:1137#0/1
ffaffafgfggggagggaffffeggf]fc]ff`
@HWUSI-EAS1795_0092:3:1:14271:1134#0/1
TTAACGAGAGTCAGAATTGGGATACTTAACTAA
+HWUSI-EAS1795_0092:3:1:14271:1134#0/1
hhhhghghhhhhgghhhghhhfchghhhhdhhg
@HWUSI-EAS1795_0092:3:1:14509:1136#0/1
GCGCGGTGTAGAGTTGAGAAAACTGAAAAACCA
+HWUSI-EAS1795_0092:3:1:14509:1136#0/1
hhhhhhhhhhhhhhhddehhghhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14738:1138#0/1
GACCGACTACCTGATGAAGATCCTGACCGAGCG
+HWUSI-EAS1795_0092:3:1:14738:1138#0/1
hghhhhhhhhgghhhhhhggghhhghhhhhghg
@HWUSI-EAS1795_0092:3:1:14803:1140#0/1
CTTGTATCAGCTATAGAGCTTGTGTGGCTGCTA
+HWUSI-EAS1795_0092:3:1:14803:1140#0/1
hghhhhhhhhhhhghgghhhhghghhhhhfegc
@HWUSI-EAS1795_0092:3:1:14820:1132#0/1
CCGGACCATAGGAACATGTCTCCTGCTTGCAAA
+HWUSI-EAS1795_0092:3:1:14820:1132#0/1
hhghghhghhhhhhhhhhgghfhcfdehfghhf
@HWUSI-EAS1795_0092:3:1:15064:1136#0/1
GTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATA
+HWUSI-EAS1795_0092:3:1:15064:1136#0/1
ffafa_f_\aaYfdffff^ffcfafffggc_cf
@HWUSI-EAS1795_0092:3:1:15288:1131#0/1
AGATTCTCGGTCCCAGCGAGGCAATTGTGAATG
+HWUSI-EAS1795_0092:3:1:15288:1131#0/1
hhhfghhhhhfhhhhghhgehhfffefghch[g
@HWUSI-EAS1795_0092:3:1:15920:1130#0/1
CCGTGCTGCATGCCAAATCCACCCATCGGCATC
+HWUSI-EAS1795_0092:3:1:15920:1130#0/1
ffdcfffggggggggfgaffeffd`fcf[dffd
@HWUSI-EAS1795_0092:3:1:16280:1140#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16280:1140#0/1
ghhehfhfhhhhggdhfghhhhhhhhhdg_hfa
@HWUSI-EAS1795_0092:3:1:16538:1133#0/1
CGGTGGTCGATTTGCGCTGATTTTTTGACAAAG
+HWUSI-EAS1795_0092:3:1:16538:1133#0/1
hhhhhhhhhhhhhhhghfhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17082:1137#0/1
TGAACTTCTTGTTGGTGCGGCGCTGAAGGAAGC
+HWUSI-EAS1795_0092:3:1:17082:1137#0/1
hhhhhhhhhhhhhghhhhhhhhgfhahhhhghh
@HWUSI-EAS1795_0092:3:1:17599:1132#0/1
CAACTGAAGAAGTTCAAGAAGACCACCGGCGAG
+HWUSI-EAS1795_0092:3:1:17599:1132#0/1
gdggaggfcff[fffffaffaff]fffgacegc
@HWUSI-EAS1795_0092:3:1:17959:1134#0/1
ATCGACGCGACGCTTTGTGTTGCCCTTACGAAT
+HWUSI-EAS1795_0092:3:1:17959:1134#0/1
ffffffffccaad`daa\````ffdfd[b`b``
@HWUSI-EAS1795_0092:3:1:18074:1132#0/1
CAACCATTCATTCCAGCCTTCAATTAAAAGACT
+HWUSI-EAS1795_0092:3:1:18074:1132#0/1
hghhhhhhhhhhhhfhghhhhghhhghhfhhhf
@HWUSI-EAS1795_0092:3:1:18191:1131#0/1
GCGACATCTCATCCAGGAAGTTCACATCCTGCA
+HWUSI-EAS1795_0092:3:1:18191:1131#0/1
gggggggcf_fffffffgfggggggdggfedga
@HWUSI-EAS1795_0092:3:1:18851:1132#0/1
GTATTCCTCGGAACCTGGATTTTTTGTATCTTG
+HWUSI-EAS1795_0092:3:1:18851:1132#0/1
hhhhhhhhhhhchhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18948:1132#0/1
TGGCGTACAGCGAGAGCACAGCCTGGATGGCCA
+HWUSI-EAS1795_0092:3:1:18948:1132#0/1
affffffggfggcSadcdffffcfffcbffff]
@HWUSI-EAS1795_0092:3:1:19035:1133#0/1
GTGAATAGCTGCTAGCTCCTGCTCTGTAGTGGA
+HWUSI-EAS1795_0092:3:1:19035:1133#0/1
fdfc\^^f_ff^ffdfadfdf]fafffBBBBBB
@HWUSI-EAS1795_0092:3:1:19367:1139#0/1
GGCGGACCGACAGCTGCTTGGCGCGCTCGACAA
+HWUSI-EAS1795_0092:3:1:19367:1139#0/1
gcggdggggggdcgggeffffcdab`Qc_[aa[
@HWUSI-EAS1795_0092:3:1:19532:1139#0/1
GCTTCATCCCCACGCCTGTGCGCGAGCTGGACA
+HWUSI-EAS1795_0092:3:1:19532:1139#0/1
hhghhhhhhhhhhhhhhaghhhhgeghfhgghh
@HWUSI-EAS1795_0092:3:1:2075:1152#0/1
AACTGCAGGAGCCCCTTCTGTTGCTCGGCAAGG
+HWUSI-EAS1795_0092:3:1:2075:1152#0/1
fcdWaeedeeaeffffceb[db`d\e`cff[ce
@HWUSI-EAS1795_0092:3:1:2447:1142#0/1
CTACCGCCTCACCGCTACTTGCCTCGATCTAAA
+HWUSI-EAS1795_0092:3:1:2447:1142#0/1
ggffdcfggg_gdfddfgdg_gfffa[cffadg
@HWUSI-EAS1795_0092:3:1:2851:1144#0/1
CTTGTAGTCATTTACATCGTATTTTCCTGGTTT
+HWUSI-EAS1795_0092:3:1:2851:1144#0/1
fffffff[ff_dffaffcfcfcee__dffffff
@HWUSI-EAS1795_0092:3:1:2882:1144#0/1
GGCGAATATACTGTGCAACACACTTGCGAGGCG
+HWUSI-EAS1795_0092:3:1:2882:1144#0/1
ggfgcgffcfafc[c^c_ac^a]fffffaffad
@HWUSI-EAS1795_0092:3:1:3361:1142#0/1
GGTGTATCCAAATCGATAACCTCAATCGTTGGC
+HWUSI-EAS1795_0092:3:1:3361:1142#0/1
]\aaed^ac_fafaddfacfffYffaSfefdfY
@HWUSI-EAS1795_0092:3:1:3486:1148#0/1
TTTTGATCAGGATTGAAGCATGTTTGAACTCAC
+HWUSI-EAS1795_0092:3:1:3486:1148#0/1
gfggc^gggg_gfdffffffWaffffff]fffc
@HWUSI-EAS1795_0092:3:1:3582:1148#0/1
TTGCAGGTACCGTTAAGGAACGCCATTTACTCC
+HWUSI-EAS1795_0092:3:1:3582:1148#0/1
gfggggggggggggggegcgfgfggfggggggf
@HWUSI-EAS1795_0092:3:1:4504:1147#0/1
AAACAATTGCCATCGGGGCGGGTGCGGCGAATG
+HWUSI-EAS1795_0092:3:1:4504:1147#0/1
fhhhhhhhfhhhghehhchhhcH^aaa^\[\\d
@HWUSI-EAS1795_0092:3:1:5346:1144#0/1
CCATGGAGTTGCTGAAGGTGTCCAAGGATAAGA
+HWUSI-EAS1795_0092:3:1:5346:1144#0/1
hhghghhehhhhhhhgefafcfhhhhcgghhah
@HWUSI-EAS1795_0092:3:1:5577:1151#0/1
GCAGAACAAGAACGCTGCCACACGATATCGCCA
+HWUSI-EAS1795_0092:3:1:5577:1151#0/1
hghhhhghhhhhhhhhhghhhchhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:5940:1146#0/1
GTAATTTTAATATCCACAATATTCATGAGTGAT
+HWUSI-EAS1795_0092:3:1:5940:1146#0/1
afcffffffggggeggggggdfggagagaggge
@HWUSI-EAS1795_0092:3:1:6907:1145#0/1
GCGAAAATGCATATTCTGCCATTCCACACACAC
+HWUSI-EAS1795_0092:3:1:6907:1145#0/1
acfffffggggdfggggegfggggggffdcadf
@HWUSI-EAS1795_0092:3:1:6928:1141#0/1
GAGCAAACGATTTGTGCCTTGCGACATATTTTA
+HWUSI-EAS1795_0092:3:1:6928:1141#0/1
fggggdgggggggagggggggggggggfggggg
@HWUSI-EAS1795_0092:3:1:7709:1152#0/1
TTCCATATGGAGATGTCAGGTGGTGCACCCAGT
+HWUSI-EAS1795_0092:3:1:7709:1152#0/1
hhhhhhhhghhhhfghhhhfghgghhhhhhfhg
@HWUSI-EAS1795_0092:3:1:7828:1146#0/1
CTTACATGTTTTGACCTTTCGCACAGCTTCCAA
+HWUSI-EAS1795_0092:3:1:7828:1146#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:8129:1147#0/1
TTTTGAAATCGATAAATAAGCCGCCAAGATGAC
+HWUSI-EAS1795_0092:3:1:8129:1147#0/1
gggggfgggggefcffdc_^deggggggggggg
@HWUSI-EAS1795_0092:3:1:8434:1148#0/1
TGAACACACTTCACGAGGCCGGGCGCATCGAGA
+HWUSI-EAS1795_0092:3:1:8434:1148#0/1
hhhhhhhghhhhhhffhhhhghhhhhhgffgeh
@HWUSI-EAS1795_0092:3:1:8486:1145#0/1
AAATGGACGAGTACCAGAGGGAGCACTCGGATG
+HWUSI-EAS1795_0092:3:1:8486:1145#0/1
dfca\Y_aaaaZcc\c^^d_dacYcW^dda[RV
@HWUSI-EAS1795_0092:3:1:8760:1145#0/1
GACGCGGCAGCAACGCCAGCAGCTAACGATGCA
+HWUSI-EAS1795_0092:3:1:8760:1145#0/1
hhhfhhhhhghhghdghfffhgechhhhhfhec
@HWUSI-EAS1795_0092:3:1:9492:1146#0/1
CGCTAGCAAAAGATCTTCTGCACCCTCTGCCCG
+HWUSI-EAS1795_0092:3:1:9492:1146#0/1
f]c[cadcdeeef`fa_eeacdffdfafffffg
@HWUSI-EAS1795_0092:3:1:9630:1145#0/1
CCGTGATCTCAGCCTCATAATACCTTCCATCGT
+HWUSI-EAS1795_0092:3:1:9630:1145#0/1
ggfcffffgggeggfgfgggggggggfff_fe`
@HWUSI-EAS1795_0092:3:1:10066:1147#0/1
GGTGCAAAGAGGAGCATGGCGTCATCGCGGGCC
+HWUSI-EAS1795_0092:3:1:10066:1147#0/1
hhhhhhghhhhhhhhhhhffhhfhhhfhhhgfh
@HWUSI-EAS1795_0092:3:1:10239:1142#0/1
CGCGAGAACATCGCGAAGGCCGCCGAGCCCTTC
+HWUSI-EAS1795_0092:3:1:10239:1142#0/1
ggggagggdgggcffWaacafffeabdadcadd
@HWUSI-EAS1795_0092:3:1:10358:1141#0/1
GGGATTTGTTGGTTAAGTGTCTACTTAAATGCA
+HWUSI-EAS1795_0092:3:1:10358:1141#0/1
dgdcaffaf``afffafcfccfffffffcfffg
@HWUSI-EAS1795_0092:3:1:10424:1145#0/1
GTTTCGTTTGCTTTTGTTTACCGTGGATGGAGG
+HWUSI-EAS1795_0092:3:1:10424:1145#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhfhggdgg
@HWUSI-EAS1795_0092:3:1:11014:1149#0/1
GTTCACCACGTCCCTCATCCCCACCGAGGCAAT
+HWUSI-EAS1795_0092:3:1:11014:1149#0/1
hhhghhhhhhhhhhhhhghhhhhhhhhhgghgh
@HWUSI-EAS1795_0092:3:1:11114:1151#0/1
TGTTGCGCCTGTAAAAGGGAATCAGATCGACTG
+HWUSI-EAS1795_0092:3:1:11114:1151#0/1
ggeeggggfgggcdffcggcfcaffafffd[ff
@HWUSI-EAS1795_0092:3:1:11280:1147#0/1
CGCACACCTTGGCGCAGTCCTGTCCGAAGTGGT
+HWUSI-EAS1795_0092:3:1:11280:1147#0/1
affcffffaffffcfffaffc]afffc`b`bbY
@HWUSI-EAS1795_0092:3:1:11302:1151#0/1
GTCGCCTTACCCACCTCCTGGGTTTCGTAGAGC
+HWUSI-EAS1795_0092:3:1:11302:1151#0/1
ffcffcafffffffc`fffffaSYW^^Zb_^^\
@HWUSI-EAS1795_0092:3:1:12313:1146#0/1
CCGTTCTCCAGTTCCTCCATCTTTTTGGTGAAC
+HWUSI-EAS1795_0092:3:1:12313:1146#0/1
hhhhhhhhhghhhhhhhhfggghhhhefhahhh
@HWUSI-EAS1795_0092:3:1:12552:1151#0/1
GTACGCTCTTGGTGAGATGCAGCATGGTCAAGG
+HWUSI-EAS1795_0092:3:1:12552:1151#0/1
VSZ\Z]]cfacaff_ccffcWf^^^daccf_ff
@HWUSI-EAS1795_0092:3:1:13416:1145#0/1
CACACACCAACCAACCAACCAACCAACCTACCA
+HWUSI-EAS1795_0092:3:1:13416:1145#0/1
cggeecffcffffafcdfge]gegggfc]afaf
@HWUSI-EAS1795_0092:3:1:14198:1152#0/1
GGCTGGGTGAGCTGCAGGCCACGGATGTTGTGG
+HWUSI-EAS1795_0092:3:1:14198:1152#0/1
hhhhghhdhghghhhghhhhghfhgfhggfehe
@HWUSI-EAS1795_0092:3:1:14600:1142#0/1
CCCCCGCCACCGCCGACGCACTTCAACGACGAG
+HWUSI-EAS1795_0092:3:1:14600:1142#0/1
ggfef]]ccff[OL\XV]_b`dffdf]aaaaaO
@HWUSI-EAS1795_0092:3:1:14700:1149#0/1
GGCCTGCCGCATCGTCAAGCACTCGTTCGAGAT
+HWUSI-EAS1795_0092:3:1:14700:1149#0/1
hhhhhhhhhghhhhhhhghghgghghhhehhhg
@HWUSI-EAS1795_0092:3:1:14719:1150#0/1
CACGCTCATAACTCCCAATTGTGCAGTTGTTGT
+HWUSI-EAS1795_0092:3:1:14719:1150#0/1
efgggeggdgfggfgga_ff]cggfgggggggg
@HWUSI-EAS1795_0092:3:1:14950:1143#0/1
TGGCACTGTTAAGTGATAAGAAATTCCTTTCTT
+HWUSI-EAS1795_0092:3:1:14950:1143#0/1
c\caccaacaccaZc^YYSVYYV]aacccca__
@HWUSI-EAS1795_0092:3:1:15515:1141#0/1
GCGAAAACAAAGTCTTTTTCTTATCATATAAAA
+HWUSI-EAS1795_0092:3:1:15515:1141#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhgf
@HWUSI-EAS1795_0092:3:1:15542:1142#0/1
GCTGGACCTGAACCTCCTCCTTCTGAACTTTAG
+HWUSI-EAS1795_0092:3:1:15542:1142#0/1
ggegfgggfdggffcffdfffdfffcafffaff
@HWUSI-EAS1795_0092:3:1:16363:1148#0/1
TGATCCGCGGCCACTTCAAGGGCAACCAGGTGG
+HWUSI-EAS1795_0092:3:1:16363:1148#0/1
gggggggggggfccf_ffdffacfcf]`a^Udf
@HWUSI-EAS1795_0092:3:1:16767:1149#0/1
CTGGTATTGCAGATCATAGCGGGAGGCATTGCA
+HWUSI-EAS1795_0092:3:1:16767:1149#0/1
ggdcdfdfffffafafcggggfcfac`afacfg
@HWUSI-EAS1795_0092:3:1:17261:1148#0/1
AAGACTGTGTGTGCAATTCATTGGGCGCCTCCA
+HWUSI-EAS1795_0092:3:1:17261:1148#0/1
gdggfgefccafd[e\efdfff]fdfffgcggg
@HWUSI-EAS1795_0092:3:1:17368:1146#0/1
GGGCAGGTTAGACTTTATATATAATTCAAAAAG
+HWUSI-EAS1795_0092:3:1:17368:1146#0/1
hhhhhhhhhhhhhhhhhhhhgchhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:18143:1143#0/1
CCTGGTTCCGACCAATCAGCTGTGAGGACTTGG
+HWUSI-EAS1795_0092:3:1:18143:1143#0/1
hhhhhhhhhfhehhgehfehhhggghgahghhh
@HWUSI-EAS1795_0092:3:1:19176:1145#0/1
ACGACCGCGGCCGCCAAGGCCAAGAGCAAGGAT
+HWUSI-EAS1795_0092:3:1:19176:1145#0/1
ggggggffddffegggg]dffffaca_caaac]
@HWUSI-EAS1795_0092:3:1:19667:1142#0/1
CAGATGATCCAGTTCTAGGCACCTTTACACCAT
+HWUSI-EAS1795_0092:3:1:19667:1142#0/1
fdddbbdfddbb``eaeY]ba`^WY\afcfff[
@HWUSI-EAS1795_0092:3:1:2503:1160#0/1
GTTGAAGCCAACGTTGTCTCCGGGAACGGCCTC
+HWUSI-EAS1795_0092:3:1:2503:1160#0/1
edgdgggffcfaacafcacaacf_ff^fcdadf
@HWUSI-EAS1795_0092:3:1:2708:1155#0/1
GATAGCAGCTGCTCCCTTAACCGCAGATAACGA
+HWUSI-EAS1795_0092:3:1:2708:1155#0/1
ffcfafcffffchfghghfhhhehhfhehhhaf
@HWUSI-EAS1795_0092:3:1:3708:1156#0/1
TTCGCCTAATTGGTTTGAAGCCGAAGCCTGTTA
+HWUSI-EAS1795_0092:3:1:3708:1156#0/1
dfdf_cfdcf\Wceaec^ebe]fffffafff]d
@HWUSI-EAS1795_0092:3:1:4597:1163#0/1
CAACTTGGTTGCCTTCAACAGACTTTCCAAAGA
+HWUSI-EAS1795_0092:3:1:4597:1163#0/1
ggfggg_ggggggggccfcfccfafa[ffffff
@HWUSI-EAS1795_0092:3:1:4620:1157#0/1
CTGGGTGCCATTCTGGGTTTGTTTGTCGATCAG
+HWUSI-EAS1795_0092:3:1:4620:1157#0/1
f^fffcffff_[adeeecffffccccff[[ffg
@HWUSI-EAS1795_0092:3:1:4640:1161#0/1
CGGCGACAAGAAATCCGCCTGCGGCTGCTCCAA
+HWUSI-EAS1795_0092:3:1:4640:1161#0/1
cffaf_fcad[c__edaff[fca[`Ydb[bbQY
@HWUSI-EAS1795_0092:3:1:4907:1156#0/1
CGGAAAGCGGTTGGGAAAACCCATAGAATGGAA
+HWUSI-EAS1795_0092:3:1:4907:1156#0/1
gggggfgcefffgfgdgfgfgfggegfdggggd
@HWUSI-EAS1795_0092:3:1:5428:1161#0/1
CGGCGCTGGCATCCACACCAAGGACGGCAAGGT
+HWUSI-EAS1795_0092:3:1:5428:1161#0/1
fggfgfgfgfgfdgfgggggggggfgdgfcgab
@HWUSI-EAS1795_0092:3:1:6388:1159#0/1
TACCAACGAATCGTGTGCACACCCACACGATCA
+HWUSI-EAS1795_0092:3:1:6388:1159#0/1
ggggggggggefca`Jcdbb]bffdfd[[`]`^
@HWUSI-EAS1795_0092:3:1:6425:1164#0/1
TGCAGGATGAATCTGTTGTTACGCAGAAAAGAA
+HWUSI-EAS1795_0092:3:1:6425:1164#0/1
gggcgggegeggggfgggggggfgggggggggg
@HWUSI-EAS1795_0092:3:1:6544:1155#0/1
GGCCAGTCTTATCAGAGCATATGGCAGTGGCAT
+HWUSI-EAS1795_0092:3:1:6544:1155#0/1
fffffffggggggdaeagffggggfcgdf_gc[
@HWUSI-EAS1795_0092:3:1:6583:1154#0/1
TGGACCGGTGGCCAAGGAATGCGCCGATCTGTG
+HWUSI-EAS1795_0092:3:1:6583:1154#0/1
hhhhhhhgghhhhhhgghhghhehhhghgggfg
@HWUSI-EAS1795_0092:3:1:7691:1164#0/1
CGAGGATAAGGCCGCTGCTGCCGATGCCGCCGG
+HWUSI-EAS1795_0092:3:1:7691:1164#0/1
gggggfggfffgaffc]cddddddadddacd]b
@HWUSI-EAS1795_0092:3:1:7736:1155#0/1
CGGAAACAAGAGGAATAACAAGAACAAACAGCG
+HWUSI-EAS1795_0092:3:1:7736:1155#0/1
age_ggggg`gggggcdggdffgeffgeefggf
@HWUSI-EAS1795_0092:3:1:8006:1164#0/1
AAAAAATCGAACTCGTTGCTGTCGGCGTTCCAA
+HWUSI-EAS1795_0092:3:1:8006:1164#0/1
hhhhhhhhhhhhhhhhhhhcfhhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:8319:1162#0/1
CTTTGTCATTGTATTAAATAATGCTTTTATATG
+HWUSI-EAS1795_0092:3:1:8319:1162#0/1
hhhfhhhhhhhfhhhhhghghhhhhghfgghfh
@HWUSI-EAS1795_0092:3:1:9245:1159#0/1
GTCACCGTGGTCAACTCCACTGCCCAGAAGGAC
+HWUSI-EAS1795_0092:3:1:9245:1159#0/1
hhhhhhhhhhhhhhhghhhhhhhhhfhgghfhg
@HWUSI-EAS1795_0092:3:1:9556:1161#0/1
AGAAGCCGCGTTCAACACGTATGCCACATTCTC
+HWUSI-EAS1795_0092:3:1:9556:1161#0/1
gggggggggggggggdgggggfgggcggfdgaf
@HWUSI-EAS1795_0092:3:1:10984:1156#0/1
TGGACATCAGTTAAGCCACTTATTAGGCATAGT
+HWUSI-EAS1795_0092:3:1:10984:1156#0/1
hhhghhhhhhhhhhghhhhhhfhghhhgfhhgh
@HWUSI-EAS1795_0092:3:1:11163:1156#0/1
GTTATAACTCAGGCCATAGTACCCGCAAACAAA
+HWUSI-EAS1795_0092:3:1:11163:1156#0/1
ggggggfggeggggggfgggggggggggggggg
@HWUSI-EAS1795_0092:3:1:11211:1159#0/1
TCGGCCTCAAGCATAAACTCCTTGGACTCCTGA
+HWUSI-EAS1795_0092:3:1:11211:1159#0/1
gggfgffggggggggggfaffccffffgggggg
@HWUSI-EAS1795_0092:3:1:11535:1162#0/1
TTTTGATTTGCGTGCACAATTCGCGATTGCGAT
+HWUSI-EAS1795_0092:3:1:11535:1162#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:11714:1164#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11714:1164#0/1
hhhhhhhhhhhghhhhhfhhgcfhhfhhfhgge
@HWUSI-EAS1795_0092:3:1:11828:1161#0/1
TTCAGGAGGCCGTTGCCACGCTTGCAGTAAGCG
+HWUSI-EAS1795_0092:3:1:11828:1161#0/1
ggggggfggggggggggffaf_fcfffeggggg
@HWUSI-EAS1795_0092:3:1:12049:1162#0/1
TGCAACGCATGCTGGAGCAGGCCATGATCCTGC
+HWUSI-EAS1795_0092:3:1:12049:1162#0/1
hhhhhhhghhgfhghghhhghhhhhghehhdhg
@HWUSI-EAS1795_0092:3:1:12248:1162#0/1
TGGCGACAACCTGAGTGCGCAGCACTTAGCGAA
+HWUSI-EAS1795_0092:3:1:12248:1162#0/1
_V]aX``fdfcf_dRO^\Y\aYaaaBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12726:1163#0/1
CCGGAGGTGAAGGTGGATAAACAGGGATTTCTG
+HWUSI-EAS1795_0092:3:1:12726:1163#0/1
gggfgggafccff_ffcdffffggggfgggf]g
@HWUSI-EAS1795_0092:3:1:13303:1155#0/1
GAAGAAGCTGACGGTCAAGGCGCGCGAGAACAT
+HWUSI-EAS1795_0092:3:1:13303:1155#0/1
gggggggggggggggggfdfdafffffgg__ge
@HWUSI-EAS1795_0092:3:1:13988:1154#0/1
ATTTTGTGGACCAATGATACCAATGCGGGCAAA
+HWUSI-EAS1795_0092:3:1:13988:1154#0/1
hhhhhhhhhhhhhhhhghehhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14394:1162#0/1
GTTTGCTTGGCTGATGCCGCAGCCTTCTTCTGC
+HWUSI-EAS1795_0092:3:1:14394:1162#0/1
hhhhhhfhhhhhhghhhhfhhhhhgfhhghhgh
@HWUSI-EAS1795_0092:3:1:14578:1162#0/1
GTCGTATGCGACGGCGTCGAGCTAACAGTGGTC
+HWUSI-EAS1795_0092:3:1:14578:1162#0/1
gfgggggggggggdagggggggggcgdgggggd
@HWUSI-EAS1795_0092:3:1:14760:1164#0/1
TTCCAATTGAAGTATTATCACCACAGCACGATC
+HWUSI-EAS1795_0092:3:1:14760:1164#0/1
Q\YZXZZZ^ZUZMVVYX_^^__^\___cacRVZ
@HWUSI-EAS1795_0092:3:1:14834:1155#0/1
GCAGGTGAGCGGCCACTCGGTGGCGGGCGTCGT
+HWUSI-EAS1795_0092:3:1:14834:1155#0/1
ggegggggggcgffffcaff_cfafdbUZW\YZ
@HWUSI-EAS1795_0092:3:1:14872:1162#0/1
GGAGGTGGTGCCGCTGTGCATGAAGGCGTTGGC
+HWUSI-EAS1795_0092:3:1:14872:1162#0/1
ggggdbgfdfffcfffcggeggggggdgecggf
@HWUSI-EAS1795_0092:3:1:16068:1156#0/1
GTCGATGAAATTCGTCGATGGCCTGATGATCCA
+HWUSI-EAS1795_0092:3:1:16068:1156#0/1
ggdfdggfgggggfgggg[gfggagggggdgdf
@HWUSI-EAS1795_0092:3:1:16436:1162#0/1
TGATTTCCTCATTCACCTTTTGTGCATCATTCT
+HWUSI-EAS1795_0092:3:1:16436:1162#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17015:1159#0/1
CTTGCTTTTTTCTTCTGTAGAGGAGGAATCTTA
+HWUSI-EAS1795_0092:3:1:17015:1159#0/1
cffdcffdbdc````baeY^edfdfccff]fff
@HWUSI-EAS1795_0092:3:1:17563:1162#0/1
CGAGTGTGCTTACACGTCCAGCGGAAAGTTTTC
+HWUSI-EAS1795_0092:3:1:17563:1162#0/1
hghhhhhhhhhhhhhhhhhhhhghhfghhhhhh
@HWUSI-EAS1795_0092:3:1:17605:1159#0/1
GGAGATCCAGAAACCTCTATACAGACCGGGCAC
+HWUSI-EAS1795_0092:3:1:17605:1159#0/1
gfhhffhhhhghhghhhhhghfhcghhcghghh
@HWUSI-EAS1795_0092:3:1:18052:1162#0/1
TATATATATTCATATTCTTTTCTCCCGATGTGG
+HWUSI-EAS1795_0092:3:1:18052:1162#0/1
hhhhhhhhhhhhhghghhhhhgfhhhhfhfhhf
@HWUSI-EAS1795_0092:3:1:19193:1162#0/1
TGAAATTGATTTTTAAAAAGAACTTGGCATTTG
+HWUSI-EAS1795_0092:3:1:19193:1162#0/1
hhhghhhhhhhhhhhhghhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19245:1161#0/1
TGCAAGGCCAAGCGCGTCGATAATGTGGAGCAA
+HWUSI-EAS1795_0092:3:1:19245:1161#0/1
ghhhhgchahhfggfhgfdafffcfdfc[e_dd
@HWUSI-EAS1795_0092:3:1:1231:1166#0/1
GTTATTGTGGGCCGGTACTATTACTTTGAACAA
+HWUSI-EAS1795_0092:3:1:1231:1166#0/1
GZ\^U]OccX_aaVKJbaa^^Y^Iaaaccccac
@HWUSI-EAS1795_0092:3:1:3017:1173#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3017:1173#0/1
ggff\afffffadfcffcfRffL````]P^``c
@HWUSI-EAS1795_0092:3:1:3076:1165#0/1
AAGCGATCCGCCTCGCCCTTGAGACCCCTGCTT
+HWUSI-EAS1795_0092:3:1:3076:1165#0/1
f__ffcffd_fffd_fcaacca^Rcca^^YaaZ
@HWUSI-EAS1795_0092:3:1:3147:1170#0/1
GTGCTCGTTGGCCTTAAGAGTATAGAGCAAGTG
+HWUSI-EAS1795_0092:3:1:3147:1170#0/1
dafffff_fdffcf]adR``TaN\Y]Rdcdc]a
@HWUSI-EAS1795_0092:3:1:3575:1165#0/1
GCCGAACTTTTCGGTATTTGGAATAATCTGACC
+HWUSI-EAS1795_0092:3:1:3575:1165#0/1
gggcfgdcgfggffedeffffcfaffdffefff
@HWUSI-EAS1795_0092:3:1:3729:1173#0/1
GCTGGGCATTGAACGGTTCTGGCAGGCAGTAAC
+HWUSI-EAS1795_0092:3:1:3729:1173#0/1
fdafafcfffffgggggfggggfggggegcegf
@HWUSI-EAS1795_0092:3:1:3878:1170#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3878:1170#0/1
Z\__^\[daddccffdacdd]dd]d\ddRccd_
@HWUSI-EAS1795_0092:3:1:4475:1170#0/1
GTTTGGAGTGCAGCACAACAAAATCAACAACAA
+HWUSI-EAS1795_0092:3:1:4475:1170#0/1
gggg_gcfffffggggggggg`gggcgfgf_fg
@HWUSI-EAS1795_0092:3:1:4886:1168#0/1
TACGGTTCCAATTCCGTAACCTGTTGAGTATCC
+HWUSI-EAS1795_0092:3:1:4886:1168#0/1
faffcffhhhhhhhhghhhhhhchhhfgehhhh
@HWUSI-EAS1795_0092:3:1:5909:1168#0/1
CTTCGGTGTTAGCATCAATCAAGAGTTCCATTT
+HWUSI-EAS1795_0092:3:1:5909:1168#0/1
hhhhhghhhhghhhhhhhhhhhgfhhhhhchhh
@HWUSI-EAS1795_0092:3:1:6151:1175#0/1
GTTTAATTTCTTCCATCGAAAGGAATTTCGACG
+HWUSI-EAS1795_0092:3:1:6151:1175#0/1
caaYZ^[\acc_Z\]^^BBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:6468:1175#0/1
GTTTCTCTCCTCGTTGACGGCCTGCATTAGCAG
+HWUSI-EAS1795_0092:3:1:6468:1175#0/1
ffaffdagggggfggfcffdffWbddfffcffg
@HWUSI-EAS1795_0092:3:1:7124:1174#0/1
CCGAAATCGGAGTAGATTAAGCATCTGGTTATT
+HWUSI-EAS1795_0092:3:1:7124:1174#0/1
hhhhhhhhhhhhhhdghhhhhhhhhhhahhhhh
@HWUSI-EAS1795_0092:3:1:7885:1170#0/1
CGCCGATCCAAACAGAGTACTTGCGTTCTGGCG
+HWUSI-EAS1795_0092:3:1:7885:1170#0/1
ggggcgfgggggfggfggggggdggffggdcgg
@HWUSI-EAS1795_0092:3:1:8151:1168#0/1
GTCCGGATACCGAGATCAGCGTGAACAACGCCT
+HWUSI-EAS1795_0092:3:1:8151:1168#0/1
ggggggggggggfffefggggffggggggggge
@HWUSI-EAS1795_0092:3:1:8886:1174#0/1
GGAGGTGATTTCGGGACCGATTGGTTACCAACC
+HWUSI-EAS1795_0092:3:1:8886:1174#0/1
hhhhhdhhhhhhhhhhhhhhhhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:8930:1167#0/1
GGACATGCCCCTCTGGATAAATTGGCGATTTAA
+HWUSI-EAS1795_0092:3:1:8930:1167#0/1
hhhhhhhhhhhhhhhhggfhhhfhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:9055:1167#0/1
ATTCCCACGGCCAGGTAGTACCGGCCATCAGCC
+HWUSI-EAS1795_0092:3:1:9055:1167#0/1
ggggggggggggggggc[^cdad^d`bTWXT_U
@HWUSI-EAS1795_0092:3:1:9307:1174#0/1
TGGGAGTGTTGTACTTGTTCTTGTCCTGAAATG
+HWUSI-EAS1795_0092:3:1:9307:1174#0/1
ggafdffffffffffffggggggggfggggaff
@HWUSI-EAS1795_0092:3:1:9490:1175#0/1
GGATGAGTCACCCGCACATTGTTTACACACCCC
+HWUSI-EAS1795_0092:3:1:9490:1175#0/1
hhdhhhghhhhhhghhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9625:1170#0/1
GTCGGATGTAAGTACACAAATGCTTCGCTAAGT
+HWUSI-EAS1795_0092:3:1:9625:1170#0/1
hhhhhhhhhhhgghhhhhhhdehhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:9762:1173#0/1
GCCAAGTACACCGACACCACTCCGATCGCCGGC
+HWUSI-EAS1795_0092:3:1:9762:1173#0/1
gggggggfffffg]gggggggggggdgcfc]ac
@HWUSI-EAS1795_0092:3:1:10555:1170#0/1
GGAGGATGGCCAAGAGAATGAGCAACAGCTGGA
+HWUSI-EAS1795_0092:3:1:10555:1170#0/1
ggeggfggfgegggcdfgfgggggfggggggdg
@HWUSI-EAS1795_0092:3:1:10672:1165#0/1
CGCGATACTTGGTGTTCAGTGGGGTCGGAGCTC
+HWUSI-EAS1795_0092:3:1:10672:1165#0/1
hhhhhhhhhhhhghhhhhhhhhhhefhhfhhhh
@HWUSI-EAS1795_0092:3:1:10730:1169#0/1
CGTCTTTTAATTGAAGGCTGGAATGAATGGTTG
+HWUSI-EAS1795_0092:3:1:10730:1169#0/1
gggffggggfgggegggfaffadafdffefffg
@HWUSI-EAS1795_0092:3:1:11031:1165#0/1
TGATGATGTTGCTGCTGTGGCGAGTGTTGGTGT
+HWUSI-EAS1795_0092:3:1:11031:1165#0/1
hhhhhfhhhhhhhhhhghhhhhdddfffffccf
@HWUSI-EAS1795_0092:3:1:11071:1176#0/1
CTGCGTTTGCAGAATATTTAGCACCTTTCATTG
+HWUSI-EAS1795_0092:3:1:11071:1176#0/1
ab^__`W]babbca_YacccRcaa^^^caa\ac
@HWUSI-EAS1795_0092:3:1:11122:1169#0/1
CCGCGGGGTTCTTTGGCTCAACAGCCACGCGCA
+HWUSI-EAS1795_0092:3:1:11122:1169#0/1
ffffaRcc]f_fd`]`dZ`a_[^\^U\f`]cf[
@HWUSI-EAS1795_0092:3:1:11469:1173#0/1
ATGGGACATGTGCTTTTATTAGGCTAAAACCAA
+HWUSI-EAS1795_0092:3:1:11469:1173#0/1
hhhhhhhhhhhhhhhhhghgghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11941:1171#0/1
ATCAATACTGCCAGGAACGTGAAGGCCGACTTC
+HWUSI-EAS1795_0092:3:1:11941:1171#0/1
gggceaggggggggaggggegcafcff[ddddg
@HWUSI-EAS1795_0092:3:1:12228:1170#0/1
CTGATTTCGAATGATGTCAATGAGAACGACATC
+HWUSI-EAS1795_0092:3:1:12228:1170#0/1
ggfeggggg]ggfcffffgdggcgggggggggg
@HWUSI-EAS1795_0092:3:1:12989:1167#0/1
GGGCGCCAAGGCCAACCAGTTCGACTGGGCGCT
+HWUSI-EAS1795_0092:3:1:12989:1167#0/1
hhhhhhhhhhghhhhhhfghhhghhfhgghhhg
@HWUSI-EAS1795_0092:3:1:13289:1168#0/1
CCCCACACGATCGGACCAGTGCTGTACTTGACG
+HWUSI-EAS1795_0092:3:1:13289:1168#0/1
gecgfggfffdfgggggccc]acdeffggfdgg
@HWUSI-EAS1795_0092:3:1:13860:1172#0/1
GTCGATTCCGGTAAGTCGACCACCACCGGACAC
+HWUSI-EAS1795_0092:3:1:13860:1172#0/1
hhfhhhhhhhhhhhdhhhhhhhhhhhhheghgh
@HWUSI-EAS1795_0092:3:1:16244:1167#0/1
CAGATATTTAGCATATACATTTACATATAATAT
+HWUSI-EAS1795_0092:3:1:16244:1167#0/1
bacecceggggfgcgaggcgggecgggdfffgg
@HWUSI-EAS1795_0092:3:1:16532:1175#0/1
CGGTGAAGATCTCATGGACAAGATCCTCGACGC
+HWUSI-EAS1795_0092:3:1:16532:1175#0/1
geggfggfggggggggaffffcfcffcdfcc_`
@HWUSI-EAS1795_0092:3:1:16908:1169#0/1
TAGATGACGAGGCATTTGGCTACCTTAAGAGAG
+HWUSI-EAS1795_0092:3:1:16908:1169#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:17705:1165#0/1
CTGAAGAGCCAGCGCGAGGCGCTCGTCAAGCCG
+HWUSI-EAS1795_0092:3:1:17705:1165#0/1
gggggggfgggdgaggeeefef[bb``fcdfec
@HWUSI-EAS1795_0092:3:1:17959:1170#0/1
GGCATTTTCGGAGCGACTGGCGCGATCGGTGAG
+HWUSI-EAS1795_0092:3:1:17959:1170#0/1
hghhhhhhhhhfhhfhghghdffhcheffbdad
@HWUSI-EAS1795_0092:3:1:18250:1175#0/1
CGGCCATCTTGTGGGGGTCCTCCTTGGCAATGG
+HWUSI-EAS1795_0092:3:1:18250:1175#0/1
hhhhhhhghhghhhhhghhhghhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18367:1175#0/1
AAAGTGGTCTCCGCAGGTACTACACATGATCAG
+HWUSI-EAS1795_0092:3:1:18367:1175#0/1
hhhhhhhhhfhhhhhhhhhhhhghhhfhghhhh
@HWUSI-EAS1795_0092:3:1:19152:1171#0/1
CCGCTTAGAAGCCGTGCACCTTCAGCTGATCCG
+HWUSI-EAS1795_0092:3:1:19152:1171#0/1
hhhhhgghghghhhgfgcffffh]hhhhhghhh
@HWUSI-EAS1795_0092:3:1:1930:1182#0/1
ATTTTCTCCTTGTTGTGGTTTATTTCTCCTCCT
+HWUSI-EAS1795_0092:3:1:1930:1182#0/1
gggggggggdfggggggggdggggfggggggef
@HWUSI-EAS1795_0092:3:1:2082:1182#0/1
GTTTTGATGACGAAATAGTTGAGTACAACATTG
+HWUSI-EAS1795_0092:3:1:2082:1182#0/1
\fhhhhffffffQQbbbffffffafffdffhfh
@HWUSI-EAS1795_0092:3:1:2567:1183#0/1
GAGAAATCGAAAAAGGAACTGGTGGATAACAAG
+HWUSI-EAS1795_0092:3:1:2567:1183#0/1
gggggggggggggdcgggggcgdffffggggfg
@HWUSI-EAS1795_0092:3:1:3283:1177#0/1
GATCGCTAACACAAACTCGCGTCAGAACATTCG
+HWUSI-EAS1795_0092:3:1:3283:1177#0/1
hhhhfhgghhhhhhhhhfffcceedeehhhhhg
@HWUSI-EAS1795_0092:3:1:3709:1181#0/1
ATATGTATATGTGTGTAGAAGGTATGCATGAGT
+HWUSI-EAS1795_0092:3:1:3709:1181#0/1
hhhfhhhhhhhhhhhhfffhffgffggghhhdh
@HWUSI-EAS1795_0092:3:1:3799:1180#0/1
GCCGAATTGTACAAAACGCTAGTGTGTTGTTTG
+HWUSI-EAS1795_0092:3:1:3799:1180#0/1
d]ff]cfd^a_c\aaS^ddWc\Z`V__ZR_\XZ
@HWUSI-EAS1795_0092:3:1:4547:1182#0/1
TGCGAAAAACGTAAAGATAGGCTTTGACAAGTC
+HWUSI-EAS1795_0092:3:1:4547:1182#0/1
hhhhhhhhhhhhhhgghfhhhhhhhhhhghfhf
@HWUSI-EAS1795_0092:3:1:4614:1182#0/1
TTTCTTTCTCACATTCGCTGAGCTTGTCTTCTC
+HWUSI-EAS1795_0092:3:1:4614:1182#0/1
f\ffdcc`cfdffdffd\fefeccdebfdfdfc
@HWUSI-EAS1795_0092:3:1:4798:1186#0/1
GCAAATTGGCCAACAACCAGAGCGCCATCGTCG
+HWUSI-EAS1795_0092:3:1:4798:1186#0/1
gfffffffcfffffff_ffafdfdfffdfddff
@HWUSI-EAS1795_0092:3:1:5059:1182#0/1
GGCCATCATCGTCAAGACCCACGACGATGGAAC
+HWUSI-EAS1795_0092:3:1:5059:1182#0/1
a^fcfffggggccffcecffffcafcfffaffe
@HWUSI-EAS1795_0092:3:1:5227:1182#0/1
GTTTTCGTGGTATTTCATTTAAAATTATTGCCA
+HWUSI-EAS1795_0092:3:1:5227:1182#0/1
fhhhhhhgfhffhhhhdhhhhhhhhhfhhghhg
@HWUSI-EAS1795_0092:3:1:5444:1179#0/1
GAGAAGACGATCTGCAGGCCGGAGGCCGTCATC
+HWUSI-EAS1795_0092:3:1:5444:1179#0/1
hhhhhhhhhhhhhhhhchhhhhfhhchhhhhhg
@HWUSI-EAS1795_0092:3:1:5488:1181#0/1
TGTGGGTGTCCTTGTCGAATTCGATGGCCTGGT
+HWUSI-EAS1795_0092:3:1:5488:1181#0/1
hghhghghhhhhhfhfhggfhhhfghhhfegfa
@HWUSI-EAS1795_0092:3:1:6023:1177#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6023:1177#0/1
ffffcafffcf]d[ddeeffaf`]ffcffRafe
@HWUSI-EAS1795_0092:3:1:6050:1188#0/1
CCAGCACAGCAAAATTCCACGTCTGTTCTTTCT
+HWUSI-EAS1795_0092:3:1:6050:1188#0/1
hhhhhhhhhhhhheghghhhhhgfghhhhhhch
@HWUSI-EAS1795_0092:3:1:6486:1183#0/1
CTGGTGGCTTCCTCCTGTACAGGTTTCTTTGTG
+HWUSI-EAS1795_0092:3:1:6486:1183#0/1
hhhgghhhhhhhhhhhhhhhhhhhhhhhhhche
@HWUSI-EAS1795_0092:3:1:6784:1178#0/1
GCGGGCTGGTCTATGCCTTGGTCTCCACGGCCG
+HWUSI-EAS1795_0092:3:1:6784:1178#0/1
^aWade`cfaccggdggfgeafedgggeddgef
@HWUSI-EAS1795_0092:3:1:7312:1182#0/1
CTCGATTATTTGCTACTACCACCAAGATCTGTA
+HWUSI-EAS1795_0092:3:1:7312:1182#0/1
hhhfghhhhhhghhhghhhhhhhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:7429:1184#0/1
ATTTGCCATGGCATGGAACACATGACGCTTTCG
+HWUSI-EAS1795_0092:3:1:7429:1184#0/1
ffgggggfggggggggfgggegffggggggggg
@HWUSI-EAS1795_0092:3:1:7980:1178#0/1
AGTGTATTGTATTTGGAACCAGAGGAGCAGGCA
+HWUSI-EAS1795_0092:3:1:7980:1178#0/1
hhhghhhhhhghhhhhhhhghgghhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:8168:1181#0/1
GGGACAGTTGTTGCGCAACCAGTACTTCACCTG
+HWUSI-EAS1795_0092:3:1:8168:1181#0/1
gggggggggfgggfgcggfgggfggggaggggg
@HWUSI-EAS1795_0092:3:1:8236:1187#0/1
GTAAAACCGAATGACTCGTTGACGGGCAGGTAT
+HWUSI-EAS1795_0092:3:1:8236:1187#0/1
_cffccfcfafcgggcgdff]ffa]cf]bb`a]
@HWUSI-EAS1795_0092:3:1:8255:1181#0/1
ATGTCGTACAACCCAGCACTGAACGCCGTGCTA
+HWUSI-EAS1795_0092:3:1:8255:1181#0/1
hghhhhhhhhhhhhhghhhhhhhhffhedeheh
@HWUSI-EAS1795_0092:3:1:8560:1186#0/1
TAATCATTCGCTTTACCAGATAAGATTATTTTA
+HWUSI-EAS1795_0092:3:1:8560:1186#0/1
_ZcaS\X`^a`ac\__f^da^da\acc^ffccc
@HWUSI-EAS1795_0092:3:1:8801:1181#0/1
ACAGCTTCTGTAAGCACTGGCAGCAGGCCTTCG
+HWUSI-EAS1795_0092:3:1:8801:1181#0/1
hhhhhhhhhghhhhghhhggeffdaRdY_\^^T
@HWUSI-EAS1795_0092:3:1:9178:1186#0/1
ATTATTTATGAATTAATTGGGCCCGCATATGTG
+HWUSI-EAS1795_0092:3:1:9178:1186#0/1
chhhhhhehhghhhhfhhfhgghhghhhhhghh
@HWUSI-EAS1795_0092:3:1:9273:1180#0/1
GGGAGGGAGCCTGGAAGTGACGCTTGCGGTTCT
+HWUSI-EAS1795_0092:3:1:9273:1180#0/1
hhhhhhhhefhhfhghgfhhdhhhghhhgghhh
@HWUSI-EAS1795_0092:3:1:9377:1178#0/1
GTGGATGCGGGTGACCTTGCCCCAGACAGCGCG
+HWUSI-EAS1795_0092:3:1:9377:1178#0/1
gfggfggffcfdgggfgcggggggfgccaddff
@HWUSI-EAS1795_0092:3:1:9448:1181#0/1
GGTTAGGGGAAAGTATTAACCGCAGGCCGGAAT
+HWUSI-EAS1795_0092:3:1:9448:1181#0/1
hhhhhhhhhdgfhhghhhghhhhghghhhhfhg
@HWUSI-EAS1795_0092:3:1:10185:1183#0/1
GAGGTCAACGCCGAGGAGGAGCAGCCGCGGGCC
+HWUSI-EAS1795_0092:3:1:10185:1183#0/1
ggfggggggggggeggcggggafdffdgggea_
@HWUSI-EAS1795_0092:3:1:10246:1185#0/1
CTGCTGTTGGCCACCGAGTTGTTCAGGTAGCGA
+HWUSI-EAS1795_0092:3:1:10246:1185#0/1
fdccfffgggggd]fafdefcfdffd[dfa_df
@HWUSI-EAS1795_0092:3:1:10765:1182#0/1
GTTGTTGTTGGTCTAAATGAGGGCGGCTGCTGC
+HWUSI-EAS1795_0092:3:1:10765:1182#0/1
Wba^a^]\UVY\UVURT\WT]_cccccc_c__c
@HWUSI-EAS1795_0092:3:1:11658:1180#0/1
TTATGATGTTGGTTATATGCTTGTTGTTGCTGC
+HWUSI-EAS1795_0092:3:1:11658:1180#0/1
hhhhfhhhhhhfhhhghhghhhgheghhhhhhh
@HWUSI-EAS1795_0092:3:1:12105:1188#0/1
GATCCCTTCAGTGGAATCACTAGGTTTACATTG
+HWUSI-EAS1795_0092:3:1:12105:1188#0/1
hhhhhhhhhhhhhfhhhhhhhghghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12616:1182#0/1
CAAAAATAGAAGAGATGGATAAAATTTCTCATC
+HWUSI-EAS1795_0092:3:1:12616:1182#0/1
hhhhhhhhhhhhhghghhhchhhghhghhhdhh
@HWUSI-EAS1795_0092:3:1:12683:1187#0/1
TCGAAATCCGCTAAGGAGTGTGTAACAACTCAC
+HWUSI-EAS1795_0092:3:1:12683:1187#0/1
gggggggggggggggggfacffdgggggggggg
@HWUSI-EAS1795_0092:3:1:12737:1178#0/1
GTCAAGTGCGTGCACTGGCATCCACAAAAGGGA
+HWUSI-EAS1795_0092:3:1:12737:1178#0/1
^ZZaa\Ybdb^bfff_ffff]ffffcddccdff
@HWUSI-EAS1795_0092:3:1:12817:1186#0/1
GGATGAACTGTTTATCCACCTTTATCCGCTGGA
+HWUSI-EAS1795_0092:3:1:12817:1186#0/1
hchhhghhhghhhhhhhhhhhhhhhhhhhfhhg
@HWUSI-EAS1795_0092:3:1:13095:1184#0/1
AATCAACCACTTTTGACACCTAACAACCAAACA
+HWUSI-EAS1795_0092:3:1:13095:1184#0/1
gggdgggggggggagdfgggcggggggdfgggg
@HWUSI-EAS1795_0092:3:1:13258:1177#0/1
CTGCCGGTAGGCCACTCCTCTGGGTTTCTAGTT
+HWUSI-EAS1795_0092:3:1:13258:1177#0/1
fggggggggffggdggggcggffafffdfgggf
@HWUSI-EAS1795_0092:3:1:13505:1186#0/1
GCCAGAGCGGCCTTCAAGTCATCCACCCAGTTA
+HWUSI-EAS1795_0092:3:1:13505:1186#0/1
Yff_cffcedcadeecd__accadcccccadff
@HWUSI-EAS1795_0092:3:1:13694:1180#0/1
GCTCGTTAAAGTCGATGCGCATGAGGCCGTAGT
+HWUSI-EAS1795_0092:3:1:13694:1180#0/1
gdfggggggggcfdfffd]fdf]bba]ed_dbf
@HWUSI-EAS1795_0092:3:1:13891:1178#0/1
TGCACGCCAAGGGAGCTGGTGCTTTTGGTTACT
+HWUSI-EAS1795_0092:3:1:13891:1178#0/1
ggggggggggagfbdfdffafafdcdfcggeef
@HWUSI-EAS1795_0092:3:1:14015:1177#0/1
CAGGACGTGATCAAGAGCCTGGAGCGCAAGCGC
+HWUSI-EAS1795_0092:3:1:14015:1177#0/1
ggggggggggggggaggffefeggggggggggg
@HWUSI-EAS1795_0092:3:1:14139:1180#0/1
CCGGAGGCTGCTACGCCACCGGCAACAGAAGAG
+HWUSI-EAS1795_0092:3:1:14139:1180#0/1
hhghghhhhfghhhhghfhhhhchghhgacceg
@HWUSI-EAS1795_0092:3:1:14430:1183#0/1
CTACTGTTGTTGTTGCTTGGCCGAAGCGTCGCT
+HWUSI-EAS1795_0092:3:1:14430:1183#0/1
dRa^^cW\^\Z\^^dd^Z`ab`dP^da^Y^[^`
@HWUSI-EAS1795_0092:3:1:14677:1183#0/1
CAGCTGGCCTATCAACAGGAAACGGCTGAGTAC
+HWUSI-EAS1795_0092:3:1:14677:1183#0/1
ggfgcagggfgggggggagggfg_gf_edcaff
@HWUSI-EAS1795_0092:3:1:14837:1179#0/1
GACGATTTCGCCGGCCAACTTATACTTGGTCAC
+HWUSI-EAS1795_0092:3:1:14837:1179#0/1
faggccgggafgdcffffacffggcggg]gggf
@HWUSI-EAS1795_0092:3:1:15974:1181#0/1
CCGGTGTTGTCGGCACAGTTCATCACGGCGCCC
+HWUSI-EAS1795_0092:3:1:15974:1181#0/1
hhhhhhghghhcghhchhhhffhhhhghghhhh
@HWUSI-EAS1795_0092:3:1:16016:1188#0/1
CGGCGTTTTTCGTTTCGGTGTTAGCATCAATCA
+HWUSI-EAS1795_0092:3:1:16016:1188#0/1
gggggfgggggaggge[`W]^`a_a^^gcggcc
@HWUSI-EAS1795_0092:3:1:16475:1181#0/1
GCCGCTGCTACCGCCTTCGCAGCGGCATTAGCA
+HWUSI-EAS1795_0092:3:1:16475:1181#0/1
ggggggfgggggggfagfggfcgggggegfggg
@HWUSI-EAS1795_0092:3:1:16686:1177#0/1
TTGAGTGGTGTTGGTGTTATACTACTATTGTGT
+HWUSI-EAS1795_0092:3:1:16686:1177#0/1
ggf_fffgggfgggggggfgggggggggggggg
@HWUSI-EAS1795_0092:3:1:16776:1177#0/1
CCTTCAGCTGCTTGCGCCGTTTGCGCATCTCGA
+HWUSI-EAS1795_0092:3:1:16776:1177#0/1
hhhhhhhhhhhhhhhfhhfhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17418:1179#0/1
CTACAGTATGTACTTAGAGACTAACTCGAATTT
+HWUSI-EAS1795_0092:3:1:17418:1179#0/1
gggfg_fffdddggggdfcaffggffdcgfggg
@HWUSI-EAS1795_0092:3:1:18465:1182#0/1
CCGGGACTGTGTATGAGGCACGCGAATAGACAA
+HWUSI-EAS1795_0092:3:1:18465:1182#0/1
ggggggggfggggggggggggfgggfggffgge
@HWUSI-EAS1795_0092:3:1:18749:1188#0/1
AAGTGGACAAAAACGAGACTGTCACCTGCACGG
+HWUSI-EAS1795_0092:3:1:18749:1188#0/1
hhhhhhhhhhhhhhhhdhhhhghhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:18833:1182#0/1
GTTGTTGTGGTAGTGGGCTCTGTTGTTGTGGTA
+HWUSI-EAS1795_0092:3:1:18833:1182#0/1
fhhhhhhhhhghhgfhhhhfhghehhfhhfggh
@HWUSI-EAS1795_0092:3:1:19489:1181#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19489:1181#0/1
cafafafaede_abcecffffcfffff]W`ddd
@HWUSI-EAS1795_0092:3:1:19654:1179#0/1
CTTGGGTGGCAATCAAGCTGACGAGAACCAGAC
+HWUSI-EAS1795_0092:3:1:19654:1179#0/1
g_fffffacf^ffffffgggdfafcdff]faff
@HWUSI-EAS1795_0092:3:1:19768:1185#0/1
ATATTTGAAGGGCACTATCGATATGAAATTGAT
+HWUSI-EAS1795_0092:3:1:19768:1185#0/1
acgeggfggggggggggggcgf]gggffgefaf
@HWUSI-EAS1795_0092:3:1:1134:1192#0/1
AGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCA
+HWUSI-EAS1795_0092:3:1:1134:1192#0/1
cfa^^cca^Za[a\bSLa`Yaa^]SaBBBBBBB
@HWUSI-EAS1795_0092:3:1:1370:1198#0/1
GGACCAGTTCGCGAGGGCGACATCCTGACCCTT
+HWUSI-EAS1795_0092:3:1:1370:1198#0/1
YY\^a[[dadddffcfcY`aRaW\V__d[dadf
@HWUSI-EAS1795_0092:3:1:2755:1199#0/1
TGGCAAACTGGCGATGCAATTGAAGATGATGAT
+HWUSI-EAS1795_0092:3:1:2755:1199#0/1
f[fffffggcfggfgfggggcc_fff]faaffa
@HWUSI-EAS1795_0092:3:1:3364:1192#0/1
CAGATACTGTGGACCCTTAATTTTTGCGCAGTC
+HWUSI-EAS1795_0092:3:1:3364:1192#0/1
hhhhhhhhghhhghhhhhhhhhhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:3588:1192#0/1
CTCAGTTTCAGCATCGTGATTTGCCTCGAAGAT
+HWUSI-EAS1795_0092:3:1:3588:1192#0/1
ffa]cfdafffffdfffaabbb[fdfffcd[da
@HWUSI-EAS1795_0092:3:1:3929:1189#0/1
CCAAGGTGCAGCGCCTGCTGCAGGATCTGTTCA
+HWUSI-EAS1795_0092:3:1:3929:1189#0/1
ggggggfggggfgfgdffdggcgedbggedggg
@HWUSI-EAS1795_0092:3:1:4486:1199#0/1
GGAACGGAGTGGCACTCAAGGGCAACATCGAGA
+HWUSI-EAS1795_0092:3:1:4486:1199#0/1
hhhhhhhhhhhhghhhhhhghhhhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:4893:1197#0/1
TTGAGCTTCTCGTGCAGCATGGCATCGTGTAGC
+HWUSI-EAS1795_0092:3:1:4893:1197#0/1
hhhhhhhhhhhhhghhghhfhhhgghhhfghge
@HWUSI-EAS1795_0092:3:1:5382:1197#0/1
GTGAATGATTGATTACAGAGCGCATTTAACCAG
+HWUSI-EAS1795_0092:3:1:5382:1197#0/1
hhhhhhhchhhfhhhhhhghhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:5666:1194#0/1
GTCCTTGGTGTGGATGCCAGCGCCGATGCGGTA
+HWUSI-EAS1795_0092:3:1:5666:1194#0/1
gggggggggggfgffggggggggggeggggggg
@HWUSI-EAS1795_0092:3:1:6015:1193#0/1
AGAAGATGCGCACAAAGAAGGTGGACAACATCC
+HWUSI-EAS1795_0092:3:1:6015:1193#0/1
gggdfgggggfddefcfc`cf[eaa[dffdffg
@HWUSI-EAS1795_0092:3:1:7500:1195#0/1
GTTTTCATGTGCGAATCGTTTCGTTTGCATTAG
+HWUSI-EAS1795_0092:3:1:7500:1195#0/1
gggfggggggegggggggggeggggggggggfg
@HWUSI-EAS1795_0092:3:1:8141:1198#0/1
TCTGAGTTCAAACCGGTGTAAGCCAGGTTGGTT
+HWUSI-EAS1795_0092:3:1:8141:1198#0/1
hhhhhhhghhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:8818:1193#0/1
CTGGCATAGTAATCGGTCTTTCCTTCGCGACGC
+HWUSI-EAS1795_0092:3:1:8818:1193#0/1
aa]aV\`a\OaabddddffffffaW[fabdbbf
@HWUSI-EAS1795_0092:3:1:9944:1200#0/1
GAAAAATCGGCTTTTGAACTTGTGCTAATCGCA
+HWUSI-EAS1795_0092:3:1:9944:1200#0/1
gggggggggggggggcgfffffgggggfggggg
@HWUSI-EAS1795_0092:3:1:10393:1193#0/1
GCTGGGTTCACGTTGCACCGCTTGCGCAGGTAG
+HWUSI-EAS1795_0092:3:1:10393:1193#0/1
ggggggggggffggdggggggggggfggggbgf
@HWUSI-EAS1795_0092:3:1:10563:1200#0/1
GGCGTGACGACCTAAATTATTTTCAAGAATGCG
+HWUSI-EAS1795_0092:3:1:10563:1200#0/1
]ZHWX[[eeebegfggggfgggggggggfgggg
@HWUSI-EAS1795_0092:3:1:10690:1196#0/1
TTCAACATGAAGGCCACCCTCGACGAGGATAAC
+HWUSI-EAS1795_0092:3:1:10690:1196#0/1
hhhhhhhhhhhhhhhhhhhghgfhhfhghfhhh
@HWUSI-EAS1795_0092:3:1:11284:1199#0/1
TTTAGCACCTTTCATTGGGTTTGAAAATCAACG
+HWUSI-EAS1795_0092:3:1:11284:1199#0/1
hhhhhhhhhghhhehghehghhchhefhdhhhh
@HWUSI-EAS1795_0092:3:1:11360:1191#0/1
GTTCTGGAGCAGCCATACATGGCCGGCCAGTCT
+HWUSI-EAS1795_0092:3:1:11360:1191#0/1
hhhhhhhhhhhhhhhghhhhhhhhhfhhghhhg
@HWUSI-EAS1795_0092:3:1:12166:1191#0/1
GGCTTTTGGAGCTTGATTTCACTTCAAATAGTT
+HWUSI-EAS1795_0092:3:1:12166:1191#0/1
hghhhhhhhhghhhhhhhhhfghhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:12386:1192#0/1
CCGCTGATAAGCTCCGCTGAAGCTGCAGACAAA
+HWUSI-EAS1795_0092:3:1:12386:1192#0/1
hhhhhhhhhhhhhhhhhhhhhfhhghhghhhhg
@HWUSI-EAS1795_0092:3:1:12751:1194#0/1
ACACAACATACCTAAGGGAAACAAACCTTTTGA
+HWUSI-EAS1795_0092:3:1:12751:1194#0/1
hhhhhhgghhhhhhhggffhhhhhgghhhhhfh
@HWUSI-EAS1795_0092:3:1:12935:1199#0/1
CTGGAAGAGACCAACGAGGTGGCCAATGTGATC
+HWUSI-EAS1795_0092:3:1:12935:1199#0/1
ggggggdggfgggggggcfcfeggggggcegeg
@HWUSI-EAS1795_0092:3:1:13173:1198#0/1
CGAGTGTAACCTTTGGAAGTTAACCGTGGGGAA
+HWUSI-EAS1795_0092:3:1:13173:1198#0/1
ggfgggdggggfggegcg_gdgffffffff_cd
@HWUSI-EAS1795_0092:3:1:13284:1189#0/1
GTTCGCAGTACCCTTACGCTTTCCGAATCCGCA
+HWUSI-EAS1795_0092:3:1:13284:1189#0/1
_fdfffffcffdffaffggg_fffffffggggf
@HWUSI-EAS1795_0092:3:1:13348:1195#0/1
GGATGAGGAGAGCTTCAAAAGGCAGTTTAGCCG
+HWUSI-EAS1795_0092:3:1:13348:1195#0/1
dc^aa^cfbabfcccffcf_[]ffffcafaaab
@HWUSI-EAS1795_0092:3:1:13744:1195#0/1
CGCGAGTCCAAGAGCTCTGTCTCCAGCCACAAG
+HWUSI-EAS1795_0092:3:1:13744:1195#0/1
hhhhhhhhhhhhhhhhhhhghhBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13936:1198#0/1
GTTGCCGAACTGAATTCCCCAGTCCTCCGACTG
+HWUSI-EAS1795_0092:3:1:13936:1198#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14283:1190#0/1
GGGCAAGCGCATCCGCGTCAAGCTCGACGGCTC
+HWUSI-EAS1795_0092:3:1:14283:1190#0/1
hhhhhhhhhhhhhhghhghhhhfghhfhhfhfh
@HWUSI-EAS1795_0092:3:1:14320:1197#0/1
CGGCAAAAGCGCTAAAAAAGACGAAAAAAGTTA
+HWUSI-EAS1795_0092:3:1:14320:1197#0/1
eba]``abbbd`^`dbbfcc[cdfdfe^UVW[d
@HWUSI-EAS1795_0092:3:1:14723:1192#0/1
ATCGCAGCAGACGCAGCGCGAACGATATCTTGG
+HWUSI-EAS1795_0092:3:1:14723:1192#0/1
ggggggggggggggggggegggfgggcgcggge
@HWUSI-EAS1795_0092:3:1:15094:1198#0/1
TGTGTGCTTGCTGAGCGCCTAAGTTAAGATTCC
+HWUSI-EAS1795_0092:3:1:15094:1198#0/1
^ffcdad]fa[fYdeda\`]`^]]ba`fcafff
@HWUSI-EAS1795_0092:3:1:15371:1199#0/1
CGTCTGTGCACCATGGTTACCGAGGCTGAGGTC
+HWUSI-EAS1795_0092:3:1:15371:1199#0/1
hhhhhhhhhhhhhahhghhhhhdcehgcchdag
@HWUSI-EAS1795_0092:3:1:15624:1195#0/1
CTACCTTTGCACAGTCAAAATACTGCGGCCATT
+HWUSI-EAS1795_0092:3:1:15624:1195#0/1
ggggggfggg[ggdggggggegfgggggfgggg
@HWUSI-EAS1795_0092:3:1:15665:1198#0/1
TGGATGCATAAATGCAAGTGTTTTCCCAGTGTG
+HWUSI-EAS1795_0092:3:1:15665:1198#0/1
hhhhhhhhhhhhhhhhghgghhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:15731:1200#0/1
CGGCAAGAAGCTGATGGCCTGCCGCATCGTCAA
+HWUSI-EAS1795_0092:3:1:15731:1200#0/1
ghhhhgcfhfhdhfdffffdffffffhfhhhgh
@HWUSI-EAS1795_0092:3:1:16672:1194#0/1
CAAGAAGCTGGTGAAGAAGCTGGCCAAGTCCTA
+HWUSI-EAS1795_0092:3:1:16672:1194#0/1
hghhhhhghghffhhfhfghgg_fhhhecfheh
@HWUSI-EAS1795_0092:3:1:17652:1194#0/1
CCGCTGTCCAAATTTACTCCTAGGCCGCTGTCG
+HWUSI-EAS1795_0092:3:1:17652:1194#0/1
fcaffcfggggggcafgfff_fafffffdfffg
@HWUSI-EAS1795_0092:3:1:18213:1190#0/1
GGCGGAAGGGCGTGGCATCGATGACCACGATGC
+HWUSI-EAS1795_0092:3:1:18213:1190#0/1
hfhfhhhhhcheddfhhghhh]_dfffhcgddg
@HWUSI-EAS1795_0092:3:1:18387:1189#0/1
TTTTCTTCTGTAGAGGAGGAATCTTAACTTAGG
+HWUSI-EAS1795_0092:3:1:18387:1189#0/1
fafffffcffff[dffdgcgggggfcgffffag
@HWUSI-EAS1795_0092:3:1:18916:1197#0/1
CCGCCACCGAAGCGATTGCCTCCGCCGCCGCCT
+HWUSI-EAS1795_0092:3:1:18916:1197#0/1
aa[acccccccccc[QK[^a\^_YaaBBBBBBB
@HWUSI-EAS1795_0092:3:1:19067:1193#0/1
CTTGGAATTCCCAGTAAGTGTGAGTCATTAACT
+HWUSI-EAS1795_0092:3:1:19067:1193#0/1
gggccgggggggcddefegcgffgfggffffcf
@HWUSI-EAS1795_0092:3:1:19327:1189#0/1
GCGCTGGCTGCGACTGAGGCTGCTACGCGGATG
+HWUSI-EAS1795_0092:3:1:19327:1189#0/1
bcea_dd]dfff[bee[dea\edaa`aecab`a
@HWUSI-EAS1795_0092:3:1:19568:1198#0/1
ATCGCAAGCACTGCACCTCGCCGACCTCCGCCG
+HWUSI-EAS1795_0092:3:1:19568:1198#0/1
\\\\[\T\^\YZcaacc]caccWZZYQcaTaaZ
@HWUSI-EAS1795_0092:3:1:2780:1208#0/1
CTGCACTCCAAACTTCCACCACTCGCACTTGCA
+HWUSI-EAS1795_0092:3:1:2780:1208#0/1
fffffffgggg]fcfffggggg]faffffdcf]
@HWUSI-EAS1795_0092:3:1:3086:1207#0/1
TGAGAATGTTGAGGATTTGACACTGGACGAGGA
+HWUSI-EAS1795_0092:3:1:3086:1207#0/1
hhhhhghghhgfhhgahhdhhghhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:3260:1210#0/1
TGCGTCTTTAATTTGAAGGCCACGGCCAGATCC
+HWUSI-EAS1795_0092:3:1:3260:1210#0/1
YYcccaadfaffff\ffffffaSffff_W\S`d
@HWUSI-EAS1795_0092:3:1:3543:1211#0/1
ATTCGGTCGAGGTGGAGGTGGACGTGGTGGCGG
+HWUSI-EAS1795_0092:3:1:3543:1211#0/1
hhhhhhhhhhhhhghh]ddhhhhdehcdhhfdc
@HWUSI-EAS1795_0092:3:1:4252:1207#0/1
GATCACTGAAGTTTTCTCGTGTTTTTCGCTATC
+HWUSI-EAS1795_0092:3:1:4252:1207#0/1
ggfffffffffcgggdgfgeagggggggggggg
@HWUSI-EAS1795_0092:3:1:4338:1201#0/1
GGGATTGCCAGGAGAAGCAGATGAAGATGATCG
+HWUSI-EAS1795_0092:3:1:4338:1201#0/1
hhhhhhhhhhhhhhhhhhhhghghhhghchggh
@HWUSI-EAS1795_0092:3:1:4449:1206#0/1
TGCGGGGTCTGAAGTTGTTGGGATCGCGACGGA
+HWUSI-EAS1795_0092:3:1:4449:1206#0/1
hgdhhhhhfechhhhhhfhhhhghhhhhghhga
@HWUSI-EAS1795_0092:3:1:4593:1204#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4593:1204#0/1
gggggggggfggfaaff]deddfggggcggegg
@HWUSI-EAS1795_0092:3:1:5119:1207#0/1
TTTTTGGAGAGTTCATATCGATAAAAAAGATTG
+HWUSI-EAS1795_0092:3:1:5119:1207#0/1
hhhhhhhhghhhhhhhghghdghhhhhhhehhh
@HWUSI-EAS1795_0092:3:1:5225:1203#0/1
AATTAACGGCGAGAAGGGTGAACAAGGTCTGCA
+HWUSI-EAS1795_0092:3:1:5225:1203#0/1
ghhhhhhhhhhfhfhahhdgfhhhghghhhggf
@HWUSI-EAS1795_0092:3:1:5309:1200#0/1
CGGTGACCTTGTGTGTAGGGTCGTTACGAATTG
+HWUSI-EAS1795_0092:3:1:5309:1200#0/1
cgffffefffffcfffcfffafffcfdfffcfg
@HWUSI-EAS1795_0092:3:1:6042:1208#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6042:1208#0/1
ghhhhhhhhhfcdghhhhhhhfhahdfggdhhg
@HWUSI-EAS1795_0092:3:1:6228:1205#0/1
AAGACCGAGATCCGCGAGAAGCTCGCCGCCATG
+HWUSI-EAS1795_0092:3:1:6228:1205#0/1
hhghhhhfhhhhhhhhhcfghhhhhhheecgeg
@HWUSI-EAS1795_0092:3:1:6354:1202#0/1
CTCACAGTCGTCACCGTCCTCCTCCTCCTCATC
+HWUSI-EAS1795_0092:3:1:6354:1202#0/1
_fdadd_fffacdddcaaa^ba^ddWdddaddd
@HWUSI-EAS1795_0092:3:1:7308:1201#0/1
TCTTGGACTCGGCGGCTGGAGCAGCGGCGGGGG
+HWUSI-EAS1795_0092:3:1:7308:1201#0/1
gcggg]gggfgggcgeWV^BBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:7768:1207#0/1
CGGCGTCTTGGTGAACTTGAGCCAGTCGGCTTC
+HWUSI-EAS1795_0092:3:1:7768:1207#0/1
ggdggggggcgggagfgggagggeggfefgggg
@HWUSI-EAS1795_0092:3:1:8417:1202#0/1
GACCTGGGATCGCTTCCAGATGAGAATCCACAA
+HWUSI-EAS1795_0092:3:1:8417:1202#0/1
gfgggggcf]fffffffgggffdfffcgdegge
@HWUSI-EAS1795_0092:3:1:8512:1202#0/1
ACGACGTGCTGACCAAGAAGCGCAGCGAAAAGG
+HWUSI-EAS1795_0092:3:1:8512:1202#0/1
gggggggedgggfcefcfffffggggggggggf
@HWUSI-EAS1795_0092:3:1:8708:1211#0/1
GCGCCATCATCAGCCAGAGCCAGACTTTGGCCG
+HWUSI-EAS1795_0092:3:1:8708:1211#0/1
hghfhhhhghhhhhhhghdghhdfhhhghghhe
@HWUSI-EAS1795_0092:3:1:8729:1203#0/1
GGTGCGGCGAATGAACTTGTACTTTTTGGACAG
+HWUSI-EAS1795_0092:3:1:8729:1203#0/1
ggggggggggfgggggggcggeggggggggggg
@HWUSI-EAS1795_0092:3:1:8769:1200#0/1
TGTGGTTCGGTCAAGTTTTTCGAATCATTGGTA
+HWUSI-EAS1795_0092:3:1:8769:1200#0/1
hhhhhhhhhghhhghhhhhhghhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:9222:1202#0/1
TGCACCTCATTCCGGTGCCCTTTCCCAGTGTAT
+HWUSI-EAS1795_0092:3:1:9222:1202#0/1
gfggggggffggggggggggagggggefdffde
@HWUSI-EAS1795_0092:3:1:9249:1206#0/1
TGGTGATCAAGGACCACGCGGATTGATTGGTGA
+HWUSI-EAS1795_0092:3:1:9249:1206#0/1
ggggggggggcgcgggcffffdfadfffffefc
@HWUSI-EAS1795_0092:3:1:9360:1211#0/1
CAGACTCAATATCGTTTCCCTCCACGATAAGTT
+HWUSI-EAS1795_0092:3:1:9360:1211#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:10053:1202#0/1
TGTAAATCCCAGGCACCTGAGTGTTACCACCCA
+HWUSI-EAS1795_0092:3:1:10053:1202#0/1
gggggggK_``_ggggggggfgggegggggggg
@HWUSI-EAS1795_0092:3:1:10256:1202#0/1
CATGCGCCGAAACTTAAGAAGTAAACTACAGAA
+HWUSI-EAS1795_0092:3:1:10256:1202#0/1
hghhhghfhhhhhghgffhedghhhegfhhhhh
@HWUSI-EAS1795_0092:3:1:11016:1205#0/1
GTCCACTTGCTTTTTTCTTCTGTAGAGGAGGAA
+HWUSI-EAS1795_0092:3:1:11016:1205#0/1
hhhhhhhhfhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:11080:1207#0/1
CCTCCTTCTTGTTGATCTTGGAGCCAGGACGAT
+HWUSI-EAS1795_0092:3:1:11080:1207#0/1
cfacaJda^aP^`]^Z][\^\S]ac^Zaffff[
@HWUSI-EAS1795_0092:3:1:11447:1202#0/1
ATTGTCGACGTCATTGACCAAAACAGAGTTCTG
+HWUSI-EAS1795_0092:3:1:11447:1202#0/1
hhhhhhhhhhhhhhhfhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:11722:1211#0/1
TTTCTTGTGGGGATCGGGAGGTGTGCGCAAGCA
+HWUSI-EAS1795_0092:3:1:11722:1211#0/1
hhhhhhfhhhhhhhhhhhghh`hhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:12003:1203#0/1
GGCGGTTCGGTGACTCCTTGTTCAGTTTGAGGA
+HWUSI-EAS1795_0092:3:1:12003:1203#0/1
fffffcffff]aa^Z^addR^af`f`fdaW`d^
@HWUSI-EAS1795_0092:3:1:12081:1210#0/1
TTTCGAAATGGTTACACCGCTTTTGTCAAATTC
+HWUSI-EAS1795_0092:3:1:12081:1210#0/1
hhhhhhhhehhghhhhhhehhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13288:1211#0/1
TCGGAGGTGACACAGTTGATGGGGAAATGGGCG
+HWUSI-EAS1795_0092:3:1:13288:1211#0/1
afffffcegggff_f[ada]fdBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13647:1209#0/1
GGAACACATCGATCTGGGCATCAAGTACGATCC
+HWUSI-EAS1795_0092:3:1:13647:1209#0/1
hhhhhhhhhhghhhhhhhhghhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:13834:1202#0/1
GGCAGGTGACCACGGCCCAGCAGCTTGTAGTAG
+HWUSI-EAS1795_0092:3:1:13834:1202#0/1
gggggggeggggggggggfcfgggggggggage
@HWUSI-EAS1795_0092:3:1:14132:1200#0/1
GGTTGTTGAACTTCATCGACTAAAACGACTTCC
+HWUSI-EAS1795_0092:3:1:14132:1200#0/1
_WTU\T_SMTOSaM[\[VX]VYa_][a]ccca[
@HWUSI-EAS1795_0092:3:1:14407:1203#0/1
CGCATGGTGAAGGCCAGTGGCCAGAGACCCGGA
+HWUSI-EAS1795_0092:3:1:14407:1203#0/1
fcdbdc`Y^ca^Z]``TaWWa^]Y^YZaa^WWa
@HWUSI-EAS1795_0092:3:1:14777:1203#0/1
CCTTGCCGAGAGCGGCCAGACGACCCTTGCCGC
+HWUSI-EAS1795_0092:3:1:14777:1203#0/1
ee\faffgg]ggfcgggg_ggggcgg_ggggg_
@HWUSI-EAS1795_0092:3:1:15137:1201#0/1
GCAGCATGTCGTCCTTGACTTTTAATGGGCTTT
+HWUSI-EAS1795_0092:3:1:15137:1201#0/1
hgfhhhhhhhhhhhhgfhhhhhhhfghhhhhhh
@HWUSI-EAS1795_0092:3:1:16249:1211#0/1
ATTGATTATTTCTATTTTTGCTGAGTGAGTTGT
+HWUSI-EAS1795_0092:3:1:16249:1211#0/1
hhhghhhhhhhghhhhhhhgghhfhhhhghhfh
@HWUSI-EAS1795_0092:3:1:17395:1209#0/1
CTCTGAGCTCAGTGTAGATTATGGATATCTGAC
+HWUSI-EAS1795_0092:3:1:17395:1209#0/1
hhghghhhhhhhhhhghhhhhhhhhehhghhhf
@HWUSI-EAS1795_0092:3:1:18416:1205#0/1
CAGCTTAGCATTACTTTGTTTATAGAAAAGAAT
+HWUSI-EAS1795_0092:3:1:18416:1205#0/1
ffdcd^[dad]^Z^[Za_^\\\acfffdccccc
@HWUSI-EAS1795_0092:3:1:18653:1201#0/1
CCGTGGTCTGGAAGCGAATGAAATGCAAGGAGC
+HWUSI-EAS1795_0092:3:1:18653:1201#0/1
egggffcgfgggegfgggggggggggg_fc`cd
@HWUSI-EAS1795_0092:3:1:18879:1209#0/1
GAGAGATTAAAGACTAAGCCTCAGATATCCTAT
+HWUSI-EAS1795_0092:3:1:18879:1209#0/1
ggffggggggg]fffffcfffffacffgggRff
@HWUSI-EAS1795_0092:3:1:19790:1210#0/1
TGAAAATCAAAAAATAAAAAAACCCAAAGCCAA
+HWUSI-EAS1795_0092:3:1:19790:1210#0/1
ggfgdgggggggggfggggggfggfggffggeg
@HWUSI-EAS1795_0092:3:1:1719:1214#0/1
ATCACAGTCTTCAGCAGAGCTTTGCCATCTTTG
+HWUSI-EAS1795_0092:3:1:1719:1214#0/1
W[\IZZMXZSX]]`V^LTU\YXZPXR_^[\W[^
@HWUSI-EAS1795_0092:3:1:2216:1222#0/1
GGAACCAGACTGTCAAAATGGTGGCCATCCAAT
+HWUSI-EAS1795_0092:3:1:2216:1222#0/1
hghhhhhfhhhhhhhffhgfhhhfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:2722:1222#0/1
GTGCGCTGGAACTTCTGGGTGCGGCGGGGGGGG
+HWUSI-EAS1795_0092:3:1:2722:1222#0/1
ffffffffafRaffffaffffffffffBBBBBB
@HWUSI-EAS1795_0092:3:1:2837:1215#0/1
CTTGCTTGGCCACTGCAATCTTAAGTGGAGGCA
+HWUSI-EAS1795_0092:3:1:2837:1215#0/1
hhhhhch_hhhfhffhhhghghhhahfcfacaf
@HWUSI-EAS1795_0092:3:1:2955:1223#0/1
TGCGTGGATGCATCGTGGACGCCAACATGTCCG
+HWUSI-EAS1795_0092:3:1:2955:1223#0/1
ggfggfgfcggegfggceff_fafca]f_fdff
@HWUSI-EAS1795_0092:3:1:3318:1220#0/1
AGGGGGCCGGCATTGGCGCCAACTTCGCCAAGA
+HWUSI-EAS1795_0092:3:1:3318:1220#0/1
afffJfdfffffggggcgeegggegggffYWdc
@HWUSI-EAS1795_0092:3:1:3953:1220#0/1
GTGACCCAGGATGTTCATACGGCAGGTGAAGAG
+HWUSI-EAS1795_0092:3:1:3953:1220#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhbbbdRbX
@HWUSI-EAS1795_0092:3:1:4101:1214#0/1
CCTGGGCCTCATCACGCGGGCGATGGCCAGAAT
+HWUSI-EAS1795_0092:3:1:4101:1214#0/1
caQffcfhhhhhhhhehcehhgdadafdfefef
@HWUSI-EAS1795_0092:3:1:4567:1216#0/1
GCGGGTAGGAGAACAAAGTAATCAAGCATCACA
+HWUSI-EAS1795_0092:3:1:4567:1216#0/1
hdhhhghhhfghhghhhhchhfhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:4765:1213#0/1
CGGCCTCCATCTTCTTCATCTTCTGCTCGTGCT
+HWUSI-EAS1795_0092:3:1:4765:1213#0/1
hhhhhhhhhhhhhfhhgghhhhghhhhdfhhgh
@HWUSI-EAS1795_0092:3:1:6652:1219#0/1
ATTTTGGTATCATTCAATTGATGAATTTAGTTG
+HWUSI-EAS1795_0092:3:1:6652:1219#0/1
\SVWRXSNWGYLSNPXLPUVMOaOa][a[[[[^
@HWUSI-EAS1795_0092:3:1:6750:1222#0/1
CTTCGACATGTCCACCAAAGCCGAGCTCGCCTG
+HWUSI-EAS1795_0092:3:1:6750:1222#0/1
cggggg_fffdfdggfeggggadfffdggggag
@HWUSI-EAS1795_0092:3:1:6960:1216#0/1
GGTCATTGCCCACGATGTTGATCCTCTGGAGCT
+HWUSI-EAS1795_0092:3:1:6960:1216#0/1
hhhhhghhhhhhhhhhghhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7254:1212#0/1
GAAGCTGACGGTCAAGGCGCGCGAGAACATCGC
+HWUSI-EAS1795_0092:3:1:7254:1212#0/1
hhhghhhghhhghhheefcfffhhhhhgdghgg
@HWUSI-EAS1795_0092:3:1:7353:1223#0/1
GCCACTTTCATCATCCAGAAGATCCTGCTCGAT
+HWUSI-EAS1795_0092:3:1:7353:1223#0/1
hhhhhhhhhhhhhgghghhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:7597:1219#0/1
ATGCTGGCCGCTTCCGTGGATCAGCTAAAGAAC
+HWUSI-EAS1795_0092:3:1:7597:1219#0/1
hhhhhfhhhfehhhhhhhhhhhghhhhdcafcX
@HWUSI-EAS1795_0092:3:1:7788:1217#0/1
CCTGTTTGCCAGTGAATCCCTGGCAGATCACCC
+HWUSI-EAS1795_0092:3:1:7788:1217#0/1
gcgfgggdgggggcgggfffffggggaggcggg
@HWUSI-EAS1795_0092:3:1:8559:1219#0/1
GGTGGAACTACGTGAGGTTGGCTTGTTTTGCAT
+HWUSI-EAS1795_0092:3:1:8559:1219#0/1
hfehhghhhhghghghhehhgchgcfgehhghf
@HWUSI-EAS1795_0092:3:1:9165:1221#0/1
TAAGCAAGGACAAAGCGCATCGAAGCATTGATT
+HWUSI-EAS1795_0092:3:1:9165:1221#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9261:1221#0/1
CCGTCCTTCTTGGCCAGACGCACGATGCAGTCG
+HWUSI-EAS1795_0092:3:1:9261:1221#0/1
hhhhhhhhhfhhchhhghhhhhhhfaghhhhhg
@HWUSI-EAS1795_0092:3:1:10074:1217#0/1
TGACCATCTTATAAATGATGAGTCGCTGTATAC
+HWUSI-EAS1795_0092:3:1:10074:1217#0/1
gggfggggfgggfgggfgggg_efffdggfggg
@HWUSI-EAS1795_0092:3:1:10144:1220#0/1
CGTCTACATTGTGATGCACCAGAAGCAGAAGGA
+HWUSI-EAS1795_0092:3:1:10144:1220#0/1
hhhhhgdhghhhhhhhfhhfhchhh_gffafdg
@HWUSI-EAS1795_0092:3:1:10262:1219#0/1
CGTCGGAGATGTCCAGTTTGTGGGCGTCGAAGA
+HWUSI-EAS1795_0092:3:1:10262:1219#0/1
gggfggeggcgggggggggegggggeggggdaf
@HWUSI-EAS1795_0092:3:1:10529:1212#0/1
CGCGGACCAGGTTCTCCTTCTTGCGCAGGGCAA
+HWUSI-EAS1795_0092:3:1:10529:1212#0/1
hhhhhhhhhhhhhhhhhhhhghghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:10663:1217#0/1
GGGTGATCTTCTCCAGCAAGTAGGGATAGAGGG
+HWUSI-EAS1795_0092:3:1:10663:1217#0/1
hhhghghhhhhhhhhhhhhgfhhhhhhhhdhgg
@HWUSI-EAS1795_0092:3:1:10789:1217#0/1
ACAAGGATGGGTTACTCGTGCAACTGGTTTCGG
+HWUSI-EAS1795_0092:3:1:10789:1217#0/1
a\ffd^feffffdfcffdfafafffffffcddf
@HWUSI-EAS1795_0092:3:1:12541:1219#0/1
CTCGTCTGCATTTAGCATTCGTATCCGTCGAAA
+HWUSI-EAS1795_0092:3:1:12541:1219#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhgh
@HWUSI-EAS1795_0092:3:1:12949:1214#0/1
GCCGCATGAGCGATGACATTATCTTGAGGACCC
+HWUSI-EAS1795_0092:3:1:12949:1214#0/1
hhhhhhhhhhhhhhghfghhhhhhgfhhfhhhh
@HWUSI-EAS1795_0092:3:1:13416:1222#0/1
CTTGCGGTTGGCGTCGCGCGGAGACAGGGCCTT
+HWUSI-EAS1795_0092:3:1:13416:1222#0/1
hhhhhghhhhhhhdhchffffdgghhgheheba
@HWUSI-EAS1795_0092:3:1:13628:1223#0/1
AGGGACTTCTTCGCCTACTCAGGCGGTGTGTAC
+HWUSI-EAS1795_0092:3:1:13628:1223#0/1
cgggfggggcfgaggdggggc[Yaaa]^Z^]_d
@HWUSI-EAS1795_0092:3:1:14070:1214#0/1
GCGCCTTCTCATAGGGGCGACGGGGAGTCACGT
+HWUSI-EAS1795_0092:3:1:14070:1214#0/1
a]ada[dd[^^]^W^^^dXZa^^a^]ZV^]]^c
@HWUSI-EAS1795_0092:3:1:14419:1216#0/1
AAACTATACATATGAATTACGTTTACCTAACCA
+HWUSI-EAS1795_0092:3:1:14419:1216#0/1
hhhhhhhhhhhhhgfhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:14971:1217#0/1
CATTCGCACGCGGAGAAGCAGGAGGCAAGGTAT
+HWUSI-EAS1795_0092:3:1:14971:1217#0/1
gggggggggggfgggdgefcffgggcg```W``
@HWUSI-EAS1795_0092:3:1:15228:1212#0/1
GGGACAATGGGTCAGTCTGAAGCGCCAGCCGGA
+HWUSI-EAS1795_0092:3:1:15228:1212#0/1
hhfhghhhhhghhhhhhhhhhfhhhhhhhghgg
@HWUSI-EAS1795_0092:3:1:15249:1218#0/1
CTGGGTTGTTTAGTTGCGCGATCCGCGTCCGAA
+HWUSI-EAS1795_0092:3:1:15249:1218#0/1
gggggagggggggggggggggaffffdaffdfg
@HWUSI-EAS1795_0092:3:1:15472:1223#0/1
GCGCAATCGCGTTCCGACCAAGACCACTGTAGA
+HWUSI-EAS1795_0092:3:1:15472:1223#0/1
hhhhhhhhhhhhhhhhfgfhhdhhgghhhghgh
@HWUSI-EAS1795_0092:3:1:15544:1212#0/1
CCGTAAATTGCCTTATTCAATTTACACACATTG
+HWUSI-EAS1795_0092:3:1:15544:1212#0/1
hfhhfhhhhhhhhhhhhhhhhghhhhhhhhhhd
@HWUSI-EAS1795_0092:3:1:16845:1216#0/1
CTGTGATCCACGCTTATTGCTCCTCATGGGATT
+HWUSI-EAS1795_0092:3:1:16845:1216#0/1
hfghhhhfehfhhhhhhhhhdhghhhgghhahg
@HWUSI-EAS1795_0092:3:1:16903:1221#0/1
TCTTGCGCAGGACAGGTGTTGGTGTTATACTAC
+HWUSI-EAS1795_0092:3:1:16903:1221#0/1
ghhhhhhhhhdfhghhhhhhhhgghgghhghhh
@HWUSI-EAS1795_0092:3:1:17541:1217#0/1
CTCGGTCAGGATCTTCATCAGGTAGTCGGTCAA
+HWUSI-EAS1795_0092:3:1:17541:1217#0/1
hhhfgchghghehhhhhhhghhggdhhgfghgh
@HWUSI-EAS1795_0092:3:1:17636:1217#0/1
GGCAGCCCAATCGCCTCTTCAATTGGAGCTTAG
+HWUSI-EAS1795_0092:3:1:17636:1217#0/1
ghhhhghhhhhhchhhhhhhfgghhhdfggghh
@HWUSI-EAS1795_0092:3:1:17979:1219#0/1
CGATGACAGTCTCTGGCTGTCCACCGCCGAACC
+HWUSI-EAS1795_0092:3:1:17979:1219#0/1
hghghhhghghhhcfhhhhhghhhhghhehhfh
@HWUSI-EAS1795_0092:3:1:18437:1223#0/1
CTGCTTTAGTCGCTCGATTTCGCTCTGGAGCCA
+HWUSI-EAS1795_0092:3:1:18437:1223#0/1
hhhhhhhhhhhhhhfgdhhhhcfffaaWd^eea
@HWUSI-EAS1795_0092:3:1:18504:1214#0/1
CTGGGACACTATGAAGGACAAACTAAGTTTTGC
+HWUSI-EAS1795_0092:3:1:18504:1214#0/1
ggggggegggfcge_g_gcfggfgggcgffgag
@HWUSI-EAS1795_0092:3:1:18998:1221#0/1
GGGGGAGCTGCTGCGCCTGCGTCGCTTGTGCCG
+HWUSI-EAS1795_0092:3:1:18998:1221#0/1
gggdfggfcff[ffdfcO`^bVaa```^Qaa^d
@HWUSI-EAS1795_0092:3:1:19202:1219#0/1
CCGCGATTGTGCTTGTTGCGTCCTCCGTTACGG
+HWUSI-EAS1795_0092:3:1:19202:1219#0/1
f^fffffffa[[XQVTVfffc_UU[XT[ada^[
@HWUSI-EAS1795_0092:3:1:19509:1218#0/1
GCGAGGGATACCTGTGAGCAGCTTTCACTCCTA
+HWUSI-EAS1795_0092:3:1:19509:1218#0/1
dYaa^\^dddddHURQV^a`]bcf[ffcffccf
@HWUSI-EAS1795_0092:3:1:1374:1230#0/1
CGGAAAAACTGCAGCAAAACTCCACAAGCCGAA
+HWUSI-EAS1795_0092:3:1:1374:1230#0/1
d[Waaa]]cdfSf]fffefaddaf_fffccfaf
@HWUSI-EAS1795_0092:3:1:1508:1225#0/1
TAAATATTTTCTGAATGAGAGTAAGAAAAGAAA
+HWUSI-EAS1795_0092:3:1:1508:1225#0/1
fegggfdggggggaggc[adeafcfffgg`gcg
@HWUSI-EAS1795_0092:3:1:3055:1223#0/1
GAGAAGCGTATGGGACAGGTTGTGGAGGCCGAT
+HWUSI-EAS1795_0092:3:1:3055:1223#0/1
gggggggggggcggffgggeffcafccdggdga
@HWUSI-EAS1795_0092:3:1:4201:1235#0/1
GAAAACTTTCCGCTGGACGTGTAAGCACACTCG
+HWUSI-EAS1795_0092:3:1:4201:1235#0/1
_QXNY_aTU\S\T]^]Zccf[caK^K^a[aWaW
@HWUSI-EAS1795_0092:3:1:4297:1229#0/1
CCGAGGAGCACCCCGTGCTGCTGACCGAGGCCC
+HWUSI-EAS1795_0092:3:1:4297:1229#0/1
cccccY_aaccac__T]c]]^^caccccccc_B
@HWUSI-EAS1795_0092:3:1:4412:1230#0/1
GGAGTCCACCAGGGTGAACAATGTTTTCACTAT
+HWUSI-EAS1795_0092:3:1:4412:1230#0/1
gghghhhhhhhgghchhffhfa\ffff`gfhhh
@HWUSI-EAS1795_0092:3:1:4790:1231#0/1
CGCAGGTGTTGCAGCTCCTCGTCGGTGGGGGAG
+HWUSI-EAS1795_0092:3:1:4790:1231#0/1
ggeadfbaeeeedfgaffcfffT_]T__BBBBB
@HWUSI-EAS1795_0092:3:1:5103:1228#0/1
GAAAAACCAAGACTCCGACGACGAGGATGTAGA
+HWUSI-EAS1795_0092:3:1:5103:1228#0/1
f^dcdad^cdddfaadf\c_aR\Z\^^cfffc[
@HWUSI-EAS1795_0092:3:1:5412:1226#0/1
GTGACCTTGACAACCTTGAAGCGCACACCGGGA
+HWUSI-EAS1795_0092:3:1:5412:1226#0/1
c[ffdffcaffafcfffffaf[c[dddfWffff
@HWUSI-EAS1795_0092:3:1:5446:1230#0/1
AATACTTCAGGAAAATTGGAAAATGCACCCCAT
+HWUSI-EAS1795_0092:3:1:5446:1230#0/1
fdfgggggaggggggfgeecdS___^aggg`fa
@HWUSI-EAS1795_0092:3:1:5820:1224#0/1
TGCTCACATTGTCTTCGACTTTGCTATTTGGTC
+HWUSI-EAS1795_0092:3:1:5820:1224#0/1
aa\]aaafffffafffffffff[fffadd]^^f
@HWUSI-EAS1795_0092:3:1:6344:1227#0/1
CCCGTTCCTGTTGATGTCGATGAACCAGCGGCA
+HWUSI-EAS1795_0092:3:1:6344:1227#0/1
ffccffff_^dfdaddd^^ZaX_\aZ\addac[
@HWUSI-EAS1795_0092:3:1:6432:1232#0/1
AAACAATCGTCCTGGCAATCCTGACAACTGTCA
+HWUSI-EAS1795_0092:3:1:6432:1232#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6459:1229#0/1
GAGTGCAAGCCCGAGGCGGTGACCAGCAAGACA
+HWUSI-EAS1795_0092:3:1:6459:1229#0/1
ffc]ffffffcffcaffcf_c[^bb^^ccb]_Z
@HWUSI-EAS1795_0092:3:1:7180:1228#0/1
GTGCGTCCGATCCCGTTCTGCTGCGCAAAGTGG
+HWUSI-EAS1795_0092:3:1:7180:1228#0/1
ggggggggggggggggcfd[dfefcgfggecgd
@HWUSI-EAS1795_0092:3:1:7539:1233#0/1
GGAATATCGCGAGGGTCGCGATTGGATCGAGCG
+HWUSI-EAS1795_0092:3:1:7539:1233#0/1
gdgggggggfgafggeg_cfcfgcfegggeggg
@HWUSI-EAS1795_0092:3:1:8575:1233#0/1
ATCGGCGTCTTATATTGATCATACCTTCCGTAC
+HWUSI-EAS1795_0092:3:1:8575:1233#0/1
gfggggcgfecggfcgffdffaggggggggcgg
@HWUSI-EAS1795_0092:3:1:8896:1226#0/1
GACTTTTCCCATGGCATCGGAATCTACGAGCGG
+HWUSI-EAS1795_0092:3:1:8896:1226#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:10754:1235#0/1
GGAAGAAGCCGTCCACCTTGAAGAAGGGCTACA
+HWUSI-EAS1795_0092:3:1:10754:1235#0/1
[_\abba]aa\]__\]\f^_\Yaa^b]cfc[ff
@HWUSI-EAS1795_0092:3:1:11028:1230#0/1
TCGGGAACTCTGTTTGTATTATTTTCCTACTGT
+HWUSI-EAS1795_0092:3:1:11028:1230#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11321:1231#0/1
CTGCTGTTGACCGCTGGGCGCCGTTTGTCTATC
+HWUSI-EAS1795_0092:3:1:11321:1231#0/1
hhghhhhhhhhhhhghhhhhfhcghhghhhhfg
@HWUSI-EAS1795_0092:3:1:11860:1233#0/1
GGAGTTTAAAACTTTCAATTTGCCAAACGTCAA
+HWUSI-EAS1795_0092:3:1:11860:1233#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:11914:1224#0/1
CTTTGCAAAAAGGACTATTCCAGCATGTTCGGG
+HWUSI-EAS1795_0092:3:1:11914:1224#0/1
hhhhhhhhhhhhhhhfhhhhghhfhhehhhffh
@HWUSI-EAS1795_0092:3:1:11935:1234#0/1
CGTTTTGCGCGTCTGCTTTTCCATCCTCGCCTG
+HWUSI-EAS1795_0092:3:1:11935:1234#0/1
hhhhhhhhhffhhhhfghhhhhchhhfghhhhh
@HWUSI-EAS1795_0092:3:1:12011:1230#0/1
TTCTTGGATGTTGGACTCGCTCGTACTACAACT
+HWUSI-EAS1795_0092:3:1:12011:1230#0/1
hhhghhhhhhhhhhfhhhdhfhhhhehghghhh
@HWUSI-EAS1795_0092:3:1:12050:1233#0/1
GGGAAATGGGCGTACACAGCACGCATCTTGTAC
+HWUSI-EAS1795_0092:3:1:12050:1233#0/1
hhffaffddfffhhhhhhfhhhhhfhhhhhghf
@HWUSI-EAS1795_0092:3:1:12169:1234#0/1
TCACTGTGTAGCAGAAGGCAATTGGCACATCGA
+HWUSI-EAS1795_0092:3:1:12169:1234#0/1
gggggggdffafffdffddcf_`ccf`fdbddd
@HWUSI-EAS1795_0092:3:1:12442:1232#0/1
CGGCCTCGAAAGTGTTCACTTAGGCATCGGCGT
+HWUSI-EAS1795_0092:3:1:12442:1232#0/1
hhhhhhhhhhhgghhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:12655:1234#0/1
GTGCCTTCAAGGTGCCCGAGCACCTGAACGACG
+HWUSI-EAS1795_0092:3:1:12655:1234#0/1
hhghhhhhhhhhdhhhhhhhhhhhhghhhhhgg
@HWUSI-EAS1795_0092:3:1:13066:1228#0/1
TGGAATGAATGGTTGGACGAAATATTAACTGTT
+HWUSI-EAS1795_0092:3:1:13066:1228#0/1
hhhhhhhfhfhhhhhhhhhghhchhghhfhhhh
@HWUSI-EAS1795_0092:3:1:13129:1228#0/1
TACACGTCCACCTCTCGAGGATTACAGCACAAA
+HWUSI-EAS1795_0092:3:1:13129:1228#0/1
hhhhhhhhhhhhghhhghhhghhhghhhhghhh
@HWUSI-EAS1795_0092:3:1:13770:1234#0/1
AGATCATCAAGGGCGCCTTCGGCACCCGTGCCC
+HWUSI-EAS1795_0092:3:1:13770:1234#0/1
hhhhhhhhhhehehhhhhhhgghhhhggdbhhg
@HWUSI-EAS1795_0092:3:1:14016:1228#0/1
GTTTGGCGTAAGCCTGCATGGAGCTGCCATTGG
+HWUSI-EAS1795_0092:3:1:14016:1228#0/1
hhhhhhhhhhhhhhhhhhhhdhghhhhhehghg
@HWUSI-EAS1795_0092:3:1:14645:1232#0/1
CTCCCAAGAAAATCAAGCACAAGAGGAAGAAGG
+HWUSI-EAS1795_0092:3:1:14645:1232#0/1
hchhghhhhhghhhhhghhfhhhhfhhhggWhg
@HWUSI-EAS1795_0092:3:1:15408:1224#0/1
GTGTGTTTGTGTGTGTGTTTATGCTGTTGTTGT
+HWUSI-EAS1795_0092:3:1:15408:1224#0/1
fef_faffccfcf]fcfffcc_fdcaffffcff
@HWUSI-EAS1795_0092:3:1:15526:1232#0/1
CGTTGACTTCTCCTCGGAGGTGACCGCCGCCCT
+HWUSI-EAS1795_0092:3:1:15526:1232#0/1
hhhhghhhhhhhhghhhhfhdhhhhhhgghheh
@HWUSI-EAS1795_0092:3:1:15685:1227#0/1
GTTGCTGTTTATGTTTCGCTATTGCGCAGCGAC
+HWUSI-EAS1795_0092:3:1:15685:1227#0/1
gggggggggggggggfgggfgcggggggggggg
@HWUSI-EAS1795_0092:3:1:15853:1231#0/1
GCCTGATCGTCCGAGCCGGAACCGTCATCATTA
+HWUSI-EAS1795_0092:3:1:15853:1231#0/1
gefgggggfgggfaffffgggggegcgfgdffg
@HWUSI-EAS1795_0092:3:1:15892:1235#0/1
GCTGTTTCACTTTCCCTACTCTCAAGGAGATCG
+HWUSI-EAS1795_0092:3:1:15892:1235#0/1
gfggggggggggggggfggd]ggggggf]cggg
@HWUSI-EAS1795_0092:3:1:16461:1234#0/1
TGTTCATCGACTTGCTGGCCGACTGCTGTGGCA
+HWUSI-EAS1795_0092:3:1:16461:1234#0/1
gdgggggggfggfffcfffffefddfe`_]bdc
@HWUSI-EAS1795_0092:3:1:16624:1226#0/1
AAGGAAAATGAGAGCTAAGTGGCGTAAGAAGCG
+HWUSI-EAS1795_0092:3:1:16624:1226#0/1
ccccLYccScccccccccaacc\aa^accaccc
@HWUSI-EAS1795_0092:3:1:16970:1229#0/1
TGTCGCCTTCCTAGTTGTTCTTGTAGTTCTTTA
+HWUSI-EAS1795_0092:3:1:16970:1229#0/1
]bcccc^UZUPU`ZZ_W]\U_\QQQSTaa^\[W
@HWUSI-EAS1795_0092:3:1:17401:1226#0/1
CCGGACTGGATGTGGAGCGTGGGGCGCTGAGAT
+HWUSI-EAS1795_0092:3:1:17401:1226#0/1
]QPTQRSWVNQ\]a]aaR]\Va`BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:17736:1224#0/1
CGGCAGACTTTTCAAAGGCCTCGTGCTTCTTAA
+HWUSI-EAS1795_0092:3:1:17736:1224#0/1
_ffcfdfgaggcfcff_gaggdfff[ffffffc
@HWUSI-EAS1795_0092:3:1:17881:1232#0/1
GGTCAACAAAGACTTCCCCGGCGATGTGGGCGT
+HWUSI-EAS1795_0092:3:1:17881:1232#0/1
ccaffffddZ`dWRac^daa[[dd_]^ddWWdR
@HWUSI-EAS1795_0092:3:1:17993:1232#0/1
TCCGCTTGTAGTAGATATTTGGTGGTTTCTTGT
+HWUSI-EAS1795_0092:3:1:17993:1232#0/1
hhhhhhhhhhhhhhhhghhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19076:1224#0/1
GTGATCTTCACAGCACCCGTACCGAAAGCCATG
+HWUSI-EAS1795_0092:3:1:19076:1224#0/1
ggg_agagfgggggegggfggagcggWadafag
@HWUSI-EAS1795_0092:3:1:19661:1226#0/1
GCCATTGTGACCCATCAGAACGGTGACCTCGTT
+HWUSI-EAS1795_0092:3:1:19661:1226#0/1
hhhhhhehgghhhghhhchhghhghhhfffcfh
@HWUSI-EAS1795_0092:3:1:19736:1232#0/1
GCGGCATCGGGAGCCTTGGCCATATTTGCGGGG
+HWUSI-EAS1795_0092:3:1:19736:1232#0/1
ggggggdggfggggfcggeggg[deddeeggge
@HWUSI-EAS1795_0092:3:1:1530:1243#0/1
GCAAGATGAAACAGAACCCGTTCGTGTAGTCGT
+HWUSI-EAS1795_0092:3:1:1530:1243#0/1
aKacccccXXZcRSYVM]]^]^BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2292:1239#0/1
GGGACAACCAACTCCAGTGGAAGGCGGCAGCTG
+HWUSI-EAS1795_0092:3:1:2292:1239#0/1
dhhfhhhhhehghhhdhahhffee]ecWddbbf
@HWUSI-EAS1795_0092:3:1:2736:1246#0/1
CTCCAGTGTAATCTCATGGTCATTCCGTAGTCG
+HWUSI-EAS1795_0092:3:1:2736:1246#0/1
gfgggggfcfffgggegggggggfgggefddff
@HWUSI-EAS1795_0092:3:1:2828:1239#0/1
CTAAAGTAACTTAATTTTTTAATCATTATTAAT
+HWUSI-EAS1795_0092:3:1:2828:1239#0/1
hhffffchhhghhhhghhhghhhhhhhghch_h
@HWUSI-EAS1795_0092:3:1:4127:1235#0/1
CAGATTTCTACACTCACACAAAACAAAAAACCC
+HWUSI-EAS1795_0092:3:1:4127:1235#0/1
[ccfdfdfff_cdffffffSfBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4180:1247#0/1
CGGCGATGCGCAGCTGGTAGCCCTTCCACTCGT
+HWUSI-EAS1795_0092:3:1:4180:1247#0/1
ffhfhfcghhhhhhhcgfhhhghhhhhhhehde
@HWUSI-EAS1795_0092:3:1:4360:1238#0/1
CCAGCACGCTCTGCACCTGCTGTACGCCCGTAA
+HWUSI-EAS1795_0092:3:1:4360:1238#0/1
aggcfgeffdfff_ffffdffWeffff`^NWS^
@HWUSI-EAS1795_0092:3:1:4485:1235#0/1
GCAAGGTCAAGAAGACCCAGCGGGGAGCCAAGG
+HWUSI-EAS1795_0092:3:1:4485:1235#0/1
[_VSTQSYY]ZYTMTQVRQPSFN_OU[MQTT^S
@HWUSI-EAS1795_0092:3:1:4719:1245#0/1
AATGGCTCTCCCAGCGAGCCTGAAATTGGCTGA
+HWUSI-EAS1795_0092:3:1:4719:1245#0/1
hhghhhhhhhhhhhhhhhghghghhhhhfhhgh
@HWUSI-EAS1795_0092:3:1:4762:1242#0/1
GTACTATTACTTTGAACAAATTAGAGTGCTTAA
+HWUSI-EAS1795_0092:3:1:4762:1242#0/1
hhhhhhhhhhhhgghhhhhghhghhhhheghhh
@HWUSI-EAS1795_0092:3:1:4900:1239#0/1
CTTGCCGCAGCGATCGACTATCCAGTCATGCCT
+HWUSI-EAS1795_0092:3:1:4900:1239#0/1
hhhhhhhghhhhghhhhhhgfhhghghhghhfh
@HWUSI-EAS1795_0092:3:1:5341:1244#0/1
GTCGCTCACCGCCGTTCTTGGGTCCTCCGATCT
+HWUSI-EAS1795_0092:3:1:5341:1244#0/1
afaggggggfgWdfffdcf]ff_ggagdfaadd
@HWUSI-EAS1795_0092:3:1:5581:1236#0/1
GTTCAGAATAATCATTCCCTTGTTAGAGGACTC
+HWUSI-EAS1795_0092:3:1:5581:1236#0/1
hhhhhhfhhhhhhhhhhhhhhhhhehhhhhhgd
@HWUSI-EAS1795_0092:3:1:6390:1242#0/1
GGGACTTCAGGTGGTCTGCCACAACGTTTGTCA
+HWUSI-EAS1795_0092:3:1:6390:1242#0/1
hhhhhhhhhhgfdhhghhhhghfhhdhhhghhh
@HWUSI-EAS1795_0092:3:1:6479:1239#0/1
AACAGCCACAGTTTCGAAAGAGTGCCGAACGGC
+HWUSI-EAS1795_0092:3:1:6479:1239#0/1
hhhhhhhhhhhhhhhhghhfhcghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6759:1241#0/1
GTTTTCTTGGCCGTCAATTACGTTGCTTAGTCG
+HWUSI-EAS1795_0092:3:1:6759:1241#0/1
ggggggggcggfgdgggdcfffgagafggcgeg
@HWUSI-EAS1795_0092:3:1:7930:1245#0/1
GCAAGGTTCGCAGAACCGAGCCCAAATCCCAGG
+HWUSI-EAS1795_0092:3:1:7930:1245#0/1
hhhhhhhhhhghhhhhhfhhghhhhgghfgghh
@HWUSI-EAS1795_0092:3:1:8189:1242#0/1
CACAGTTGTTGAGTCTTGTTTATATATATTATC
+HWUSI-EAS1795_0092:3:1:8189:1242#0/1
hhhhhhhghhgfhhhhhghhheggghhhhhhhh
@HWUSI-EAS1795_0092:3:1:8415:1239#0/1
ACCGAAAAGTATGCCTGCGAGAGCTATTTCGAC
+HWUSI-EAS1795_0092:3:1:8415:1239#0/1
gggggggggggfggggggggdgggfgggggggg
@HWUSI-EAS1795_0092:3:1:9055:1245#0/1
CACAGCGGCAGGCAGCGGGATCGGAGGCGCGGT
+HWUSI-EAS1795_0092:3:1:9055:1245#0/1
gggggggggggggfggfdgcgggggegbd^cdB
@HWUSI-EAS1795_0092:3:1:9129:1238#0/1
GCGGCCTATCTCTACGCGGTGCCACTATGTACT
+HWUSI-EAS1795_0092:3:1:9129:1238#0/1
fcfdf]fad_aaadcadVZT_`caaca[YTWYX
@HWUSI-EAS1795_0092:3:1:9835:1240#0/1
GTTCTGGACTCCGGCGATGGTGTCTCCCACACC
+HWUSI-EAS1795_0092:3:1:9835:1240#0/1
fgfgfcaff[ffffffc`deRc``]abcffffg
@HWUSI-EAS1795_0092:3:1:10209:1238#0/1
GCGGAAATTTACGTCAATTTGGAGCAGAAAGTA
+HWUSI-EAS1795_0092:3:1:10209:1238#0/1
gggggggggggdfdfffgggaggeggeffffbf
@HWUSI-EAS1795_0092:3:1:10840:1241#0/1
ATTCGTTGTTTCCCAGCCGGGCAAGACTCTTCT
+HWUSI-EAS1795_0092:3:1:10840:1241#0/1
hhhhhhhghhhhhhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10865:1244#0/1
CGCTGCCAACACCTCCTCCGCCGCCGCAAGCAA
+HWUSI-EAS1795_0092:3:1:10865:1244#0/1
ggggggggggggggggfgggggcgggggdafgg
@HWUSI-EAS1795_0092:3:1:11123:1235#0/1
TCCTGCTCCGCCCGAATCTCGTCGTGGAACTTG
+HWUSI-EAS1795_0092:3:1:11123:1235#0/1
hhhhhhhhhghhhehhghhhhggghhhghhhhe
@HWUSI-EAS1795_0092:3:1:11599:1245#0/1
GGAAAAGAGAGTTCGTCTGGCTTGTTCGCCTTA
+HWUSI-EAS1795_0092:3:1:11599:1245#0/1
hhhhghhehhhehhhaghfghhghghhhhhghh
@HWUSI-EAS1795_0092:3:1:12073:1238#0/1
GCTTGGGCACCCTCGCAGTGCTCGGTCACCTTA
+HWUSI-EAS1795_0092:3:1:12073:1238#0/1
hhhhdghhhhhhhhhfhhhhhghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:13495:1242#0/1
CTTTTGGCCATCTGCCTGGTACTCCATCCCCAG
+HWUSI-EAS1795_0092:3:1:13495:1242#0/1
hhhhhhhhhhhhhhhhhhhghhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:13725:1244#0/1
CGAATACGCAACCAACTCGGATTACTACGATGA
+HWUSI-EAS1795_0092:3:1:13725:1244#0/1
hhhhhhhhhhgfhghghhhhhhghhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:14146:1241#0/1
GTTGTCGGCGGGCATATCAAAAAACACCCTAGG
+HWUSI-EAS1795_0092:3:1:14146:1241#0/1
cccccccccccMWWU[VQM^a^`BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14246:1241#0/1
GACGCAGTATGCGGCACCAAACAGAGAAATAAC
+HWUSI-EAS1795_0092:3:1:14246:1241#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:14315:1240#0/1
TCTTAACATCACGAAGCAGAGCGGTGAACTGCT
+HWUSI-EAS1795_0092:3:1:14315:1240#0/1
hhhhhhhhhhhhhhhhhhhhhhhgghhhhghhh
@HWUSI-EAS1795_0092:3:1:14729:1237#0/1
CGGATGTGGAGACTGAAGCGCCGGAAACTTGAG
+HWUSI-EAS1795_0092:3:1:14729:1237#0/1
hhhhhhhhhgghhhfhhhgghhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14901:1245#0/1
GACGAAACGAACCGCTCGTATCCCACACAGCTG
+HWUSI-EAS1795_0092:3:1:14901:1245#0/1
ggggfgagegggfffWfffccfffdfaggbgdg
@HWUSI-EAS1795_0092:3:1:15245:1238#0/1
GTCAACAAAAAATACATAACAATTTGTGTGCCG
+HWUSI-EAS1795_0092:3:1:15245:1238#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:15299:1246#0/1
CGATGAGGCCGCTATCGCCGTTAAGTCTTGCGA
+HWUSI-EAS1795_0092:3:1:15299:1246#0/1
hhhhhhhhhhhghghghghahhgghhhhhcghg
@HWUSI-EAS1795_0092:3:1:15991:1243#0/1
CTGTCGCCCAGGGAGACTATGACATTGGAGCTG
+HWUSI-EAS1795_0092:3:1:15991:1243#0/1
hhhhhghhhhhhgcffhhhehfhghhhhfhhfh
@HWUSI-EAS1795_0092:3:1:16191:1244#0/1
CAGCGGGTACTCGCCCTTGGCGGTCTCACCAGA
+HWUSI-EAS1795_0092:3:1:16191:1244#0/1
ffdfdfdefa[c`bbf^^BBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:16507:1245#0/1
CGGCCATCTTCCAGCTGCTTGCCAGCGAAGATC
+HWUSI-EAS1795_0092:3:1:16507:1245#0/1
ggegggggggggeeggcgggcggggde`^W\QU
@HWUSI-EAS1795_0092:3:1:16980:1244#0/1
ATATTTTCTTTATTCTCGAGTAGAAAACAGCTC
+HWUSI-EAS1795_0092:3:1:16980:1244#0/1
dhahhhhhhhgghhhhhhhfhhfhhfhhhfhfh
@HWUSI-EAS1795_0092:3:1:17301:1239#0/1
ACAGCATCGTGGTCATCGATGCCACGCCCTTCC
+HWUSI-EAS1795_0092:3:1:17301:1239#0/1
hhhhhhhhhhfgghhhhhhgchhchghhggbhe
@HWUSI-EAS1795_0092:3:1:17505:1238#0/1
CGCCCCCTCAAAAATAACGTCTATAATTAAAAA
+HWUSI-EAS1795_0092:3:1:17505:1238#0/1
hghhhhhhhghhhhghhghhhcghhghfghhhh
@HWUSI-EAS1795_0092:3:1:17960:1238#0/1
CGCCAATGCGTCGTCCAGCATGAAGGCTCCTTG
+HWUSI-EAS1795_0092:3:1:17960:1238#0/1
geffffffafffbdddaaacffff_efddfcff
@HWUSI-EAS1795_0092:3:1:18134:1239#0/1
GTTTGTTGCAGGCCCTCGCGCAGATCAGTCGCG
+HWUSI-EAS1795_0092:3:1:18134:1239#0/1
gggggfgggdgggggfgggcggggfcggeg_gg
@HWUSI-EAS1795_0092:3:1:18209:1240#0/1
CGGCAGCTGAATGTCCTCCGCTACGTTTCCTTC
+HWUSI-EAS1795_0092:3:1:18209:1240#0/1
fafca_[\a\^ad]dd]__ZZZNXXWWff_d]f
@HWUSI-EAS1795_0092:3:1:18682:1235#0/1
CCCCGGTGGAGCGATGAAAAGCTCTTCCAAGCT
+HWUSI-EAS1795_0092:3:1:18682:1235#0/1
_c___c[aaa]]SNQU_aaa[][][[caBBBBB
@HWUSI-EAS1795_0092:3:1:19048:1243#0/1
ATCTGACAACTTCTACAACACATCCCCTGCACC
+HWUSI-EAS1795_0092:3:1:19048:1243#0/1
gff]ff]aacacdbfa[`````[ebebFRVZZ^
@HWUSI-EAS1795_0092:3:1:19689:1241#0/1
TTTGGAGACATTTTGTTGTTTCGTGTCTTGTCG
+HWUSI-EAS1795_0092:3:1:19689:1241#0/1
fgefe]e]fccffafffffcccfffcfgfegef
@HWUSI-EAS1795_0092:3:1:1507:1249#0/1
GCCAAGCAAGGCGAATTTATTTATGCCACTAAG
+HWUSI-EAS1795_0092:3:1:1507:1249#0/1
`fffafaacfffgccaef^fcf_`edKe`ee[f
@HWUSI-EAS1795_0092:3:1:1616:1259#0/1
TCGTAGTCTGCCATGCATATAAGTGTGTGATGC
+HWUSI-EAS1795_0092:3:1:1616:1259#0/1
dfc`cadd]aceccdfcfdffcaZd^dW\WY^d
@HWUSI-EAS1795_0092:3:1:1791:1258#0/1
CGACGAGGTCCTGGTTGCCGGTTTCGGTCGTAA
+HWUSI-EAS1795_0092:3:1:1791:1258#0/1
d`ddYed^`a`bf^ffaffffccdaacc^cca\
@HWUSI-EAS1795_0092:3:1:1848:1252#0/1
CGCATCGCATTATGGGATGGCTGCAGACCATCG
+HWUSI-EAS1795_0092:3:1:1848:1252#0/1
]LaaaaQdcffffcaVfaR]\e\`\`afdedcf
@HWUSI-EAS1795_0092:3:1:2030:1256#0/1
GTTTGGTTGAAGAACGCCAGTTACTCCTGGTTG
+HWUSI-EAS1795_0092:3:1:2030:1256#0/1
hhhhhhhhhhffhghhfgchhhhhhhhfhahff
@HWUSI-EAS1795_0092:3:1:2089:1255#0/1
AATCGATGAGGCTTGCGTTTCAATGGGGGGTGT
+HWUSI-EAS1795_0092:3:1:2089:1255#0/1
]ffaffccfccffcfYffffdfccfcfaBBBBB
@HWUSI-EAS1795_0092:3:1:2801:1255#0/1
CCGCAGTACTGAACTCGAAGGATAAAACCCCCT
+HWUSI-EAS1795_0092:3:1:2801:1255#0/1
gggcgggfcccffadfffdcff_ffc]UWVUTO
@HWUSI-EAS1795_0092:3:1:3017:1253#0/1
GTGGGAATGCGGAAGATGCGAGGGCTGCTTCGA
+HWUSI-EAS1795_0092:3:1:3017:1253#0/1
ffaYdcdWdYd_\aaaafafWffffWaO\]XZf
@HWUSI-EAS1795_0092:3:1:3831:1251#0/1
CCGCGTTGTTAGGATCTTTTGCGGTGTTTTCGC
+HWUSI-EAS1795_0092:3:1:3831:1251#0/1
ffaffffggfgdcafefgggfgdacafggegad
@HWUSI-EAS1795_0092:3:1:4327:1256#0/1
TGGGTTTTGGATAAGTTGAAGGCTGAGCGCGAG
+HWUSI-EAS1795_0092:3:1:4327:1256#0/1
aY\RZZJNTSSW\Y^^\X[T\[Sa\a^UU]YS]
@HWUSI-EAS1795_0092:3:1:4439:1247#0/1
AAAAATGACGAAGCTCAGATTAAAGAAATTTTG
+HWUSI-EAS1795_0092:3:1:4439:1247#0/1
hhghhhfhhhghhfhhchhghhghghhhhhhhc
@HWUSI-EAS1795_0092:3:1:4541:1254#0/1
GAACGATAAGAATTTGATGATCCCGCCGCAAAA
+HWUSI-EAS1795_0092:3:1:4541:1254#0/1
hghhhhhffhfhhhhhcghchhhhhh`ghhhhh
@HWUSI-EAS1795_0092:3:1:4953:1259#0/1
TGCAGCTTAGAAACGCAGCTTCTGGAAGAACCA
+HWUSI-EAS1795_0092:3:1:4953:1259#0/1
ggcgeWgdc`deebdefggacfc_cffWfffff
@HWUSI-EAS1795_0092:3:1:5418:1247#0/1
CGGGGACATGTGGGTGGTTGGCAAATCCAAAAT
+HWUSI-EAS1795_0092:3:1:5418:1247#0/1
ggggggegggggggeggeffffgggffgggggg
@HWUSI-EAS1795_0092:3:1:6336:1253#0/1
CAAGCGCAACACGCGCCGCAACCTGACCCCCGG
+HWUSI-EAS1795_0092:3:1:6336:1253#0/1
hhhhghhhhhhchhhhghhghhhefhhhhhhfg
@HWUSI-EAS1795_0092:3:1:7372:1251#0/1
GGGGAAGTGATCGAAGGTGTTGCGGACCGCCTC
+HWUSI-EAS1795_0092:3:1:7372:1251#0/1
hhhhhhhhhhfhhhhfhadffdff]dfhhhhaf
@HWUSI-EAS1795_0092:3:1:7498:1253#0/1
GGGCTCCTCGTATCGCCTCTTTGCCGGCGTGGC
+HWUSI-EAS1795_0092:3:1:7498:1253#0/1
hhhhghhhhhhhghhhhfghhh[hhggggdfgg
@HWUSI-EAS1795_0092:3:1:7703:1252#0/1
CCGGCTTGTCATCAACTTCTGGGACTGAAATGG
+HWUSI-EAS1795_0092:3:1:7703:1252#0/1
hhhhhhhghhehhhhhhhhhhhhhfhhhhehhh
@HWUSI-EAS1795_0092:3:1:8871:1258#0/1
GAGTAATTGGGTAGCGGAAGCGTGTTAATCTCA
+HWUSI-EAS1795_0092:3:1:8871:1258#0/1
hhhhhhhhhhhhhhfhgehggfcfffffhchhf
@HWUSI-EAS1795_0092:3:1:10106:1256#0/1
CGAGTGAGCGCCATGCGTTAGAAATAATTGTGA
+HWUSI-EAS1795_0092:3:1:10106:1256#0/1
hhhhhhhhhhhhdhhhhhhhhhhhhhhhhfggh
@HWUSI-EAS1795_0092:3:1:10608:1250#0/1
ACAGCATCGTGGTCATCGATGCCACGCCCTTCC
+HWUSI-EAS1795_0092:3:1:10608:1250#0/1
gggggggffdffggfggggeefgfgagggffgg
@HWUSI-EAS1795_0092:3:1:10731:1256#0/1
GAAACTGTTCACATGAACTTGGAATTCCCAGTA
+HWUSI-EAS1795_0092:3:1:10731:1256#0/1
gggffgfgggggggfggggggggfgdgffdd_f
@HWUSI-EAS1795_0092:3:1:10959:1248#0/1
CCAGGATGTTCAGCGCATCTGCCAAAAGCAGAG
+HWUSI-EAS1795_0092:3:1:10959:1248#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:11233:1250#0/1
GTGTTGGTGTTATACTACTATTGTGTTCGCTGC
+HWUSI-EAS1795_0092:3:1:11233:1250#0/1
hghhhhhhhghhhhhhhhghhhhhfhhghhhhh
@HWUSI-EAS1795_0092:3:1:12203:1255#0/1
TTCGGGATTACGCTGGGGTGTAAAGAAATCGAA
+HWUSI-EAS1795_0092:3:1:12203:1255#0/1
hhhhhhhhhhhhhhhhhhefhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12398:1250#0/1
GCACCGTTCCCTTCGATGAGAAACTTCCTCTTT
+HWUSI-EAS1795_0092:3:1:12398:1250#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:12732:1258#0/1
CAGACCAGGGCGCCCGAAGAAGCAATACAATGT
+HWUSI-EAS1795_0092:3:1:12732:1258#0/1
fdcafffffffRcaaaaaaa[df[c[W]ab`]d
@HWUSI-EAS1795_0092:3:1:13101:1248#0/1
CGGCCAATACGTTCATACGCACCATGGCTGGAT
+HWUSI-EAS1795_0092:3:1:13101:1248#0/1
ffd^ffdcaaa^\__Z_`]b`b_ZZZZVM^P]U
@HWUSI-EAS1795_0092:3:1:13349:1256#0/1
CTCATATCCGAGGCCCTGTAATTGGAATGAGTA
+HWUSI-EAS1795_0092:3:1:13349:1256#0/1
hghghhhhhghehhhhhghhghhhgfhhcghhh
@HWUSI-EAS1795_0092:3:1:15009:1251#0/1
AAATAGTCAAGTTTATGTTTGAGTTTTATGATT
+HWUSI-EAS1795_0092:3:1:15009:1251#0/1
TQ\a]``dacdaccaaaffffK``ab`d``Kdd
@HWUSI-EAS1795_0092:3:1:15468:1252#0/1
CAGCTCGTCGCGCGTCTCAATGGCGACAACGAA
+HWUSI-EAS1795_0092:3:1:15468:1252#0/1
hhhhhhhhhhhghhghhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15547:1251#0/1
CGTGTGTGTGCGAGAGAGCGAAGCTTTTGATTT
+HWUSI-EAS1795_0092:3:1:15547:1251#0/1
hhhhhhhhhghhhehhhhhhhhhghhhhh_hfh
@HWUSI-EAS1795_0092:3:1:16253:1254#0/1
TTCGGATGTGCCTTCGGGTAGAGTGTTCCATGC
+HWUSI-EAS1795_0092:3:1:16253:1254#0/1
hhhhhhhhhhhhhhhhhfdhhhhgfhhhhhhgh
@HWUSI-EAS1795_0092:3:1:16885:1250#0/1
CTCGCAATTTGCATCCTCGTGTTCGCCCTGTTC
+HWUSI-EAS1795_0092:3:1:16885:1250#0/1
ggggggffggeggggffgggggggggggggggg
@HWUSI-EAS1795_0092:3:1:17060:1258#0/1
CCCCAGTCAAACTCCCTACCTGGCAATGTCCTT
+HWUSI-EAS1795_0092:3:1:17060:1258#0/1
hhhhhhhhgghhhhhhhhhhghhghhgfghhhh
@HWUSI-EAS1795_0092:3:1:17591:1254#0/1
CGGCTTTCCACACGCCAAGGGTTGGGTAGTGAA
+HWUSI-EAS1795_0092:3:1:17591:1254#0/1
hgghhhhhhhhhhchhhhfghghhhhfhhfhhh
@HWUSI-EAS1795_0092:3:1:17710:1248#0/1
CCTAGGCTTAAGTGGAATCGCTCATTCGCATAG
+HWUSI-EAS1795_0092:3:1:17710:1248#0/1
hhhhehhhhfhfbdebedfdfdhhhhhhhghff
@HWUSI-EAS1795_0092:3:1:17881:1257#0/1
GTCGTACAGGGCAATGGCGTGGATTCCGGTGTC
+HWUSI-EAS1795_0092:3:1:17881:1257#0/1
hhhhhhhhhhhhhhhhhghghhhhhhhhhdhgh
@HWUSI-EAS1795_0092:3:1:19241:1253#0/1
TGGAACAGGAACCCAGGGTTCACATCGAACCTA
+HWUSI-EAS1795_0092:3:1:19241:1253#0/1
gghhhhghhhhhhhhgghghghhhhhhhehhhh
@HWUSI-EAS1795_0092:3:1:19267:1257#0/1
CATGCAGCGAATGGGGCTGGGCGGCATCTTTAG
+HWUSI-EAS1795_0092:3:1:19267:1257#0/1
gdggcggggggaggfgce]fedfcccaacaccd
@HWUSI-EAS1795_0092:3:1:19313:1249#0/1
TTTTTAATTGGCTGAAACAACACTAATGTGCAA
+HWUSI-EAS1795_0092:3:1:19313:1249#0/1
hhhhhhhhhhhhfhhhhghhechhhffhghghh
@HWUSI-EAS1795_0092:3:1:19484:1259#0/1
ATTAAAAAATTAAGTTACTTTAGGGATAACAGC
+HWUSI-EAS1795_0092:3:1:19484:1259#0/1
fggdggggfgagggggfggggggggggggcfgg
@HWUSI-EAS1795_0092:3:1:2142:1268#0/1
GTTGGAAAAAGGAAAGTCAGCGGGAGCGGGAAT
+HWUSI-EAS1795_0092:3:1:2142:1268#0/1
cafcccffff^_fffcdfefffd\ffdcdc``^
@HWUSI-EAS1795_0092:3:1:2481:1261#0/1
TTCCGTTCCACCCTGAAGCCAGTGCAGAAGGTG
+HWUSI-EAS1795_0092:3:1:2481:1261#0/1
hhhhhhhhhhhhhhfhhffhhdehhhhghgabh
@HWUSI-EAS1795_0092:3:1:2816:1268#0/1
TCGTAGTTGAACTTGTGCTTCATACGGGTAGTA
+HWUSI-EAS1795_0092:3:1:2816:1268#0/1
gggfggggecg_aa]^cfffffgggagfacccf
@HWUSI-EAS1795_0092:3:1:3803:1270#0/1
GCGGATGGCATCAGCGTAGCGGCGCATCATCAT
+HWUSI-EAS1795_0092:3:1:3803:1270#0/1
ggcggaggfgdcgggfggdfggggfggfdgcge
@HWUSI-EAS1795_0092:3:1:4582:1260#0/1
CACCAACGAGGGAATCGAGGAGCTGCGCAGCTA
+HWUSI-EAS1795_0092:3:1:4582:1260#0/1
gggfggggggadfffffcfffagggadfeaadf
@HWUSI-EAS1795_0092:3:1:4656:1264#0/1
CGCTGATGGCGTCTTGCGTTCCGACCAATATCA
+HWUSI-EAS1795_0092:3:1:4656:1264#0/1
fgefafcffffeaffffadfcfggdggggggef
@HWUSI-EAS1795_0092:3:1:4703:1270#0/1
TTGCAGTTGGGTGCTCAGTTGCGGATAAATCAG
+HWUSI-EAS1795_0092:3:1:4703:1270#0/1
fffdffcS\Z`Lcca^cWaaddff_[fffcfcZ
@HWUSI-EAS1795_0092:3:1:4991:1259#0/1
TTCGCACGGAATTGATATCTATGTGTAACCCAA
+HWUSI-EAS1795_0092:3:1:4991:1259#0/1
hhhfhhhhhhghhcchehhghccffffhghchh
@HWUSI-EAS1795_0092:3:1:5271:1269#0/1
CCTGAACAAGGGCCACAAGACCTCGAAGATCAG
+HWUSI-EAS1795_0092:3:1:5271:1269#0/1
hghhghgghhhchghghhaghhfghhhhghg_h
@HWUSI-EAS1795_0092:3:1:5335:1269#0/1
ACAACCGACAGGCCTACGCCGTCAGCGAGCTGG
+HWUSI-EAS1795_0092:3:1:5335:1269#0/1
ff_L`_Z^[aW\^\V``[Wc^^db]bBBBBBBB
@HWUSI-EAS1795_0092:3:1:5356:1262#0/1
TGGGTACCTTCGATTTCTTTACACCCCAGCGTA
+HWUSI-EAS1795_0092:3:1:5356:1262#0/1
gggggfggggggg]ggffffffgdggeggfdgf
@HWUSI-EAS1795_0092:3:1:5598:1261#0/1
CTTCGCAGGACATGTTATCTCCAATGGCAGTTT
+HWUSI-EAS1795_0092:3:1:5598:1261#0/1
ffaffcfgggggggggccgfgdggggggcgggg
@HWUSI-EAS1795_0092:3:1:5693:1265#0/1
GCGCACCAAGAAGGTTGGAATCGTTGGTAAATA
+HWUSI-EAS1795_0092:3:1:5693:1265#0/1
hghhgghhghffhgghggagchhhfgehhgfha
@HWUSI-EAS1795_0092:3:1:6488:1262#0/1
CGCACGTGAAAAGCGAGCACTCTTCGCCAGTGC
+HWUSI-EAS1795_0092:3:1:6488:1262#0/1
ggfggggfffffffdffgfggggggggfdfffc
@HWUSI-EAS1795_0092:3:1:6559:1263#0/1
CGAATGGGGACCAAACACACACACACACACACA
+HWUSI-EAS1795_0092:3:1:6559:1263#0/1
ccZY\SZYPVZX^aa\ac^YcKYNPVNW_`W\c
@HWUSI-EAS1795_0092:3:1:6760:1260#0/1
CGAACTTTTGCCTCGACCACATCGCAGTCTCCT
+HWUSI-EAS1795_0092:3:1:6760:1260#0/1
ggfggggggggggfggfffgfggggdggggggd
@HWUSI-EAS1795_0092:3:1:7167:1259#0/1
ATCCATGGCTGGGTGCGAGTGGTGATGAAGCCA
+HWUSI-EAS1795_0092:3:1:7167:1259#0/1
hhhhhhhhhhhhhghhhffdffdfhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:8240:1269#0/1
TGGAATTCCCAGTAAGTGTGAGTCATTAACTCG
+HWUSI-EAS1795_0092:3:1:8240:1269#0/1
hhhhhhhhhhhhhhhhhhghhfgfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8290:1266#0/1
CTGGTCGCGACGGTGGTTCACATGCTTCCTGGC
+HWUSI-EAS1795_0092:3:1:8290:1266#0/1
hhhhhhghhhhhhdhhhhhhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:8382:1268#0/1
GGGGAGGGGGCCGTGTGGTGGGCACCGCTTCTT
+HWUSI-EAS1795_0092:3:1:8382:1268#0/1
ggggggggggggggggggdggggggaggggggg
@HWUSI-EAS1795_0092:3:1:8498:1260#0/1
TGTTGCCGTCGTGGCCGGCGATGCACGCCTTGG
+HWUSI-EAS1795_0092:3:1:8498:1260#0/1
gggggggggggggggggggggdgggfggggggg
@HWUSI-EAS1795_0092:3:1:8843:1265#0/1
AGCATTTGCCCTTTTGCTCTATGTGTGGTTTCT
+HWUSI-EAS1795_0092:3:1:8843:1265#0/1
afcffafadeda`]`X^ffd_ffcfccd`bbdf
@HWUSI-EAS1795_0092:3:1:9093:1259#0/1
TGCAACATTCACAGCGCTTGCCACTTGTCACTA
+HWUSI-EAS1795_0092:3:1:9093:1259#0/1
gggggggggggggcgggfgcgggcggeggggfg
@HWUSI-EAS1795_0092:3:1:9153:1265#0/1
CTCCTGCTCACTGACATCGTTCACGAAGTCCGG
+HWUSI-EAS1795_0092:3:1:9153:1265#0/1
hhhhhhhhghhhghhhhhhhhhghhhhggghhh
@HWUSI-EAS1795_0092:3:1:9184:1268#0/1
GGAAGACACAGCCGGAGCTGAACTTGATCCTGC
+HWUSI-EAS1795_0092:3:1:9184:1268#0/1
hchhfhhgdghchhgdchfhcghhhhhhhhgeg
@HWUSI-EAS1795_0092:3:1:9963:1264#0/1
TGATCGTCCTGCTCATTCCGTATCCTTAACCAA
+HWUSI-EAS1795_0092:3:1:9963:1264#0/1
hhhhhhhhhhghhghhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:10157:1268#0/1
CAAAGGCTACAACTTTGGCCTGTGGAAGCTCGA
+HWUSI-EAS1795_0092:3:1:10157:1268#0/1
hhhhhghhhhhhhhhhghhhhgghhhhhhgghg
@HWUSI-EAS1795_0092:3:1:10235:1260#0/1
CGTTTTCCTGCCCTTCGCCTTCACCATGGACAA
+HWUSI-EAS1795_0092:3:1:10235:1260#0/1
hhhhhhhhhhhhhfghhdf]fcWad\`hhcgeh
@HWUSI-EAS1795_0092:3:1:10270:1270#0/1
TGACCTTCTCACCGGTGACGGCGACATCGTCAT
+HWUSI-EAS1795_0092:3:1:10270:1270#0/1
ZZNIVZV\\\]X_aa\acd^d^abRbRa\Zaaa
@HWUSI-EAS1795_0092:3:1:10360:1260#0/1
CAACAAGTCGTTACCGAGGAAGAACTCACACAC
+HWUSI-EAS1795_0092:3:1:10360:1260#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10601:1268#0/1
CAACAAGGCGGAGGGCGAACGTTTGGGCATGCA
+HWUSI-EAS1795_0092:3:1:10601:1268#0/1
ggggggegggffc_cc_cd]fdc_cddgg_fgg
@HWUSI-EAS1795_0092:3:1:10813:1269#0/1
TGTCCCTTGATTCCTTTGCAGTCGCATAGCGTT
+HWUSI-EAS1795_0092:3:1:10813:1269#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10862:1270#0/1
GATGGATGCGGTCAAGTCGCTGGAGCAGCCCCT
+HWUSI-EAS1795_0092:3:1:10862:1270#0/1
hhhhhhhhghghhhhfhhhhhhhgchhhhhhhd
@HWUSI-EAS1795_0092:3:1:11101:1260#0/1
CGCCCTTTTCCGTCTGGTCACTCCTGGTGCTTC
+HWUSI-EAS1795_0092:3:1:11101:1260#0/1
hghhhhhhhhhghhahhfhhhfghhhhhhhfhc
@HWUSI-EAS1795_0092:3:1:11639:1268#0/1
AAGGCCTCGGTGAAGGCCCGTGTGGTGACCATC
+HWUSI-EAS1795_0092:3:1:11639:1268#0/1
hhhhhhhfffafhhdhhhhhefdcfcefhfhdh
@HWUSI-EAS1795_0092:3:1:12242:1261#0/1
TGGCACGATGTGCACTTCGGCTCTTCCCGTCTT
+HWUSI-EAS1795_0092:3:1:12242:1261#0/1
fdfffffaffddgffggfgcggdfafcff_cff
@HWUSI-EAS1795_0092:3:1:13411:1263#0/1
CGCGAATGTGTGTGTGTAAGCTTGTGGGTGTGC
+HWUSI-EAS1795_0092:3:1:13411:1263#0/1
c_ac]a_a[^[ZV\NWT_VaY^cc_ccaXa]a]
@HWUSI-EAS1795_0092:3:1:13652:1264#0/1
GGAGCTTTAGACATCTTGTGTGTTGTTTCTTAG
+HWUSI-EAS1795_0092:3:1:13652:1264#0/1
NWPWVSSa]Z]^caccJccccc]]]a]]_a_V[
@HWUSI-EAS1795_0092:3:1:13785:1259#0/1
CGCAATTCAATGATCAATATGATGAAGTATGAA
+HWUSI-EAS1795_0092:3:1:13785:1259#0/1
hhhhhhhhhhhgghhhhhhhhhgfhhdghhghh
@HWUSI-EAS1795_0092:3:1:15370:1266#0/1
TAGATGGTAGATCCCTATACGGAGGACCCGTAC
+HWUSI-EAS1795_0092:3:1:15370:1266#0/1
cYccdcc`dffaecdeadceed\W_eaeeb`db
@HWUSI-EAS1795_0092:3:1:15404:1264#0/1
CAAATCTCGAGGATTGAATATCAGCTACCGCCT
+HWUSI-EAS1795_0092:3:1:15404:1264#0/1
gghhhghhhghhhdhfhhggghghhghghehcg
@HWUSI-EAS1795_0092:3:1:15677:1263#0/1
TTGGCTTTGACATTTTCGATAGTATCCGACGGT
+HWUSI-EAS1795_0092:3:1:15677:1263#0/1
hehhhhhhhhhehhhhhhhghaghhhhehhhhh
@HWUSI-EAS1795_0092:3:1:15851:1259#0/1
CCTGGGCCTCATCACGCGGGCGATGGCCAGAAT
+HWUSI-EAS1795_0092:3:1:15851:1259#0/1
gggggfggfggggfggf_ggafcccafeffeeb
@HWUSI-EAS1795_0092:3:1:15923:1261#0/1
GCGAAAACCCTCCGGGCTTCAATTTCGGCTGCA
+HWUSI-EAS1795_0092:3:1:15923:1261#0/1
gfg_gggggfggf`aef_fdffagag_f_cda]
@HWUSI-EAS1795_0092:3:1:16204:1260#0/1
GCTACACCCAAAATTATATCTTAATCCAACATC
+HWUSI-EAS1795_0092:3:1:16204:1260#0/1
hhghhghhhhghghhgghhfhhhhhhfhfhhcg
@HWUSI-EAS1795_0092:3:1:16271:1262#0/1
CAGGAGGTAGTAGTCAAAATCTTATATTATTTA
+HWUSI-EAS1795_0092:3:1:16271:1262#0/1
ggggeggdffefggggeggfggggggggggggg
@HWUSI-EAS1795_0092:3:1:16373:1268#0/1
GACTGCAGCAGGCCAGGTGAAATCAGAAGATAT
+HWUSI-EAS1795_0092:3:1:16373:1268#0/1
gfgggggfc[ffffdfffggggggagafdeeeg
@HWUSI-EAS1795_0092:3:1:16768:1267#0/1
CTCGATCATCTTGGCGCGAGCTGGATCCTTTTC
+HWUSI-EAS1795_0092:3:1:16768:1267#0/1
hhhhhhhhhhhhhfhdhgdhhaggfehhhhhhh
@HWUSI-EAS1795_0092:3:1:16826:1266#0/1
CAGACACACAATCCCATTGCCGGCGGCAAGCAC
+HWUSI-EAS1795_0092:3:1:16826:1266#0/1
hhhhhhhhhhhhhgghhhhhfhhhghhgfd_gh
@HWUSI-EAS1795_0092:3:1:17179:1264#0/1
GTCGTTTTCAATGTAATGATATATGGCCATCCA
+HWUSI-EAS1795_0092:3:1:17179:1264#0/1
XVW___]a_acc__^__^Ldd^_\W__accccf
@HWUSI-EAS1795_0092:3:1:17329:1267#0/1
GCGGGTGGTCCGTCTGCAGGTGCTTGTTGGCCC
+HWUSI-EAS1795_0092:3:1:17329:1267#0/1
hhhhfchhhhhhhhhhhfghbhfhhfdhhhghh
@HWUSI-EAS1795_0092:3:1:17361:1261#0/1
TCCTCCTGAACGGTTTGCGCTGCCGAATAACCA
+HWUSI-EAS1795_0092:3:1:17361:1261#0/1
hhhhhhhhhhhhhhhhghgfgghhhhhghhhga
@HWUSI-EAS1795_0092:3:1:17664:1259#0/1
TCGCGAAGTTCTTCATAACGCTCACGTTCGTAT
+HWUSI-EAS1795_0092:3:1:17664:1259#0/1
ggggggggggfggggggggggfggggggggggg
@HWUSI-EAS1795_0092:3:1:18018:1269#0/1
CGGGAATTCGGGTATTTCGGTAGAACTGTTGGT
+HWUSI-EAS1795_0092:3:1:18018:1269#0/1
\Z\[^Y^^aaccNZZ]`dbdWdccffcbbbdbc
@HWUSI-EAS1795_0092:3:1:18478:1266#0/1
CCGTGATCGAGGGTGGAGCCTTTTGTGAAGATA
+HWUSI-EAS1795_0092:3:1:18478:1266#0/1
f_cfffcfdWffcXe__ffdffffaccf__dff
@HWUSI-EAS1795_0092:3:1:18521:1269#0/1
GCGACTGTGGCTTCAACGAGGAGGAGTGCAAGG
+HWUSI-EAS1795_0092:3:1:18521:1269#0/1
hhhhhhhhhhhhhhhhgegfhccfddahhhggh
@HWUSI-EAS1795_0092:3:1:18719:1261#0/1
CGCCAACATGGGTTTCGCTACTCTCTGGTACTC
+HWUSI-EAS1795_0092:3:1:18719:1261#0/1
dhdhhghhhhhhhhfhhhhggeghhchghhghh
@HWUSI-EAS1795_0092:3:1:18878:1261#0/1
GCTTTTCGGACGACAACAGCTCGATACAATCCT
+HWUSI-EAS1795_0092:3:1:18878:1261#0/1
hhgfhhhhghhghhhhhhhhhhhhhhhhhgheh
@HWUSI-EAS1795_0092:3:1:19292:1263#0/1
CTGGGGAAACACTACAACCTGCAGGCTGCTCCT
+HWUSI-EAS1795_0092:3:1:19292:1263#0/1
ggfgffgcg_gggggggffecddfeffgaKggc
@HWUSI-EAS1795_0092:3:1:1577:1278#0/1
AGACGACGATGATCGAGTCCTTCCCTTGTGCAT
+HWUSI-EAS1795_0092:3:1:1577:1278#0/1
gggf]cgggdggfcaeeeffffffdff_afa_]
@HWUSI-EAS1795_0092:3:1:2316:1279#0/1
CGTCTTGCAGCAAACCCAATTTGTCTCGTAACT
+HWUSI-EAS1795_0092:3:1:2316:1279#0/1
a[_c__cggggcgggggfgaggcecdfdfeffd
@HWUSI-EAS1795_0092:3:1:2909:1282#0/1
CTCGGCTAGTAGCACGCGCTTGCCGGTGAGCAG
+HWUSI-EAS1795_0092:3:1:2909:1282#0/1
ggfQfffffefefffffdfaf]ffffbdddffg
@HWUSI-EAS1795_0092:3:1:4107:1278#0/1
TCAGGATCGGGAGCGTGTTTCCCAAGAGCTGAT
+HWUSI-EAS1795_0092:3:1:4107:1278#0/1
gggggfgggggeffgggfggggfaf_acccffb
@HWUSI-EAS1795_0092:3:1:4277:1273#0/1
GGGCCGCACCGGCTCCCAGGGTCAGTGTACCCA
+HWUSI-EAS1795_0092:3:1:4277:1273#0/1
gggggggggggffafff]ffd[fcfccedfffd
@HWUSI-EAS1795_0092:3:1:4355:1280#0/1
CCTTCGTCCGGAGTGAGGTTCTCGGTTTCCACA
+HWUSI-EAS1795_0092:3:1:4355:1280#0/1
fdgggfgdffccffffffffffggggfgggggf
@HWUSI-EAS1795_0092:3:1:4463:1272#0/1
CATTCGCCAACGATGTCCCCTGTTGGTTTTGGT
+HWUSI-EAS1795_0092:3:1:4463:1272#0/1
ddc^db^dccddda]ddQ]YUZWSW`\dbWR[[
@HWUSI-EAS1795_0092:3:1:4662:1282#0/1
TGTGGCATCTGCCGATCTTAGTTGGCGATGGTG
+HWUSI-EAS1795_0092:3:1:4662:1282#0/1
gggggfgffcfafa][feead_ccdbdcfff]P
@HWUSI-EAS1795_0092:3:1:4784:1273#0/1
GGTGTCCAGGATGTTGATGGCATCAAAGTAGTA
+HWUSI-EAS1795_0092:3:1:4784:1273#0/1
ffghhhhhhhhhhhhehcghhhgghghhfhhhh
@HWUSI-EAS1795_0092:3:1:5004:1282#0/1
CGGCGGAGATGGCCTCATCCGTGTTGGTCACCA
+HWUSI-EAS1795_0092:3:1:5004:1282#0/1
ffgggdggggggcgggfggcecffafcdegggg
@HWUSI-EAS1795_0092:3:1:5539:1281#0/1
CAGGAGAACATTGAAAAAACCATCTTCAAGCAC
+HWUSI-EAS1795_0092:3:1:5539:1281#0/1
hfhhhhfghghhhhghhhhhhggfhghhfhfhh
@HWUSI-EAS1795_0092:3:1:6093:1271#0/1
GTGAGACAGCAAGATCGCGTGTGGAAGGAGATA
+HWUSI-EAS1795_0092:3:1:6093:1271#0/1
ffffdfdffWfa\\]P\P\S\NYYU^Zc`d`d]
@HWUSI-EAS1795_0092:3:1:6139:1278#0/1
GGTACACTTGCACTTTTTTATAAAAATTATGAC
+HWUSI-EAS1795_0092:3:1:6139:1278#0/1
chhhhhhfgehhhhhhhhhhggghhhhhhhghf
@HWUSI-EAS1795_0092:3:1:6272:1277#0/1
GAAGTACCTGAAGAAGAACAGTCTGCGCGACTG
+HWUSI-EAS1795_0092:3:1:6272:1277#0/1
hhhhhhhhhhhhhghgghhhfhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:6326:1275#0/1
TGCAGGCGCAGGCCGTATTTTGAGAATCTCTTG
+HWUSI-EAS1795_0092:3:1:6326:1275#0/1
ggfgggegg]ggSG]RXW[[VOcggggfggggg
@HWUSI-EAS1795_0092:3:1:8046:1277#0/1
GGAGTGGCCTGTAGTTGCGAGGCGGCCGCTGTC
+HWUSI-EAS1795_0092:3:1:8046:1277#0/1
hhhhhhhhhdhhhhhhhehfhhhhhdfBBBBBB
@HWUSI-EAS1795_0092:3:1:8211:1274#0/1
CGTCTTTGCTAGAAGCCACGTGCTAAATTTGTA
+HWUSI-EAS1795_0092:3:1:8211:1274#0/1
hhhhhhhhhhhhhhhhhhfhghhhgghhhhghh
@HWUSI-EAS1795_0092:3:1:8330:1278#0/1
ACTATGTTGGGTTTGTTCGCTCAAATATGTCTC
+HWUSI-EAS1795_0092:3:1:8330:1278#0/1
ggggggggggggggfgggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:8558:1274#0/1
CGTCGGTGTTGCGGTTTTTCTTTGTCTCCCTGC
+HWUSI-EAS1795_0092:3:1:8558:1274#0/1
a[ZPWZPY[YYPXYQZY__KV[XIWP\W\_]Ia
@HWUSI-EAS1795_0092:3:1:8613:1275#0/1
CGCACCAGCAAGGACTTTATCGCCTATATGAAC
+HWUSI-EAS1795_0092:3:1:8613:1275#0/1
hhhhhhhfhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8775:1272#0/1
TGTGCATTCTGGGAAGTGTTAACTGATCCAGCA
+HWUSI-EAS1795_0092:3:1:8775:1272#0/1
gcgggagccfcffcffefdfffggcgggfggag
@HWUSI-EAS1795_0092:3:1:8946:1278#0/1
GGAAGGATTGCCCGATCTATCCCAGTACTTGGA
+HWUSI-EAS1795_0092:3:1:8946:1278#0/1
f]fcdfW^]adddWddRMVP]V^RYVY^a^a^Y
@HWUSI-EAS1795_0092:3:1:9255:1281#0/1
GTAATTTCTGTGATTTGCTTTTTTTGTGTTAGT
+HWUSI-EAS1795_0092:3:1:9255:1281#0/1
hhhhhhhhhhhhhghhaghfhgghhhhghfgcb
@HWUSI-EAS1795_0092:3:1:9690:1279#0/1
GCATTGCGCGTCGCCATGACGACAACGATGACC
+HWUSI-EAS1795_0092:3:1:9690:1279#0/1
ggggggfggaggfgggggdgggcggfefggcgg
@HWUSI-EAS1795_0092:3:1:9944:1274#0/1
CGGGGAGTCACGTAAGTCTTCGAGAAGACCGAG
+HWUSI-EAS1795_0092:3:1:9944:1274#0/1
ghfhhhhhhhhhhgfghhhfhf]cf_fhheg[h
@HWUSI-EAS1795_0092:3:1:10130:1274#0/1
TTACCACGATCCCCAGGATCATCAGGAGCAGCA
+HWUSI-EAS1795_0092:3:1:10130:1274#0/1
ghhhhhhhghhhhghhhhhhhghhhhhhghhfh
@HWUSI-EAS1795_0092:3:1:10629:1276#0/1
GTCAAATAAAAGTAAATTCAAGTTTATTCATCA
+HWUSI-EAS1795_0092:3:1:10629:1276#0/1
hhhhhhhhhhhhghhhhhhhhghghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10706:1276#0/1
GTTCATGGTGCAGAGCGTCCTGGCACCCATGGA
+HWUSI-EAS1795_0092:3:1:10706:1276#0/1
afdfcafcfcfffdfeeffffa_ecedgfgfff
@HWUSI-EAS1795_0092:3:1:11130:1272#0/1
CTCCGTCTTGGTCTTCAGGTTCTTCAGTTGCTC
+HWUSI-EAS1795_0092:3:1:11130:1272#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhfffff^
@HWUSI-EAS1795_0092:3:1:11147:1281#0/1
GACGGGCCTTGATCGCTTTGATGGTCATCTCGT
+HWUSI-EAS1795_0092:3:1:11147:1281#0/1
ggggggegggggggggggggcggggfggggggg
@HWUSI-EAS1795_0092:3:1:11198:1281#0/1
GCGGCTACACCCAAAATTATATCTTAATCCAAC
+HWUSI-EAS1795_0092:3:1:11198:1281#0/1
hhhhhhhhhhhhhhhhhhhheghhhhgghhhch
@HWUSI-EAS1795_0092:3:1:11437:1270#0/1
ATCACAAGCAGACATGCCAACAGCACAGAGTCA
+HWUSI-EAS1795_0092:3:1:11437:1270#0/1
ggggggggggfgdgfggfffdddgggggcggfg
@HWUSI-EAS1795_0092:3:1:11868:1272#0/1
GTCGGTTATGCCAGGCCTAGCCTTGCCCCAGGA
+HWUSI-EAS1795_0092:3:1:11868:1272#0/1
fdfffbffcdffddfff`bbce^bWddff_]cW
@HWUSI-EAS1795_0092:3:1:11924:1275#0/1
GTTGGACGAAATATTAACTGTTTCATTTAAAAT
+HWUSI-EAS1795_0092:3:1:11924:1275#0/1
hhhhhhhhhhhghhhhhhghhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12000:1280#0/1
ATGGACGCGAGCATGATGGATGGACTTGGCAAG
+HWUSI-EAS1795_0092:3:1:12000:1280#0/1
hhhhhhhhhhhhhhhfhggheghhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:12762:1272#0/1
GTTGTGGTCTTCGCCCCTGCTAACATCACCACT
+HWUSI-EAS1795_0092:3:1:12762:1272#0/1
hghahhghfchhhhhhhhhfghhhhhhfhhhhe
@HWUSI-EAS1795_0092:3:1:13385:1272#0/1
AGAAGAACCCCACCGTGCCCCGTTGCGGCCAGT
+HWUSI-EAS1795_0092:3:1:13385:1272#0/1
geggfggggggcggcfgfffdabbbdddff[dg
@HWUSI-EAS1795_0092:3:1:13528:1279#0/1
AGCTGGGCGCCAAGCTGAGCGACGATGAGAAGA
+HWUSI-EAS1795_0092:3:1:13528:1279#0/1
hhhhhhhhhhhhhhhhhhgheghhhhhfdhhef
@HWUSI-EAS1795_0092:3:1:13840:1276#0/1
TGTGTACAAAGGGCAGGGACGTAATCAATGCGA
+HWUSI-EAS1795_0092:3:1:13840:1276#0/1
hhhhhhgfhhhhhhhhhhghhhhhhhhffhhhg
@HWUSI-EAS1795_0092:3:1:13968:1273#0/1
GGTGGCGGCTGCGTTGGCGGCGACCTTAGCGGT
+HWUSI-EAS1795_0092:3:1:13968:1273#0/1
fcfffffffeccfcfff`bb[^^Z_[^]`]`bB
@HWUSI-EAS1795_0092:3:1:14543:1276#0/1
AAACCTGCTCGGTTGAATTGTCGGAACCATGGT
+HWUSI-EAS1795_0092:3:1:14543:1276#0/1
hhhhhghhhhhhhghhhhhhhhhchhhhhhhhd
@HWUSI-EAS1795_0092:3:1:14622:1272#0/1
AGAAGACCCTTTTGAGCTTGACTCTAATCTGGC
+HWUSI-EAS1795_0092:3:1:14622:1272#0/1
gggfacgggggggggfgggfggfgggggggggg
@HWUSI-EAS1795_0092:3:1:15686:1282#0/1
GGCAAATTAGATCCGTAACTTCGGGATAAGGAT
+HWUSI-EAS1795_0092:3:1:15686:1282#0/1
hghhhhhhhhgehhhhefhhhhhhhhhhgghgg
@HWUSI-EAS1795_0092:3:1:16287:1279#0/1
GCGGGAGAAATGACGAAGGGTATTTTTCGGGAA
+HWUSI-EAS1795_0092:3:1:16287:1279#0/1
gcggggggggagcffadfffbfgggegeggggg
@HWUSI-EAS1795_0092:3:1:16640:1274#0/1
GGCGAATTTATTTATGCCACTAAGCGTGGTATT
+HWUSI-EAS1795_0092:3:1:16640:1274#0/1
^a\aa]^fffccccYf\VUMTVaaaa[aa^^a^
@HWUSI-EAS1795_0092:3:1:16680:1273#0/1
CATCCGGGTGCAGCGTCAAAAGGCTGTGCTCCA
+HWUSI-EAS1795_0092:3:1:16680:1273#0/1
hfghhhhhgghfghhhhhghhhgffhhgfhhhg
@HWUSI-EAS1795_0092:3:1:16940:1279#0/1
GCGGATTGGTGCCGTGCACGTTTTTGGCCTCCT
+HWUSI-EAS1795_0092:3:1:16940:1279#0/1
ddabSaadYaddcc^acdcdccfff_]ff_fcf
@HWUSI-EAS1795_0092:3:1:17153:1279#0/1
TGGAATTTTGCTGTGCTGGTTTGAGGATCGCAG
+HWUSI-EAS1795_0092:3:1:17153:1279#0/1
hhhffhhhhhhhhhhhhhhhhhhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:17377:1273#0/1
AAGGTGTCCAAGGATAAGAGGGCCCTGAAGTTC
+HWUSI-EAS1795_0092:3:1:17377:1273#0/1
hhhhhhhhhhhhhhhhgghehhhhfhhgghhhh
@HWUSI-EAS1795_0092:3:1:17774:1281#0/1
CGGAAAGTTTGCGATTGGAAACGTTTAATAACC
+HWUSI-EAS1795_0092:3:1:17774:1281#0/1
ggggggggggggf_fffgggggfggggccgggg
@HWUSI-EAS1795_0092:3:1:18000:1276#0/1
GCCCGGTAAACGGCGATAATTATGCTAGCTGCT
+HWUSI-EAS1795_0092:3:1:18000:1276#0/1
hhhhhhhhhhghhhhhhhhdhhehgghhghhhh
@HWUSI-EAS1795_0092:3:1:18780:1272#0/1
ATCGCAGACCATCTGTTTCCTGGCGAGCAGGCG
+HWUSI-EAS1795_0092:3:1:18780:1272#0/1
ggeggfgggcaaffdcffffdagggeg_Rc_fd
@HWUSI-EAS1795_0092:3:1:19094:1279#0/1
GGCCAAGAAGCCCGAGTCCGAATCAGAGGAGGA
+HWUSI-EAS1795_0092:3:1:19094:1279#0/1
hhhhhhhghhhhhhhhghhhfhghghgfffhgf
@HWUSI-EAS1795_0092:3:1:19466:1272#0/1
GATGATATGAGTCCTCGTGCTCCCTGCCAGGAC
+HWUSI-EAS1795_0092:3:1:19466:1272#0/1
hfhghghhghhhhhhhhhfhchffccfhheedh
@HWUSI-EAS1795_0092:3:1:1688:1284#0/1
GGAAGTGCGAGATGATCACACAGTCAATGTGGC
+HWUSI-EAS1795_0092:3:1:1688:1284#0/1
ab_a\[aXccacacc]]^^aL\a]X^Pa^\aaW
@HWUSI-EAS1795_0092:3:1:3028:1291#0/1
TTAGCTAACTCTGCCCGTCTCCCTCTATCTCGA
+HWUSI-EAS1795_0092:3:1:3028:1291#0/1
gefdfafffff[fffcfgfacgffcf]affffg
@HWUSI-EAS1795_0092:3:1:3361:1292#0/1
GTCCACCCTTCACTTGGTCCTTCGTCTCCGTGG
+HWUSI-EAS1795_0092:3:1:3361:1292#0/1
gggggfgggggdfggegggeggdggfgggggfg
@HWUSI-EAS1795_0092:3:1:4324:1284#0/1
CAAGGCCAAGCGCGAGGAGGCCAAGCGCCGCCG
+HWUSI-EAS1795_0092:3:1:4324:1284#0/1
ccaOZcc`aV]`aO]a^BBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5344:1289#0/1
AAATAGACAACCGGATACGCGTGATGATCGAGA
+HWUSI-EAS1795_0092:3:1:5344:1289#0/1
ggggggggggggggfcgaffffgfggafcgfgg
@HWUSI-EAS1795_0092:3:1:5723:1291#0/1
TCTTGGGGTCGTAGGGCAACATGACCTTGACCT
+HWUSI-EAS1795_0092:3:1:5723:1291#0/1
ff[_fffggffggfgg[ff]fffffcfg_ggag
@HWUSI-EAS1795_0092:3:1:5892:1285#0/1
GGTTCCAATTCCGTAACCTGTTGAGTATCCGTT
+HWUSI-EAS1795_0092:3:1:5892:1285#0/1
hhghhhhhhghhhhhhhhhhhfgchdhhhghhh
@HWUSI-EAS1795_0092:3:1:6627:1286#0/1
GTTGGAATACAAAGAGACAGAACTCAGTAGCAG
+HWUSI-EAS1795_0092:3:1:6627:1286#0/1
gggggggggggffcdffggfggggfgggggagg
@HWUSI-EAS1795_0092:3:1:6734:1290#0/1
CGTTTACAAATGTGTATTCCGACCACGTTACAA
+HWUSI-EAS1795_0092:3:1:6734:1290#0/1
hhhhhhhhhhhhhghghhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:7282:1289#0/1
GTGCAGACCTCCTTAAGGCGATAGTCCTCGTCC
+HWUSI-EAS1795_0092:3:1:7282:1289#0/1
hhfhhhhhhhhhhhhhhhhhhhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:7589:1290#0/1
ATCCAGAATGTTTATGCCAAAGGCCCATCGTGT
+HWUSI-EAS1795_0092:3:1:7589:1290#0/1
`Xdadadfff]WW\MYZ^ccc^]cdb^RUUPTX
@HWUSI-EAS1795_0092:3:1:8438:1285#0/1
GGGCGGTCCAATGCTCTCGAGATTTATTTAAAA
+HWUSI-EAS1795_0092:3:1:8438:1285#0/1
hhhhhhhhhhhhhhghhghggchhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8478:1291#0/1
CGCCGCCTGAGATTAACACGCTTCCGCTACCCA
+HWUSI-EAS1795_0092:3:1:8478:1291#0/1
ccc[c]^NTQ[XVS]ZYccO]aZ``]ZV][]Z]
@HWUSI-EAS1795_0092:3:1:8505:1289#0/1
GGAGATGGCGCAGAAGGTGCACGCCTGGGCGCC
+HWUSI-EAS1795_0092:3:1:8505:1289#0/1
Vfdffafdafffd[fff[fffYc^a_df[_ffc
@HWUSI-EAS1795_0092:3:1:8741:1288#0/1
TCCGAGTAGGTGGTGAAGGTCTGGGTCTGCTTG
+HWUSI-EAS1795_0092:3:1:8741:1288#0/1
hhhhhhhhhhhhhghhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8886:1294#0/1
GTTTTGTAATTTGAAAATGAATAGAATTGTATA
+HWUSI-EAS1795_0092:3:1:8886:1294#0/1
hhhhhhhhhhhhhhhhghhehagfhhhhhgcfh
@HWUSI-EAS1795_0092:3:1:9587:1286#0/1
GCCGGACTCGTCGTACTCCTGCTTGGAGATCCA
+HWUSI-EAS1795_0092:3:1:9587:1286#0/1
hhhhhhhhhhhhhhhhhhhghchhhhhhhghhf
@HWUSI-EAS1795_0092:3:1:9950:1291#0/1
GCTCTCTTTTGCTCTTTCCCCCGCTGGACGACA
+HWUSI-EAS1795_0092:3:1:9950:1291#0/1
hhhhhhhhhhghhfhhhhhhhhhhehhhfhhhh
@HWUSI-EAS1795_0092:3:1:10603:1291#0/1
GTCGGTTCTCACAGAGCATCCTCGCGTGGCTGA
+HWUSI-EAS1795_0092:3:1:10603:1291#0/1
fggcgcgaafafgg_dYffff_fdffbggeggg
@HWUSI-EAS1795_0092:3:1:10881:1292#0/1
TGGTGTTGGGTGCTTCAAAAAACATTATAGCCA
+HWUSI-EAS1795_0092:3:1:10881:1292#0/1
fgfdffffffffggggggfggfgcggggfggeg
@HWUSI-EAS1795_0092:3:1:12211:1282#0/1
CCGGCATTGTCCTCAAAGTATATAAACACCCCG
+HWUSI-EAS1795_0092:3:1:12211:1282#0/1
hhhhhhhhhhhhhhhhheffhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12271:1293#0/1
GTCGGCTTCTGTTCATGGTTGTTAAGTTAAGTT
+HWUSI-EAS1795_0092:3:1:12271:1293#0/1
hhhhhhhhhhhhhffhhghhehhhhhgghhfhh
@HWUSI-EAS1795_0092:3:1:12792:1288#0/1
GTTGATCAGGAATTTCACATCCATACCCAGAGT
+HWUSI-EAS1795_0092:3:1:12792:1288#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghd
@HWUSI-EAS1795_0092:3:1:12993:1293#0/1
TGCCACCAAGAAGCAGGAGCTCATCGCCCTGCA
+HWUSI-EAS1795_0092:3:1:12993:1293#0/1
hhhhhhhhhghhghhhacfhghhchhhhhfhhf
@HWUSI-EAS1795_0092:3:1:13723:1293#0/1
GTTTAAACATCAATATGCTCCTTATTGTACTGC
+HWUSI-EAS1795_0092:3:1:13723:1293#0/1
chchhhedhhhhhghhhhhhdhfhhhcecffgc
@HWUSI-EAS1795_0092:3:1:13927:1286#0/1
TATGATTCCACCGTCAATACGTTCGTACTTGTA
+HWUSI-EAS1795_0092:3:1:13927:1286#0/1
g\gggggggggfggggggggggggcgggggggg
@HWUSI-EAS1795_0092:3:1:14200:1284#0/1
CAAACACTTGTGCTGTAACTACGATGACAACGG
+HWUSI-EAS1795_0092:3:1:14200:1284#0/1
hhhhhhhhhghhhhghhhhhhhhhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:15083:1290#0/1
CGGACTCGTCGTACTCCTGCTTGGAGATCCACA
+HWUSI-EAS1795_0092:3:1:15083:1290#0/1
dfffadaa`aR`e`bfddWfcfbWb`bPa^^^Z
@HWUSI-EAS1795_0092:3:1:15752:1291#0/1
TATTGCAATAACTTAGCGTAATTTAAACAAGAT
+HWUSI-EAS1795_0092:3:1:15752:1291#0/1
hhhggghhhhhhhfhhhhhhhhhhhhhhhhehh
@HWUSI-EAS1795_0092:3:1:15943:1282#0/1
GTTTCGGTGTTAGCATCAATCAAGAGTTCCATT
+HWUSI-EAS1795_0092:3:1:15943:1282#0/1
ghhhhghhhhhghhhghhhgggh_hhhfhgdhh
@HWUSI-EAS1795_0092:3:1:16101:1290#0/1
GCGGATTTCGACTTCCATGATCACCGTCCTGCT
+HWUSI-EAS1795_0092:3:1:16101:1290#0/1
cc^X]aa^aV^^cacc_ZVW]a\cacbcccWcc
@HWUSI-EAS1795_0092:3:1:16778:1289#0/1
CCTCCTCCTCCTCTTCGAAGAGCAATTCCTTGA
+HWUSI-EAS1795_0092:3:1:16778:1289#0/1
f_gggggggggffgggggggagggggggggegg
@HWUSI-EAS1795_0092:3:1:17214:1283#0/1
CGATGGCATAGGGCTTGCTTGAGGGCTCGCTCG
+HWUSI-EAS1795_0092:3:1:17214:1283#0/1
dac^cccffcffff_fffff_Y\ZW_Zffffaf
@HWUSI-EAS1795_0092:3:1:17494:1292#0/1
CTCCCTTCGATGTGCGAACGGCGTTCTCGGCGG
+HWUSI-EAS1795_0092:3:1:17494:1292#0/1
gfggggggeggggggggfgggafeffdggggcg
@HWUSI-EAS1795_0092:3:1:17612:1283#0/1
GTTGTATTGAAGGAATCTTAATGCATCTTAAAC
+HWUSI-EAS1795_0092:3:1:17612:1283#0/1
dacebece]cdccfdfeffffaf_faffcffff
@HWUSI-EAS1795_0092:3:1:19375:1287#0/1
GGCCAATGTTCTTGCTGGTCACCTTCTCGGGAT
+HWUSI-EAS1795_0092:3:1:19375:1287#0/1
affff^fcddedeeccf\eedeffcfcffef[`
@HWUSI-EAS1795_0092:3:1:19540:1283#0/1
GAAGAACTTCGCGATGACAACCGCCTTGAGCCT
+HWUSI-EAS1795_0092:3:1:19540:1283#0/1
gfgggggggggggfdcffffffggggggggggg
@HWUSI-EAS1795_0092:3:1:2430:1297#0/1
GATCAAGATCTCAAGCTGGGCGACACTCTGCGC
+HWUSI-EAS1795_0092:3:1:2430:1297#0/1
hhhghhhhfffhffffdhhhhghhhggheehhg
@HWUSI-EAS1795_0092:3:1:2469:1301#0/1
ATTTACTATTGCAGACTCAATTTATGGATCAAC
+HWUSI-EAS1795_0092:3:1:2469:1301#0/1
\ffccffffc_YeRadd^\]]_ffff[afcffd
@HWUSI-EAS1795_0092:3:1:2528:1306#0/1
CTGCACATGGCACTGGCGCCATTCGTCGCACAC
+HWUSI-EAS1795_0092:3:1:2528:1306#0/1
ffdffffdfdfffedffggggggg_gggggggg
@HWUSI-EAS1795_0092:3:1:2795:1295#0/1
GCAGGTTCTTCAGCTTCTTCAGGGAACGGCGGG
+HWUSI-EAS1795_0092:3:1:2795:1295#0/1
ghghfghhhhhhhhhhhhghhhhhhhhhghgh`
@HWUSI-EAS1795_0092:3:1:2831:1302#0/1
GTTCCAATTCCGTAACCTGTTGAGTATCCGTTT
+HWUSI-EAS1795_0092:3:1:2831:1302#0/1
ggggdggggggggfgggggfgdggggggdgggg
@HWUSI-EAS1795_0092:3:1:2995:1298#0/1
GGTCAAGACCGGTCGCCAGATGCTCGGCGCCAC
+HWUSI-EAS1795_0092:3:1:2995:1298#0/1
eeaffffaeaeddff\fbffWbeK[a`dfff_f
@HWUSI-EAS1795_0092:3:1:3117:1305#0/1
CAGATCTCAGGACCCAGTGCAGCCGAAACCAAA
+HWUSI-EAS1795_0092:3:1:3117:1305#0/1
hhfhhhhhhhhhhhhhhhhchhhgghhhhghhe
@HWUSI-EAS1795_0092:3:1:3283:1303#0/1
GTTTGATGATGGATCATTTAAAAGTGTTTTTGT
+HWUSI-EAS1795_0092:3:1:3283:1303#0/1
hhhhghhhhhhhhhghhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:3504:1298#0/1
AAACAACAAAAAAGGTATAAAAGTTATTCATTA
+HWUSI-EAS1795_0092:3:1:3504:1298#0/1
^Y\Z\XU^_]^^`]db]aZ^\WWY^a^d]dbbd
@HWUSI-EAS1795_0092:3:1:3528:1301#0/1
GTTTATTTGACCACCAGCTCTTGGACTACATGG
+HWUSI-EAS1795_0092:3:1:3528:1301#0/1
fggegfcggggdgggggggacgdffffgdacgg
@HWUSI-EAS1795_0092:3:1:3892:1304#0/1
TCCAGTTGTTGTAGTTTCTCAGTGACTGCCAAA
+HWUSI-EAS1795_0092:3:1:3892:1304#0/1
gggggggcggggaafafcfffcadfcfgggggg
@HWUSI-EAS1795_0092:3:1:3959:1306#0/1
CGCTGAACCCCAAGGCCAACCGTGAGAAGATGA
+HWUSI-EAS1795_0092:3:1:3959:1306#0/1
fffdfffggggaaaadaffcfffcffffggfgg
@HWUSI-EAS1795_0092:3:1:4077:1303#0/1
CTGCGATCTATTCGCTCTGCCAGGTGGGTGAAT
+HWUSI-EAS1795_0092:3:1:4077:1303#0/1
gfggggggggggQffffgggggggeggfcfffg
@HWUSI-EAS1795_0092:3:1:4256:1299#0/1
TAATGATGGAACCATCTAATTGAATGCTCCGCT
+HWUSI-EAS1795_0092:3:1:4256:1299#0/1
ggggfgggdgggggggggggfggggggafffdf
@HWUSI-EAS1795_0092:3:1:4788:1295#0/1
CTGCTGTTTCGCTTTCCCTACTCTCATTCGGGT
+HWUSI-EAS1795_0092:3:1:4788:1295#0/1
ffdggagggggggggggggggfddfffdedffc
@HWUSI-EAS1795_0092:3:1:5194:1302#0/1
GGTGTTGGGATGGATGCGACCCTCGAAGTTTCG
+HWUSI-EAS1795_0092:3:1:5194:1302#0/1
hhhhhghhhfhghchhcfdhghfhhhghhghgh
@HWUSI-EAS1795_0092:3:1:5548:1300#0/1
GGGAAAGGTTGACATCTCGACCAGTAGAGTGGC
+HWUSI-EAS1795_0092:3:1:5548:1300#0/1
ffcfddfgggggggggaggggfggfgfad^aac
@HWUSI-EAS1795_0092:3:1:5666:1298#0/1
CATTGGTCTCGGTGTGCTTCAACTTTTTCGCAT
+HWUSI-EAS1795_0092:3:1:5666:1298#0/1
hhhhehhhhhhhhghghhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:6248:1297#0/1
ATGGGACATGTGCTTTTATTAGGCTAAAACCAA
+HWUSI-EAS1795_0092:3:1:6248:1297#0/1
hhhhhhhhhhhfhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6295:1302#0/1
GAGGCCCAGGAGATGGGAAAGGGATCCTTCAAG
+HWUSI-EAS1795_0092:3:1:6295:1302#0/1
g_ggdgffggdggcgfgaffcd]faffgggad_
@HWUSI-EAS1795_0092:3:1:7062:1300#0/1
TCGATGCCGACATCTTCGACAAGCTGGAGGAGC
+HWUSI-EAS1795_0092:3:1:7062:1300#0/1
fhhhghhhhhfhhhhhhhhhhhghhhchhch]h
@HWUSI-EAS1795_0092:3:1:7135:1298#0/1
CAAGAACCAGCAGACCACCATTGAACACAAAGT
+HWUSI-EAS1795_0092:3:1:7135:1298#0/1
deefcfffaaffgfggffgggg_ccfffffaea
@HWUSI-EAS1795_0092:3:1:7502:1298#0/1
TATGGGCCTCGTGCTCATCCTGGCAACAGGAAC
+HWUSI-EAS1795_0092:3:1:7502:1298#0/1
hghhghhhhhhhghhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7633:1301#0/1
TCTTGCGCTTGGCGTGCTCGGTGTAGGTGACAG
+HWUSI-EAS1795_0092:3:1:7633:1301#0/1
hhhhhhhhhhhhhhhhhhhghghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:8372:1299#0/1
CGCTGGTATTGTTCTTCCAGATATCGTCGATAT
+HWUSI-EAS1795_0092:3:1:8372:1299#0/1
hhhhghhhhhfhhhhhhhhhhcghhfhhhhefh
@HWUSI-EAS1795_0092:3:1:9259:1304#0/1
GCAAGTAGTCTCAAAGTGCGTGGTCGCATCGTA
+HWUSI-EAS1795_0092:3:1:9259:1304#0/1
ggggggeccfffcfff`fdffdf_ffffdffcf
@HWUSI-EAS1795_0092:3:1:9715:1301#0/1
CCTTGGTATGTTCCTTCTCGTGATACATCTCGT
+HWUSI-EAS1795_0092:3:1:9715:1301#0/1
hhghhhhheehhhghhhghhehhghhhghfhfh
@HWUSI-EAS1795_0092:3:1:9798:1299#0/1
GGAAAAAATAGTGCAAAAAATTTACAATACGCT
+HWUSI-EAS1795_0092:3:1:9798:1299#0/1
hhhhhhhhhhfhhhhhhhhghghhghhghhhhh
@HWUSI-EAS1795_0092:3:1:10468:1299#0/1
AGAACCAGGACCACCGACTCTTGCTCTGAGCGG
+HWUSI-EAS1795_0092:3:1:10468:1299#0/1
hghhhhhfhhhhhhhghhggehggdg]ababbc
@HWUSI-EAS1795_0092:3:1:11741:1298#0/1
ATGTCTCCTTACACTGCCAGATTAGAGTCAAGC
+HWUSI-EAS1795_0092:3:1:11741:1298#0/1
haghhhhhhghhhhhhhhhgghghhhfhhhfhh
@HWUSI-EAS1795_0092:3:1:13309:1301#0/1
ATTTAGGCTTCTGCACATCATGCGGGCGGAACA
+HWUSI-EAS1795_0092:3:1:13309:1301#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhhfggchg
@HWUSI-EAS1795_0092:3:1:13502:1298#0/1
CGCCCCCTCAAAAATAACGTCTATAATTAAAAA
+HWUSI-EAS1795_0092:3:1:13502:1298#0/1
hhhhhhhhhhhhhhdhhhhhghfhhhgghhhhh
@HWUSI-EAS1795_0092:3:1:13598:1303#0/1
CTCACATCTACGCCAGCTTCAACGACACCTTCG
+HWUSI-EAS1795_0092:3:1:13598:1303#0/1
hhhghhghhhhghhfhhchhfhhffhhhfgehh
@HWUSI-EAS1795_0092:3:1:13961:1303#0/1
CGGCGAATAACGACGACGACCCAGTCCCAGGGT
+HWUSI-EAS1795_0092:3:1:13961:1303#0/1
ac^[aac_acTccVaPP]T_\OGSQTTVV`]^B
@HWUSI-EAS1795_0092:3:1:14119:1304#0/1
GGGAGCGGGATGACGCACCGCTGACCAGCGACG
+HWUSI-EAS1795_0092:3:1:14119:1304#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhgefdeh
@HWUSI-EAS1795_0092:3:1:14965:1295#0/1
GACACACCAACAACCTGCGCCCCAAGAAGAAGT
+HWUSI-EAS1795_0092:3:1:14965:1295#0/1
hhhhhhhhhhhhhhhhhhfhhhhhhhhfgghhh
@HWUSI-EAS1795_0092:3:1:15099:1299#0/1
AAGTGAGCAGCCCAACGTCGAAACTCGAACGGC
+HWUSI-EAS1795_0092:3:1:15099:1299#0/1
ccfbcafffcfff]fafff]cdccafdcacbff
@HWUSI-EAS1795_0092:3:1:17101:1303#0/1
GGAGGCGGCTAAGCGTGATCACCGCAAAATCGG
+HWUSI-EAS1795_0092:3:1:17101:1303#0/1
ggggggggfgfgdffaf_^accggggfgggggg
@HWUSI-EAS1795_0092:3:1:17264:1295#0/1
CTTGGCTTTCAACCAGATCTTGGCTTCCTGCCA
+HWUSI-EAS1795_0092:3:1:17264:1295#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17338:1301#0/1
CGGAGATTTAAACAAAACTAGTGCTTTAACAAA
+HWUSI-EAS1795_0092:3:1:17338:1301#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhghhgh
@HWUSI-EAS1795_0092:3:1:17819:1306#0/1
GCTGAAGCCCGGTACCGTTGTGGTCTTCGCCCC
+HWUSI-EAS1795_0092:3:1:17819:1306#0/1
fdfffffhggfhghhhgdhhag_dfddhfhhhg
@HWUSI-EAS1795_0092:3:1:18072:1299#0/1
TCTTAATCGGTTGGCCAAAATACTGAAAAAGCG
+HWUSI-EAS1795_0092:3:1:18072:1299#0/1
ggggggggggggfffffcggg_gggggfgggfg
@HWUSI-EAS1795_0092:3:1:18190:1298#0/1
CCCAGTTGTGATCCTGCACAGACATCTCCCTCG
+HWUSI-EAS1795_0092:3:1:18190:1298#0/1
hhhhhhhghhhhhhhhhghhgfhffhghhhghh
@HWUSI-EAS1795_0092:3:1:18350:1300#0/1
GCGACTACAAGGCCAACGGCATCAAGTGGGTGG
+HWUSI-EAS1795_0092:3:1:18350:1300#0/1
ggggfgggggedggggdgfgfgffefaffebfg
@HWUSI-EAS1795_0092:3:1:18399:1305#0/1
AAAAGTTCGGTGTGCGCAGCTACTCGGCCAAGA
+HWUSI-EAS1795_0092:3:1:18399:1305#0/1
hhhhhhhhhhghhhhhhfhhhhhhhgghhhhhe
@HWUSI-EAS1795_0092:3:1:18527:1302#0/1
CGAGGAGCGAATTCTGGGACGCAAGAAGCTGCG
+HWUSI-EAS1795_0092:3:1:18527:1302#0/1
ggggcggggggfgecgadafcfggcgWccaccd
@HWUSI-EAS1795_0092:3:1:19654:1302#0/1
AAACAAGTCCACCAGCTCGTCGACAGGCTGATT
+HWUSI-EAS1795_0092:3:1:19654:1302#0/1
f_ddd``^cdac_ZX`IVSXSVa^^^Oa^Z^af
@HWUSI-EAS1795_0092:3:1:1876:1315#0/1
GATAGAACTGCATAGCATTCGCATTGATGCCGA
+HWUSI-EAS1795_0092:3:1:1876:1315#0/1
dcdfafffdf[d]ccee^aa^acffcfgggggW
@HWUSI-EAS1795_0092:3:1:2717:1308#0/1
TGGCCTTCTTCCTGAAGATGGGCTTGGTCTGAC
+HWUSI-EAS1795_0092:3:1:2717:1308#0/1
gggdgaggfggggegc_f]fffgggcegggfff
@HWUSI-EAS1795_0092:3:1:3099:1308#0/1
CTTTGACAACCGGCTAGTCACCCACCTGGCGGA
+HWUSI-EAS1795_0092:3:1:3099:1308#0/1
hgcgghhhhddffhdhhhcfhffffccaafacf
@HWUSI-EAS1795_0092:3:1:3372:1310#0/1
GCAAAATGTCGAAGAGAGGACGTGGAGGTACCG
+HWUSI-EAS1795_0092:3:1:3372:1310#0/1
fWffffdffffdd[[f[ca^ac^dd[b^^Radd
@HWUSI-EAS1795_0092:3:1:4020:1307#0/1
GCAGGAGCGCGCCCAGATTTCGTTGCTGGTGCA
+HWUSI-EAS1795_0092:3:1:4020:1307#0/1
fScfdfff]fc]f]ebR````a]dabdff]ffd
@HWUSI-EAS1795_0092:3:1:4112:1314#0/1
CGATAAGTAGAGGACTCGTTCCGGGAGATGCCC
+HWUSI-EAS1795_0092:3:1:4112:1314#0/1
hhhhhhhchhhhgghhhhhhhhhghhhhgfhhh
@HWUSI-EAS1795_0092:3:1:4669:1311#0/1
ATGACTTGCCGTTAAAGGCAGATACGGAAAAAC
+HWUSI-EAS1795_0092:3:1:4669:1311#0/1
hhhhhhgghhhhhhggahchgaahhhhhghhhh
@HWUSI-EAS1795_0092:3:1:4825:1315#0/1
CACAACACAACACAACACAACACAACACAACAC
+HWUSI-EAS1795_0092:3:1:4825:1315#0/1
hghghhhhhhhhghfhhhhhchfhhhhehgagg
@HWUSI-EAS1795_0092:3:1:5279:1307#0/1
GGATTGGATTCCTCACGGGGGACGCGGGCGGAC
+HWUSI-EAS1795_0092:3:1:5279:1307#0/1
fggffggggggggaggcffffaff\fffdffIc
@HWUSI-EAS1795_0092:3:1:5322:1306#0/1
CCAGATCTTACGGGCCTCAGTCACATCGTAGTC
+HWUSI-EAS1795_0092:3:1:5322:1306#0/1
hhhgfghhhghhhgggghhfghhhdghhhhhhe
@HWUSI-EAS1795_0092:3:1:5388:1309#0/1
CTTCTTTATGGTCGTTCCTGTTGCCAGGATGAG
+HWUSI-EAS1795_0092:3:1:5388:1309#0/1
gggggggfgggggggggfggggaggfgg_dg_f
@HWUSI-EAS1795_0092:3:1:6099:1313#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6099:1313#0/1
fffffffdbfWd^`^^b`^a`aRdedefffdcg
@HWUSI-EAS1795_0092:3:1:6231:1313#0/1
GGGGATTTGGCCAACGGGGAGATCGCCTTGACG
+HWUSI-EAS1795_0092:3:1:6231:1313#0/1
hhhhhhhhhhhghhhhhhhghhehhhghhhhcd
@HWUSI-EAS1795_0092:3:1:6738:1309#0/1
GTGATTCCGATCTCACGGATAAAGTCCAGCTTC
+HWUSI-EAS1795_0092:3:1:6738:1309#0/1
a^cdeeeffdf]cfa_c[badd_]`edabadd`
@HWUSI-EAS1795_0092:3:1:7326:1307#0/1
AAGATCCAGATCATCCTGGTCCGCGAGCTGGAG
+HWUSI-EAS1795_0092:3:1:7326:1307#0/1
hhhhhhhhhhhhhehhhhgghhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7488:1314#0/1
CGTGCAACGACTATGTCGAGACCGCCACCCGTC
+HWUSI-EAS1795_0092:3:1:7488:1314#0/1
^cc^\adecddabcedecaaccdcdffggg`gf
@HWUSI-EAS1795_0092:3:1:8162:1306#0/1
GTCGTAGATGAGGGCAAAGCCGGTGGAGCGGCC
+HWUSI-EAS1795_0092:3:1:8162:1306#0/1
gfffafdfffffceaffgdfdgfacca_^bbbe
@HWUSI-EAS1795_0092:3:1:8502:1315#0/1
CTAGCGACGTCGAAATTCCCAAGTCCTATGAGG
+HWUSI-EAS1795_0092:3:1:8502:1315#0/1
hhhghghhhhhghhhhhhhhhhggghhhhhfhg
@HWUSI-EAS1795_0092:3:1:8841:1312#0/1
GCTTAAAGTACGAGTTCAAGTCCTTTGAGACGC
+HWUSI-EAS1795_0092:3:1:8841:1312#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8983:1306#0/1
TATCACCATCGATATCGCCCTGTGGAAGTTCGA
+HWUSI-EAS1795_0092:3:1:8983:1306#0/1
hhhhhhhhhhhhhhghhhhhhfhhghhghhhhh
@HWUSI-EAS1795_0092:3:1:9314:1311#0/1
CGGTGAGGTGCGCGAAAGTCAGATTTAGATGGG
+HWUSI-EAS1795_0092:3:1:9314:1311#0/1
hhhhghhhhhhhhhhhhhhhhgfhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:9427:1306#0/1
CCGATGACTTCGAGAAGTCCATTGCCCAGGCGT
+HWUSI-EAS1795_0092:3:1:9427:1306#0/1
hhghhhghhhehdghhhhhhhghghghhhhhgh
@HWUSI-EAS1795_0092:3:1:9727:1317#0/1
CAGCAGCAACACCATCAACAGCCCCCAACAAAA
+HWUSI-EAS1795_0092:3:1:9727:1317#0/1
gggggfgggagggggdgggfggggggggggggg
@HWUSI-EAS1795_0092:3:1:10121:1313#0/1
GTCGGCATGGGCCAGAAGGACTCGTACGTGGGG
+HWUSI-EAS1795_0092:3:1:10121:1313#0/1
a\\ZZZaZZWa^a\\_cWZ_\OY]Q\aBBBBBB
@HWUSI-EAS1795_0092:3:1:10209:1311#0/1
TGGGCTTTCTTCTCCGGGTTCAACGTGCAGGGA
+HWUSI-EAS1795_0092:3:1:10209:1311#0/1
hhhhhhhhhhhhghhhhhhhhhhh[hghhhhhg
@HWUSI-EAS1795_0092:3:1:10251:1313#0/1
ATGACGAACTGGAGCTGGAGCTAGAGTTCGAAC
+HWUSI-EAS1795_0092:3:1:10251:1313#0/1
fhgghhhghhhehhhhhfghhhhdhhQfffffe
@HWUSI-EAS1795_0092:3:1:10615:1311#0/1
CGCTGATTTGAATGACGAGAAAATCAACAAATT
+HWUSI-EAS1795_0092:3:1:10615:1311#0/1
hhhhhhhhhhhhehhhhadhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10745:1312#0/1
CTGGCTTGTTGTTGGTTCTAAATTGATTATCTC
+HWUSI-EAS1795_0092:3:1:10745:1312#0/1
hhhhhhhghhhhghghhhhhhhggchhhhgghg
@HWUSI-EAS1795_0092:3:1:10840:1307#0/1
CGCTCTTGCTCTTGTCCAGGGCAACGCTCTCGA
+HWUSI-EAS1795_0092:3:1:10840:1307#0/1
hhhhhghhhhhhhhhhhghhhghhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:11302:1314#0/1
GGTGTCGATGCTGCTGGCACTGCCGCTGAGTTG
+HWUSI-EAS1795_0092:3:1:11302:1314#0/1
fadfffff[f_f_fcffgcgagecfggfggeaf
@HWUSI-EAS1795_0092:3:1:11831:1314#0/1
GCGTTACCCTCCTTGCGCTCCACCTTCCATCCC
+HWUSI-EAS1795_0092:3:1:11831:1314#0/1
ggggggggggggggSggfegggggggggcgggg
@HWUSI-EAS1795_0092:3:1:12067:1311#0/1
ATCGAGATAAACATGATTTCCCCACTTACGCCG
+HWUSI-EAS1795_0092:3:1:12067:1311#0/1
hghhhhhghhhghdhhhhhhhhhhhghhhhhhg
@HWUSI-EAS1795_0092:3:1:12109:1313#0/1
GTTGATGACGGCCCAGGGGCATTCCGTTGCTTC
+HWUSI-EAS1795_0092:3:1:12109:1313#0/1
hhhghhhhhhggghhghhghhghhhhhhhfhhg
@HWUSI-EAS1795_0092:3:1:12448:1309#0/1
CGCCCAGCACCATCGAGCTGCCGCCGCCGGAAA
+HWUSI-EAS1795_0092:3:1:12448:1309#0/1
hhhhhhhhfhhghhhfghhhhhchhch_fc_ch
@HWUSI-EAS1795_0092:3:1:12721:1316#0/1
TTCATCTGGAAACGCAAGTATCGACGACCTCGA
+HWUSI-EAS1795_0092:3:1:12721:1316#0/1
gggcgdggggggggfggddcffffadfggfcgg
@HWUSI-EAS1795_0092:3:1:12953:1308#0/1
ACCAAATACGAACGTGAGCGTTATGAAGAACTT
+HWUSI-EAS1795_0092:3:1:12953:1308#0/1
hhhhghghhhhhhhhhgchhhghhghfgghhhh
@HWUSI-EAS1795_0092:3:1:13161:1310#0/1
GTACCATCTTAGAAATGTACATCATTAGAGGAC
+HWUSI-EAS1795_0092:3:1:13161:1310#0/1
hhhhhhhghhghhhhhhhhfhhhhhghghhchh
@HWUSI-EAS1795_0092:3:1:13406:1307#0/1
CGGGGATGTGGTGGAGTCAGCCTGAGAGCTCGA
+HWUSI-EAS1795_0092:3:1:13406:1307#0/1
gegdgggebde_fdWd`ffdff[e]dcgedgeg
@HWUSI-EAS1795_0092:3:1:13544:1313#0/1
CTTGTACTTGTTGACCACCGCGATGCCGTTCTC
+HWUSI-EAS1795_0092:3:1:13544:1313#0/1
hhhhhhhhhghhghhhhhhghhghhhhghhhfh
@HWUSI-EAS1795_0092:3:1:13570:1316#0/1
GTGAGCTGCTCGATGTTGAGCTTGCCCTGCTGC
+HWUSI-EAS1795_0092:3:1:13570:1316#0/1
]fcfac_d^ae`cffffffff_Yaaaa[ce_eY
@HWUSI-EAS1795_0092:3:1:13633:1315#0/1
TTGCAATGTTGCCACTGTTCTGCGGTGCCGTTG
+HWUSI-EAS1795_0092:3:1:13633:1315#0/1
gggdfagfddfa^dedcdffffffac]edddea
@HWUSI-EAS1795_0092:3:1:13711:1312#0/1
CCGAACTTAATCACTTAACTTTCAATTGGTATT
+HWUSI-EAS1795_0092:3:1:13711:1312#0/1
hhhhhhhhhhhhhhghhhhchhhhhhhhchghd
@HWUSI-EAS1795_0092:3:1:13885:1306#0/1
GGGGACGTAATCAATGCGAGTTAATGACTCACA
+HWUSI-EAS1795_0092:3:1:13885:1306#0/1
gggdgeggggggggfggggfeggfgagggggge
@HWUSI-EAS1795_0092:3:1:14058:1312#0/1
GCGTTTTTTGAGCCTCCACCTTTCGCCTGGACT
+HWUSI-EAS1795_0092:3:1:14058:1312#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:14981:1312#0/1
ATCCAATTGCTTGGTGAGTTCCTTCTTGTCCTT
+HWUSI-EAS1795_0092:3:1:14981:1312#0/1
gggfcgdgaggcegggggggggggfgccdfffg
@HWUSI-EAS1795_0092:3:1:15673:1308#0/1
TTCACTTTGATCAACATTTTGTGTGTATTTAAC
+HWUSI-EAS1795_0092:3:1:15673:1308#0/1
hhhhhhhhhehhhhghhhhhfhcghhhhhhhhf
@HWUSI-EAS1795_0092:3:1:16034:1309#0/1
GCCGGACCAGGAGAAGTACTGGGTGACCAGCTT
+HWUSI-EAS1795_0092:3:1:16034:1309#0/1
fff]fffdSd_a]`dd`ffffffe_[ffddccc
@HWUSI-EAS1795_0092:3:1:16283:1310#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16283:1310#0/1
hfhghhhhhhhhhhhhheghggfghhhacfffc
@HWUSI-EAS1795_0092:3:1:16681:1310#0/1
CGATCTGTCGCGTCTGCTCAAGTCTGAGGAGAT
+HWUSI-EAS1795_0092:3:1:16681:1310#0/1
ffffff]fffaaff[W[Oa]`Zbdb^dffddcd
@HWUSI-EAS1795_0092:3:1:17478:1309#0/1
GGATAAAGTCCGAGGGCGATCGTCTCCAGCACA
+HWUSI-EAS1795_0092:3:1:17478:1309#0/1
hhfehhhhhhhhfhghhhfgghhhghghhgghd
@HWUSI-EAS1795_0092:3:1:18683:1314#0/1
AAAACTTAACGAAACATTTCTTCAGGCACCAGC
+HWUSI-EAS1795_0092:3:1:18683:1314#0/1
hefhfhhhhfhgghgghhghhhghfhhgffghh
@HWUSI-EAS1795_0092:3:1:19331:1316#0/1
CGGGCCTGGAGTAGCCATTTCTCTTGGGTGGCA
+HWUSI-EAS1795_0092:3:1:19331:1316#0/1
^Scacccaa[VccXc_]\^Y_^_XVc]SM[RWc
@HWUSI-EAS1795_0092:3:1:19463:1314#0/1
ACGAAACCGTCCTGACCGTCTGGTCGGCACCCA
+HWUSI-EAS1795_0092:3:1:19463:1314#0/1
dScfcfffeffd`adfdacc[a^S^\[fcafaa
@HWUSI-EAS1795_0092:3:1:2097:1323#0/1
TGGACAAGCCTAAGAATAAACAGCAGCCCAAGA
+HWUSI-EAS1795_0092:3:1:2097:1323#0/1
RHX\^]\MYWa^aa`K\P[PSPV^ZWZI]K^\P
@HWUSI-EAS1795_0092:3:1:2117:1325#0/1
AGAAGATGGACAACATAGAGCGACTGTACAAAT
+HWUSI-EAS1795_0092:3:1:2117:1325#0/1
ghhhhhghhhfhhhgehdcfhfhhfhecffffg
@HWUSI-EAS1795_0092:3:1:2192:1320#0/1
CACGTATAGCAGAAAAGCCAAGTTAACTCGGCG
+HWUSI-EAS1795_0092:3:1:2192:1320#0/1
S^aZaaYcd\dbffcdSacaac]LYY]cdddca
@HWUSI-EAS1795_0092:3:1:2293:1323#0/1
CATCGGCCTTGGGCACACAATCGCGGTAGGTGT
+HWUSI-EAS1795_0092:3:1:2293:1323#0/1
ffhhhhhhhhhhhhghffffdffhhfeghhdea
@HWUSI-EAS1795_0092:3:1:2485:1327#0/1
TATTGTTTCCCAATCAAGCCCGACTATCTCAAT
+HWUSI-EAS1795_0092:3:1:2485:1327#0/1
hfhhafhhhhhhhhhhhdfffaffffdh]hhhh
@HWUSI-EAS1795_0092:3:1:3262:1322#0/1
AATAAATTATCCGTTCGACTGCGATCCTCAAAC
+HWUSI-EAS1795_0092:3:1:3262:1322#0/1
gfgggggggggecffffggc]egffggg^gggg
@HWUSI-EAS1795_0092:3:1:3456:1321#0/1
CCAACTCAGGGTTCGATGACAAGTTCTACAAGG
+HWUSI-EAS1795_0092:3:1:3456:1321#0/1
c^ab`\bccRca^\aaaffcaccffffdcfcfc
@HWUSI-EAS1795_0092:3:1:4238:1319#0/1
AAACTTTACCACCGGTCTGTACAACATCCCCAG
+HWUSI-EAS1795_0092:3:1:4238:1319#0/1
hhhhhhhhhhhhh_hhheahhfghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4653:1327#0/1
GCTGGACTGTGTGAACAGGCGGTCAGTAGGGGA
+HWUSI-EAS1795_0092:3:1:4653:1327#0/1
hghfhhhhghghhhhhghhfhh]dbdbfhhhh]
@HWUSI-EAS1795_0092:3:1:4782:1320#0/1
GGGATATTTCCACGCACAACGGCAGGCGCTGCA
+HWUSI-EAS1795_0092:3:1:4782:1320#0/1
fghechhhhghhghffhfhhhgfhhgRaa^dab
@HWUSI-EAS1795_0092:3:1:5283:1325#0/1
CTTCGATCCGATCGACCGATTCCTACGTCCGCG
+HWUSI-EAS1795_0092:3:1:5283:1325#0/1
aZ]\a`]aaaa^d^ddad^^[^a^^^a^d^a^B
@HWUSI-EAS1795_0092:3:1:5906:1320#0/1
CCGCGGTCCCTCCTCGCGCTCCAGCTCCTCCAG
+HWUSI-EAS1795_0092:3:1:5906:1320#0/1
gggggggegggggcgggfgeggggfgggcggde
@HWUSI-EAS1795_0092:3:1:5991:1329#0/1
CCTGTATGTTGCCGTACATGATTAACCATGTGA
+HWUSI-EAS1795_0092:3:1:5991:1329#0/1
hhhhhghhhhhhhhhhhhhgchhhhhhghhhge
@HWUSI-EAS1795_0092:3:1:6175:1328#0/1
TGGTAATGGTGTCGCAGGATCTCAAACCGCAAG
+HWUSI-EAS1795_0092:3:1:6175:1328#0/1
ggfefffcfcffdffadaf`f`fffffffdfag
@HWUSI-EAS1795_0092:3:1:6539:1320#0/1
CAAGTTAAAGAACCTACAGGTGCTGAACTTGGA
+HWUSI-EAS1795_0092:3:1:6539:1320#0/1
hhhghhghgfhhhhhhhhghhhhghhghhhehe
@HWUSI-EAS1795_0092:3:1:7048:1319#0/1
GTGGGTTTTTGGCCGACCTGCAGCAGCAGCCGC
+HWUSI-EAS1795_0092:3:1:7048:1319#0/1
hghhhhhhhhfghhhghhhhhhhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:7801:1325#0/1
CGAAAGGCACGAAAGTAGGACATGATGGCCAAC
+HWUSI-EAS1795_0092:3:1:7801:1325#0/1
ffcggcgfgggggggaggfgcggggfggeagc_
@HWUSI-EAS1795_0092:3:1:7978:1320#0/1
GCCGAAGCAAATACAAATGGCCCAGTATCTGCT
+HWUSI-EAS1795_0092:3:1:7978:1320#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:8249:1321#0/1
GACCAAGGAGCTCACGGCCAAGTTCACATCGGT
+HWUSI-EAS1795_0092:3:1:8249:1321#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhggfhf
@HWUSI-EAS1795_0092:3:1:8472:1319#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8472:1319#0/1
fdff_dfcc]dfffc]f`bddfc]ff_fbffab
@HWUSI-EAS1795_0092:3:1:8647:1325#0/1
GTCAACATCCCATTCGACGTGGCCAAGTCACGC
+HWUSI-EAS1795_0092:3:1:8647:1325#0/1
ZN___\ZO\aa\^W^WY^QR^BBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:8813:1321#0/1
GGCGGTGGTAAGGCGATCCGGACCAGCTGAAAT
+HWUSI-EAS1795_0092:3:1:8813:1321#0/1
cffcdfcc^cc^\Z\\]fdcfccfffWXZXZ_`
@HWUSI-EAS1795_0092:3:1:9247:1322#0/1
CGCTGAACCACTTTCATGCTTGGGATTGTGAAC
+HWUSI-EAS1795_0092:3:1:9247:1322#0/1
d^aY_aaaca[accacc\_b`\dcddddcYdd^
@HWUSI-EAS1795_0092:3:1:9559:1326#0/1
CTCGTTTTGTGGTTCAGTGCCAGATTCATCGGC
+HWUSI-EAS1795_0092:3:1:9559:1326#0/1
hhhhhhhhhhhhhhhhhhhhhhfehhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9822:1318#0/1
ACGCAATACGATCCTTTTACCTCGCCAAGCTCA
+HWUSI-EAS1795_0092:3:1:9822:1318#0/1
hgfghhhhhghghhhhhhhhfhhgghhcgfhgh
@HWUSI-EAS1795_0092:3:1:10213:1329#0/1
CGTCTTGCAGCAAACCCAATTTGTCTCGTAACT
+HWUSI-EAS1795_0092:3:1:10213:1329#0/1
ffefeffgegddgggggggfgfWcfffcdffeg
@HWUSI-EAS1795_0092:3:1:10469:1328#0/1
GCAGATTTTGGTGGAAACATCTTTATTACTTGG
+HWUSI-EAS1795_0092:3:1:10469:1328#0/1
ghhhhhhhhfhhhhhhhhhhhhhhghhhghhhh
@HWUSI-EAS1795_0092:3:1:11117:1319#0/1
CTCGGTCATCAATGTAAGGAAGCTATCGTCACT
+HWUSI-EAS1795_0092:3:1:11117:1319#0/1
hhhhhhhhgghhgcgghhchcghcfhhghhhfc
@HWUSI-EAS1795_0092:3:1:11560:1319#0/1
GTCGCTGCGAGTTTATGGTTTATTAAGTTTTTA
+HWUSI-EAS1795_0092:3:1:11560:1319#0/1
hhhhhhgghhhhhhghghhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:11937:1327#0/1
TAATAATAAAGCAGTAATAACTACTGATCAAAC
+HWUSI-EAS1795_0092:3:1:11937:1327#0/1
hhhhhhhhhhhhhhhhhhhhhgghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11992:1325#0/1
GCAGATTCCTCGTTTGCTTGGCCCTGGCTTGAA
+HWUSI-EAS1795_0092:3:1:11992:1325#0/1
hhhhhhhhhhhhhhghhhhhhhhhehghhhghg
@HWUSI-EAS1795_0092:3:1:12337:1320#0/1
TGCCCACCGATTTCCTGGCAACTTTGGCATTAA
+HWUSI-EAS1795_0092:3:1:12337:1320#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12400:1324#0/1
GGCAATTTCGCTGCCGCCTACCCAGTTGGTAAA
+HWUSI-EAS1795_0092:3:1:12400:1324#0/1
ffaggggggfggggggggfgfgfegggffaeee
@HWUSI-EAS1795_0092:3:1:12854:1325#0/1
TGTTGCTGTTGGCCATTCTGGCTATATTGAATC
+HWUSI-EAS1795_0092:3:1:12854:1325#0/1
ggggggggcgcegggggffdgggfcgggagfgf
@HWUSI-EAS1795_0092:3:1:12936:1325#0/1
TGCCGGGGTAATAGTAAACAACAAGGGCGAAAT
+HWUSI-EAS1795_0092:3:1:12936:1325#0/1
hghgghhhhhhhhfhehhhhhhhhhfghghfgh
@HWUSI-EAS1795_0092:3:1:13063:1320#0/1
TGCGAAAACGTTTGCTTTCTCTGAAGCTATCGA
+HWUSI-EAS1795_0092:3:1:13063:1320#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:13097:1318#0/1
CAATGACCATGACGCCCATCCAGGGCAGGGACC
+HWUSI-EAS1795_0092:3:1:13097:1318#0/1
hhghhhhhhhhhhhhhhfhhhhhhghhhhgghh
@HWUSI-EAS1795_0092:3:1:13139:1328#0/1
ATGAGATGTGGCACAATAAGAAGCCATACTTAA
+HWUSI-EAS1795_0092:3:1:13139:1328#0/1
hhhgfghghhgghhhhghhfghhhgghhghhhg
@HWUSI-EAS1795_0092:3:1:13379:1323#0/1
TTGCTGGTAAAATCCGCCTTTAGCGTCTGCTGG
+HWUSI-EAS1795_0092:3:1:13379:1323#0/1
hhhhhfhhhhhhhhhhfhhhhfhhhhghhhcfh
@HWUSI-EAS1795_0092:3:1:13818:1323#0/1
TATCTGTCGTGCTGCCTCCCACGTTTGGCGGAA
+HWUSI-EAS1795_0092:3:1:13818:1323#0/1
hfhhhfhhhhehghhhhhhhghhgehcchhggh
@HWUSI-EAS1795_0092:3:1:13971:1319#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13971:1319#0/1
gggggcgggggggggggggggdggggggfggcg
@HWUSI-EAS1795_0092:3:1:14007:1319#0/1
GCAGGTTCGAAATAGTGACGCTGGTGGATGCGG
+HWUSI-EAS1795_0092:3:1:14007:1319#0/1
hfhhhhhhhhhhghfgghhghdhhfhghfhhff
@HWUSI-EAS1795_0092:3:1:14251:1326#0/1
GCCCAGGTGGCTGGCGACGATGACGAGGAGGAT
+HWUSI-EAS1795_0092:3:1:14251:1326#0/1
gcfffffafffdgggfgdgecgggggggagaab
@HWUSI-EAS1795_0092:3:1:14761:1324#0/1
CGAATAAACTGTACCAGATTGGGACTATGCGGA
+HWUSI-EAS1795_0092:3:1:14761:1324#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15132:1321#0/1
GCCGGTTTGGTTATGGCCTTTAATTATTTACAC
+HWUSI-EAS1795_0092:3:1:15132:1321#0/1
fadddWddcdad[`]dafcffffffffccccff
@HWUSI-EAS1795_0092:3:1:15300:1326#0/1
TCGGAGTTCTCGTAGATTCGCCGTATGATGGTA
+HWUSI-EAS1795_0092:3:1:15300:1326#0/1
hhhhhhhgghhhhgghhhhhhhgghchhghhh_
@HWUSI-EAS1795_0092:3:1:15800:1328#0/1
AGAAAATAGTCGAACGTAGTCCCAGATCACATG
+HWUSI-EAS1795_0092:3:1:15800:1328#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:16491:1319#0/1
AATCAATAGCGACATTTACAATTCATAAACTTG
+HWUSI-EAS1795_0092:3:1:16491:1319#0/1
hhhhghhhhhhhhhhhhhfghfhhghhhghhgh
@HWUSI-EAS1795_0092:3:1:16509:1320#0/1
GGAGGCGTTGGATATCAATTCACGCAGGAAGAT
+HWUSI-EAS1795_0092:3:1:16509:1320#0/1
hhhghhhhhhhhhhhhhchhhhhhhhhahdcfh
@HWUSI-EAS1795_0092:3:1:16925:1329#0/1
GGATCTTGGAGAGGGAGCTGGACGCAGTAGATC
+HWUSI-EAS1795_0092:3:1:16925:1329#0/1
hhhhhhhhhgghhhhghghhhfhhhhhgfhhhh
@HWUSI-EAS1795_0092:3:1:17049:1319#0/1
CGGGAAGAGACAGAGCTGCAGGAATTGCGTGAT
+HWUSI-EAS1795_0092:3:1:17049:1319#0/1
hghhghdhhhhghhhhgffffffhhfhghggh]
@HWUSI-EAS1795_0092:3:1:17745:1321#0/1
CTCTTTTTCAATTTGTCCCATAGTTTTGGGTGC
+HWUSI-EAS1795_0092:3:1:17745:1321#0/1
gfggdgggceagffafffffc]cced^ff[f_^
@HWUSI-EAS1795_0092:3:1:18870:1321#0/1
GCCATATTCGCCCACCTGGGCCACAGTGCGTTG
+HWUSI-EAS1795_0092:3:1:18870:1321#0/1
a\cacd\aeedefffc]daeeededed[eWba`
@HWUSI-EAS1795_0092:3:1:18913:1320#0/1
CGGAGCCAGAAAAGCCCGAGTCGGCGCCGATGA
+HWUSI-EAS1795_0092:3:1:18913:1320#0/1
fbcffffgcgggc`fffTXVQ]VVVWJ^ZYYW`
@HWUSI-EAS1795_0092:3:1:1542:1333#0/1
AGCACATTCCCGACCCAGATGCCACAAAGCCTG
+HWUSI-EAS1795_0092:3:1:1542:1333#0/1
QLJUPVV_W__Ycacdffcfff\\Saacc\ac^
@HWUSI-EAS1795_0092:3:1:2370:1329#0/1
GCGGAGTCCCGGGATCGATGGTATCGATGGCAT
+HWUSI-EAS1795_0092:3:1:2370:1329#0/1
fdfffdafffccfcafabRbb^a]a``LXSXZ_
@HWUSI-EAS1795_0092:3:1:2886:1340#0/1
GGCAATCGTCTGTGGAGACACTTTGGCAATTCG
+HWUSI-EAS1795_0092:3:1:2886:1340#0/1
gggggcgggggggggYaff_ffggggeggggfg
@HWUSI-EAS1795_0092:3:1:2946:1339#0/1
ATGTATTGGTGTTATAGTCTCCGAGCTTCTTCT
+HWUSI-EAS1795_0092:3:1:2946:1339#0/1
hhhhhhhhhgghhfhhhhhghhhhghhhehhdh
@HWUSI-EAS1795_0092:3:1:2975:1340#0/1
CCCCACATAGCCATGGATCTATACCATGACGTG
+HWUSI-EAS1795_0092:3:1:2975:1340#0/1
hhhhhhhgghghhhhhhghfhfhhghhfhhegg
@HWUSI-EAS1795_0092:3:1:4136:1340#0/1
GCCATGCTCTGGGCGGTATTTCACATTGCAACC
+HWUSI-EAS1795_0092:3:1:4136:1340#0/1
f^ggggggggggggggeggggefgggg[ffffg
@HWUSI-EAS1795_0092:3:1:4214:1337#0/1
TTGCCGGTGAGGGTTTTCACGAAGATCTGCATA
+HWUSI-EAS1795_0092:3:1:4214:1337#0/1
cfaffffadafff`dffdedbbff]cdfff_df
@HWUSI-EAS1795_0092:3:1:4437:1334#0/1
GCCCTACATCTCCCTGCCTAAGGGCAAGGGGGT
+HWUSI-EAS1795_0092:3:1:4437:1334#0/1
J_ccaaac_cRccc^_aZHX\NV]acaBBBBBB
@HWUSI-EAS1795_0092:3:1:4897:1337#0/1
CAGAGAGATATGGTAGATGGGCTAGAAGAGCAT
+HWUSI-EAS1795_0092:3:1:4897:1337#0/1
hfhhhhhhhhhghhfhahdehhhghhhahhghg
@HWUSI-EAS1795_0092:3:1:5347:1333#0/1
GAATTCTGCTACGAGAACATGAACTTCATGAAG
+HWUSI-EAS1795_0092:3:1:5347:1333#0/1
hhhhhhhhhhhhhhhghhhhghhhhghhhghhh
@HWUSI-EAS1795_0092:3:1:5388:1333#0/1
AACGCAATGCGGATCACGCTGCTCCGCCGTGCA
+HWUSI-EAS1795_0092:3:1:5388:1333#0/1
bffffffagagggaggaeeQdafffffgggggg
@HWUSI-EAS1795_0092:3:1:5665:1334#0/1
CCGGCTTGTAGGGTCGCTCGAAGCGTTCGATGA
+HWUSI-EAS1795_0092:3:1:5665:1334#0/1
hhhhhhhfhhhhhghhhghhgg]hhehhhfcgf
@HWUSI-EAS1795_0092:3:1:5921:1338#0/1
TTTCCGTGTACACGGAGACCAATGGCCTGGCGT
+HWUSI-EAS1795_0092:3:1:5921:1338#0/1
hhhhhhhhhhghhhhggcffffhhhhghfhhhh
@HWUSI-EAS1795_0092:3:1:6263:1336#0/1
CTGCTGAATCATCGCATATACACAGCACAACGT
+HWUSI-EAS1795_0092:3:1:6263:1336#0/1
hhhhhhhhhhhhhdhhfghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6837:1339#0/1
CGGCGTGCTTGCCCGAGAACTTCTTCTCCAGCT
+HWUSI-EAS1795_0092:3:1:6837:1339#0/1
fffffffc]dWdee]b]Wd``a[ad``cfacca
@HWUSI-EAS1795_0092:3:1:7627:1337#0/1
CAAAAAACCAACACAAAAATGGCCAAGCTCGCA
+HWUSI-EAS1795_0092:3:1:7627:1337#0/1
hghhhhhhghhhhhhhhhhghfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7938:1338#0/1
CGGGCACCGTAACATTACGTTTGGTTCATCCCA
+HWUSI-EAS1795_0092:3:1:7938:1338#0/1
hhhhhhhhhhhhhfhhhghhhhgghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8533:1337#0/1
CAAGCAGGGGTCTCAAGGGCGAGGCGGATCGCT
+HWUSI-EAS1795_0092:3:1:8533:1337#0/1
hhhhhhhhfhghhhhhfhfhhehhhhhhfhdhg
@HWUSI-EAS1795_0092:3:1:8867:1331#0/1
GGAACGCGCGGTTAACTTTATATTTTACTAAAT
+HWUSI-EAS1795_0092:3:1:8867:1331#0/1
hhhhhhhhhhhhhhhhhhhghgghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9037:1337#0/1
GCATCAAGTACGATCCCTCCATCGGTATCTATG
+HWUSI-EAS1795_0092:3:1:9037:1337#0/1
c\cfffffff_fcff\fa_WVbffffR`Xba]b
@HWUSI-EAS1795_0092:3:1:9132:1340#0/1
ATTTTAAGTTATTTCAACTGCAACACCAGCACC
+HWUSI-EAS1795_0092:3:1:9132:1340#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhfghh
@HWUSI-EAS1795_0092:3:1:9218:1332#0/1
GGAGTCTAATCTGACAATCTAGTCGTCTCATAC
+HWUSI-EAS1795_0092:3:1:9218:1332#0/1
dhhhhhhhgghhhhhhhfhfhhhhfhhhhehhh
@HWUSI-EAS1795_0092:3:1:9421:1334#0/1
CTGAAATTTCTTTATTCAAAGATAGTAATAATG
+HWUSI-EAS1795_0092:3:1:9421:1334#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9873:1330#0/1
AGTCGAGTTGCTGGAGGCTTTGGCCATGCTGCT
+HWUSI-EAS1795_0092:3:1:9873:1330#0/1
ggggegggg]aggg_fgcgggafgggegefggg
@HWUSI-EAS1795_0092:3:1:10229:1341#0/1
ACGGCAACCAGAACAACAGATCTACGTCTATGT
+HWUSI-EAS1795_0092:3:1:10229:1341#0/1
c_fffafggfggfafdfcdfffTVUTRW_YWYd
@HWUSI-EAS1795_0092:3:1:10347:1335#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:10347:1335#0/1
hffgghhfhghgghchhahhdhffhhhggehhf
@HWUSI-EAS1795_0092:3:1:11098:1335#0/1
GGCGTGACTTGGTATGGGGGCTGGGGGCAAAGA
+HWUSI-EAS1795_0092:3:1:11098:1335#0/1
cd\a[ecdfdfddfffff]aafcWadbQ^d_]b
@HWUSI-EAS1795_0092:3:1:11822:1334#0/1
CTTTCGGCGACATACTGCAGCTGGTCATCGTGG
+HWUSI-EAS1795_0092:3:1:11822:1334#0/1
gggggfgeggggfggfgggfgagggggeggggg
@HWUSI-EAS1795_0092:3:1:12133:1335#0/1
GGTCGTACCAAAGAAACCGGATGCTTCTGGCGT
+HWUSI-EAS1795_0092:3:1:12133:1335#0/1
hhghghhhhhhheghhhhhhfhhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:12314:1337#0/1
GGCGAATTGGTGTGGCGGCAGGGGCTCGAGCAG
+HWUSI-EAS1795_0092:3:1:12314:1337#0/1
gggggggggggggggggfc]ffJ```^b]_^BB
@HWUSI-EAS1795_0092:3:1:12566:1331#0/1
GGGCGGTGTGTACAAAGGGCAGGGACGTAATCA
+HWUSI-EAS1795_0092:3:1:12566:1331#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12897:1338#0/1
TAAAGGTATCGATGTATGTGGATCATAATGGCA
+HWUSI-EAS1795_0092:3:1:12897:1338#0/1
ggggggggggggfgggggdgggdgggggaggag
@HWUSI-EAS1795_0092:3:1:13748:1331#0/1
TGGTCATAGAGATTCCTTGGAAGGTACCCAAAT
+HWUSI-EAS1795_0092:3:1:13748:1331#0/1
ggggggfgggggggggggfggdgfggggggggd
@HWUSI-EAS1795_0092:3:1:13779:1339#0/1
GCAGAGTTCGCAGCATCCGCAGCACGTCAAGCA
+HWUSI-EAS1795_0092:3:1:13779:1339#0/1
hhhhhhhhhhhhhhgghghhhhhhhcfghhfhg
@HWUSI-EAS1795_0092:3:1:14230:1334#0/1
AGGATCTGGAAGATACAAGGGGTGGTCACAAGA
+HWUSI-EAS1795_0092:3:1:14230:1334#0/1
hhhhhhhhhhhhhhfhhhghhhehhhhhhhggh
@HWUSI-EAS1795_0092:3:1:14393:1337#0/1
GCAAAATGATATTTAATATCAATATGTTTAGCT
+HWUSI-EAS1795_0092:3:1:14393:1337#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14547:1337#0/1
TCGTCCTCATCCTCCGCCTCGTCGTCATCGTCA
+HWUSI-EAS1795_0092:3:1:14547:1337#0/1
hhhhhhhhhhhhghhhhhhhghhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:14823:1331#0/1
CTTCTTGCCGGCGAGGACCTTCTTCTTGGCATC
+HWUSI-EAS1795_0092:3:1:14823:1331#0/1
cccccccccccacaccWZ]Zaa^BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:15271:1335#0/1
AAACAGAGTTCCCGAATGAGAGTAAGGAATGCG
+HWUSI-EAS1795_0092:3:1:15271:1335#0/1
hhhhhhhhhhhhhhhhhhfhhhhhgghhhfhhh
@HWUSI-EAS1795_0092:3:1:15424:1335#0/1
CTTTTCTTCGTGGGCTCCTTTATTTTTTCCCTG
+HWUSI-EAS1795_0092:3:1:15424:1335#0/1
hhhhhhhhhhhhhhhhhhhhhghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:16214:1333#0/1
ATCAGCTCCAACGACGATGAGGACGACGATGCC
+HWUSI-EAS1795_0092:3:1:16214:1333#0/1
hhhhhhhhhhhhhhhhhhhghhhhhgghhhhhh
@HWUSI-EAS1795_0092:3:1:16565:1339#0/1
GTGATCTCAGATTTTCCGTTGACAAGCTCGCTC
+HWUSI-EAS1795_0092:3:1:16565:1339#0/1
hhhhhhhhhhhhhhhhgghhghdhhhffhghhh
@HWUSI-EAS1795_0092:3:1:17571:1338#0/1
CAATTCACAACTGTTTTGTACACAATACAGATG
+HWUSI-EAS1795_0092:3:1:17571:1338#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18124:1341#0/1
AGGAAATCCAGACATACATCAAGCGCTTCCAGC
+HWUSI-EAS1795_0092:3:1:18124:1341#0/1
hhhhhhhhhhhhhfghhghghhhhhhhehcecd
@HWUSI-EAS1795_0092:3:1:18264:1333#0/1
CTCAAATTGGGCAGCATTGAAGAGTTTCGCTGT
+HWUSI-EAS1795_0092:3:1:18264:1333#0/1
hfhhhhhhhghhhhhhhhgfhhefhhhhhhhfe
@HWUSI-EAS1795_0092:3:1:1581:1347#0/1
GCACACCAAGCGATCTGCCCTGGAGCAGATCAA
+HWUSI-EAS1795_0092:3:1:1581:1347#0/1
adfaccfffffaa^e`d\\\[^a\^BBBBBBBB
@HWUSI-EAS1795_0092:3:1:2228:1351#0/1
ATCGGATTCGAGATATATAGCGGACGCCCAGAC
+HWUSI-EAS1795_0092:3:1:2228:1351#0/1
ccdd[cd\^^aaf[fR_cc^cccfaffdf[[]Z
@HWUSI-EAS1795_0092:3:1:2816:1349#0/1
TATGAATTACTTAATTCAGATGAAGACTGCAAT
+HWUSI-EAS1795_0092:3:1:2816:1349#0/1
hhhhhhghhhhhhghhhhchhahhefghhhhhh
@HWUSI-EAS1795_0092:3:1:3202:1349#0/1
ACCCACCAGCCCAGATAGCCACACAGACTTTGG
+HWUSI-EAS1795_0092:3:1:3202:1349#0/1
_fffcf]PTZZ]a^b]bbcef]e]d[a]^V`]\
@HWUSI-EAS1795_0092:3:1:3288:1350#0/1
CGATGTACAGCGTGTTTCCTATGAAAGGCTCCC
+HWUSI-EAS1795_0092:3:1:3288:1350#0/1
ggfafffgggggcdccfadfcf\ffffgggffg
@HWUSI-EAS1795_0092:3:1:3553:1343#0/1
TGCGCTTGGCCATTTTGCTGTTGTTGTTGGTGT
+HWUSI-EAS1795_0092:3:1:3553:1343#0/1
g_gdfafffff\acffYfffff_accff_]_fa
@HWUSI-EAS1795_0092:3:1:3623:1345#0/1
CCGCGAGTTTCCTCGTAAATCAAGCCAGAGATA
+HWUSI-EAS1795_0092:3:1:3623:1345#0/1
fffcfdfdYeec_aa\addaYefRadcd\^caf
@HWUSI-EAS1795_0092:3:1:4776:1348#0/1
GTCAAGCCCGGTATCACCAAGAAGAAGCTGCTG
+HWUSI-EAS1795_0092:3:1:4776:1348#0/1
f[ffffa^eeebf_fff[ffffggg_gfaffcf
@HWUSI-EAS1795_0092:3:1:5021:1343#0/1
GTGGCATTAGGCAAATAACAATTAATTTGTAGG
+HWUSI-EAS1795_0092:3:1:5021:1343#0/1
fcggcggfggggggggggggggggggggggfgd
@HWUSI-EAS1795_0092:3:1:5600:1343#0/1
CTTCGGTATTAGAGCGCAGATCGGCGGGAAAAA
+HWUSI-EAS1795_0092:3:1:5600:1343#0/1
f^ffc\f^aa\Sacaaccdc^d_R^BBBBBBBB
@HWUSI-EAS1795_0092:3:1:5830:1341#0/1
GTTTCAAAGACAGCCTTTTCTACCAAGCACGGT
+HWUSI-EAS1795_0092:3:1:5830:1341#0/1
ggggggggggfgg_gggggdgggggcgggggge
@HWUSI-EAS1795_0092:3:1:6032:1347#0/1
AAGAAATATGGCTACCAAATTCAGCCGAAAACT
+HWUSI-EAS1795_0092:3:1:6032:1347#0/1
cffff``acaaWaead[ZZWZZ\K\YY``^]\Q
@HWUSI-EAS1795_0092:3:1:6066:1347#0/1
CTCGTCGTTCTCTTTGTCTTCGCTCTTGTCGTC
+HWUSI-EAS1795_0092:3:1:6066:1347#0/1
hhhhhhhhhghhhhhchhhhhhfhhhhcggfhh
@HWUSI-EAS1795_0092:3:1:6381:1352#0/1
GGAGGATGGCCACACCGACTGGGTGTCGTGCGT
+HWUSI-EAS1795_0092:3:1:6381:1352#0/1
fafcWffaddddddddb_\QXa^^^aaJSRLP^
@HWUSI-EAS1795_0092:3:1:7893:1353#0/1
ATCAAATCCTCCTGGGCGGACGAGGTGGAGCTC
+HWUSI-EAS1795_0092:3:1:7893:1353#0/1
dffafff\dcd_`X\Xaa[M\V\aaI\SSOXPa
@HWUSI-EAS1795_0092:3:1:8823:1352#0/1
GGAGAAGTGGCAGAAGGAGGAACTGGAGCGCCT
+HWUSI-EAS1795_0092:3:1:8823:1352#0/1
hhggghghhfhhhfhhhfhhhhhggghgefhhh
@HWUSI-EAS1795_0092:3:1:9470:1347#0/1
GAGCTTTCCTTGGATTAACAGGTTATTATCGCA
+HWUSI-EAS1795_0092:3:1:9470:1347#0/1
aa_^_^`aaa]aa`aaa_\___aaacca]a_be
@HWUSI-EAS1795_0092:3:1:9580:1348#0/1
GCGAGCCCGTGGTCTTCACCACTTCACCAGACA
+HWUSI-EAS1795_0092:3:1:9580:1348#0/1
hhhhhhhhhhhhhhhhhghgghghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9897:1350#0/1
CGAGCTTCTTTAAATTGGGCAGCTTGGGGAAAC
+HWUSI-EAS1795_0092:3:1:9897:1350#0/1
hhhhhhhhhhhhhhhhhhhhhhhhffhhhhhhf
@HWUSI-EAS1795_0092:3:1:10189:1346#0/1
TTTTAAAATTGATGATACACAGAGAACTAAATG
+HWUSI-EAS1795_0092:3:1:10189:1346#0/1
hghgghhhhhhfehcfghhhhh[[ETWV[W[[d
@HWUSI-EAS1795_0092:3:1:10755:1352#0/1
TGTCGGTATACAGCGACTCATCATTTATAAGAT
+HWUSI-EAS1795_0092:3:1:10755:1352#0/1
ggggggggcggggegggggcdgggggggggfce
@HWUSI-EAS1795_0092:3:1:11008:1350#0/1
CTCTGCCCTCTTTGCGCTCACACAAGTATAGAA
+HWUSI-EAS1795_0092:3:1:11008:1350#0/1
hhhhehhhhhhhhhhhhhhfhghhhhghhhfhh
@HWUSI-EAS1795_0092:3:1:11139:1343#0/1
CGCACCCGCTGCCGCCGCCGGTGGCCACAAGAA
+HWUSI-EAS1795_0092:3:1:11139:1343#0/1
dfgggccfa^afaY_caQ^a\[\WVI^SZ\SZ`
@HWUSI-EAS1795_0092:3:1:11307:1347#0/1
GAGGAGGAGGTGCAGGAACTGGGAGCGGTGCTG
+HWUSI-EAS1795_0092:3:1:11307:1347#0/1
fWffaffY\aV\\Zaa\fff_cfefffcaaac`
@HWUSI-EAS1795_0092:3:1:12110:1346#0/1
CCGGCGACAAGAAGGTCAAGGGTCTGCGCGGAT
+HWUSI-EAS1795_0092:3:1:12110:1346#0/1
ggggggggagggfgaggff_fdggadfccfcfg
@HWUSI-EAS1795_0092:3:1:12410:1348#0/1
CTGAGTTATACTGGTTCAGCGACGGCAACCAAA
+HWUSI-EAS1795_0092:3:1:12410:1348#0/1
gggggegggggdgggfggdggggggfggggggg
@HWUSI-EAS1795_0092:3:1:13097:1344#0/1
GGCATTTTGTGGTGTTGCTGTTGGCCATTCTGG
+HWUSI-EAS1795_0092:3:1:13097:1344#0/1
hfhhhhhhhhhhghhhhfhghhfghhhhhhgfg
@HWUSI-EAS1795_0092:3:1:13568:1344#0/1
TGTTCGTATTCATGATACGCAGGATGTGCTGGA
+HWUSI-EAS1795_0092:3:1:13568:1344#0/1
gggfggggggggggggdfgggggffgggggggg
@HWUSI-EAS1795_0092:3:1:14019:1345#0/1
CGGCAGTGATTTTGGGTTCCAGGGCACAACTAA
+HWUSI-EAS1795_0092:3:1:14019:1345#0/1
hghhhhghgghhhfhhhhhhhhhhhhhhhgghg
@HWUSI-EAS1795_0092:3:1:14290:1352#0/1
AGAACTCCTTGCGCTATCGTGGCATTGATGGCT
+HWUSI-EAS1795_0092:3:1:14290:1352#0/1
hhehhhhhghhhhhghhhffhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:14906:1345#0/1
TATTGGTGTAGAGCTCAGTCGGCCGGTATATTA
+HWUSI-EAS1795_0092:3:1:14906:1345#0/1
hhhhhghghhhfchhhghhghfhghheghghgh
@HWUSI-EAS1795_0092:3:1:15000:1351#0/1
TCTTGATTCTGCTGGAGGAGGAGGAGGAGAAGT
+HWUSI-EAS1795_0092:3:1:15000:1351#0/1
fgggggggggggggggggeggaggeggdggggg
@HWUSI-EAS1795_0092:3:1:15134:1344#0/1
GGGCACCGTAACATTACGTTTGGTTCATCCCAC
+HWUSI-EAS1795_0092:3:1:15134:1344#0/1
hhhhhhhghhhcgghghhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15468:1342#0/1
GTCTGATCCCGTCGTCTCCTACCGTGAGACTGT
+HWUSI-EAS1795_0092:3:1:15468:1342#0/1
hhhhhhhghhehhhhhhhhhhhhdghhgehhdd
@HWUSI-EAS1795_0092:3:1:16231:1345#0/1
CACGCGAGTCAGACAACGTGGCCAAGTCGTGCA
+HWUSI-EAS1795_0092:3:1:16231:1345#0/1
befffdaffaffgdggcggcagffffdfcc_ff
@HWUSI-EAS1795_0092:3:1:16598:1343#0/1
CCTCCCCTGCCTTTTGGCCATTCGCCCCGAGAC
+HWUSI-EAS1795_0092:3:1:16598:1343#0/1
hhhhhhhhhhhhhhhghhhghhhhhhhhgaeae
@HWUSI-EAS1795_0092:3:1:17964:1343#0/1
GTCAGGACGTGGTCTCTACCAAAAGATGAGATT
+HWUSI-EAS1795_0092:3:1:17964:1343#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhghhhgh
@HWUSI-EAS1795_0092:3:1:18104:1348#0/1
GCGAACTAATGCTGTTCCTAACGAACTCGGAAT
+HWUSI-EAS1795_0092:3:1:18104:1348#0/1
hhhhhhhhghhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:18177:1343#0/1
AGGACAACACGTTCTCCTCGGAAGGTTGCGGTT
+HWUSI-EAS1795_0092:3:1:18177:1343#0/1
hhhhhghhfhhhhfhhhghhghghhdfgchgeh
@HWUSI-EAS1795_0092:3:1:19167:1348#0/1
TCTCTATCCTAATTCCAATAAAATGTTTTATTT
+HWUSI-EAS1795_0092:3:1:19167:1348#0/1
hfhghhhhghhhhhghhgghfgehhhghhghhh
@HWUSI-EAS1795_0092:3:1:19467:1350#0/1
TGCAGATCCAGTTAATTTTTGGATCACGACGAA
+HWUSI-EAS1795_0092:3:1:19467:1350#0/1
a\aba]bccddd]dcddffffc\S]_`a__dd^
@HWUSI-EAS1795_0092:3:1:19612:1344#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19612:1344#0/1
ggffgggggfggfdfffacffcgeccgfacfa^
@HWUSI-EAS1795_0092:3:1:19785:1345#0/1
CGGTTCAGCAGGAATGCCGAGGAGATCGGAAGA
+HWUSI-EAS1795_0092:3:1:19785:1345#0/1
hhhghhhhhhhhchhhhhhgghhhfghfhfceg
@HWUSI-EAS1795_0092:3:1:1150:1360#0/1
AAAAGGTGGACGGAATGTGTTTCTGATATCAAA
+HWUSI-EAS1795_0092:3:1:1150:1360#0/1
fcaffYccfffdgggggf^ffffaddacffadg
@HWUSI-EAS1795_0092:3:1:1262:1354#0/1
AGCGACGCAGGCGGAGATCGAATGCACGACAGG
+HWUSI-EAS1795_0092:3:1:1262:1354#0/1
c^eeeWe`ade[edadPQaaaaW`RaBBBBBBB
@HWUSI-EAS1795_0092:3:1:1516:1362#0/1
TGGGTCCATGGTGCTGCGGAACAGATCAGCGTT
+HWUSI-EAS1795_0092:3:1:1516:1362#0/1
K_\_\Z]ccacca\Sa^UYS^UZ\^ZVcYaaa]
@HWUSI-EAS1795_0092:3:1:1842:1364#0/1
ACAACTTCAGCTGCTTCAGGGCAACCGCAAGGA
+HWUSI-EAS1795_0092:3:1:1842:1364#0/1
gfggggggggc_fccfdgegf[gcggggggggg
@HWUSI-EAS1795_0092:3:1:1988:1353#0/1
CGATACATCAAGTTGGGCATTCGTGCTGATGAT
+HWUSI-EAS1795_0092:3:1:1988:1353#0/1
gggggggffffffcffaadfffggaegdgafeg
@HWUSI-EAS1795_0092:3:1:2782:1358#0/1
AAACATCCCCGAGAAGTGGGAGCCGCCAACCGT
+HWUSI-EAS1795_0092:3:1:2782:1358#0/1
ggggg^ggggggggggagggegggggcgggegd
@HWUSI-EAS1795_0092:3:1:3012:1358#0/1
CGTTTGTCCATAGCTTCTACAAGCAGCTGCTGC
+HWUSI-EAS1795_0092:3:1:3012:1358#0/1
hhhhhghhhhghhhhhhhehgghhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:3217:1358#0/1
GAATGCTGCTGCCCACACTAAGCACACTCGATT
+HWUSI-EAS1795_0092:3:1:3217:1358#0/1
cgggeggaggggaafcfdggggdfcfffggdf_
@HWUSI-EAS1795_0092:3:1:4209:1363#0/1
GGTGGTTCCGCTCTTTTCATCTTGTAGTTGGTG
+HWUSI-EAS1795_0092:3:1:4209:1363#0/1
hhhchhhghhhhhhgghfghchhhhhhhhhhef
@HWUSI-EAS1795_0092:3:1:4350:1353#0/1
GACCACTGGCATCATCGAGACACACTTCTCCTG
+HWUSI-EAS1795_0092:3:1:4350:1353#0/1
fcgdgggggggggcggf_ggfgcgggggggggg
@HWUSI-EAS1795_0092:3:1:6485:1358#0/1
CTCCGCCGCAATCCAAGTACAGGGCATCGTAGT
+HWUSI-EAS1795_0092:3:1:6485:1358#0/1
hghhhhhhhhghhhfheghghghehhhhhfhfh
@HWUSI-EAS1795_0092:3:1:6576:1359#0/1
CGTCGAACTGCGACACCCGCTGCATTTTCGGTC
+HWUSI-EAS1795_0092:3:1:6576:1359#0/1
gggggggggggggfcfggfgadgggggggggbd
@HWUSI-EAS1795_0092:3:1:7074:1363#0/1
TGAATGTGACCGCCAAGGAGCAGGGCACTGGCA
+HWUSI-EAS1795_0092:3:1:7074:1363#0/1
hhhhhhhhhhhghhhhgdhgcdfhhhghfhffh
@HWUSI-EAS1795_0092:3:1:8022:1356#0/1
CCTTGATGTCACGGACGATTTCACGCTCAGCGG
+HWUSI-EAS1795_0092:3:1:8022:1356#0/1
hhhhhhghhhhhhhhhhhfhhhhhhhfhghfhh
@HWUSI-EAS1795_0092:3:1:8130:1359#0/1
ATTGTGAGTAACTTGGTCGATTTTGAGTTTGAA
+HWUSI-EAS1795_0092:3:1:8130:1359#0/1
gggdgfaggfgggggfgffKfffff_fggdcgg
@HWUSI-EAS1795_0092:3:1:8288:1357#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:8288:1357#0/1
hhhhhhhhhhhhhhhhhgghghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10388:1364#0/1
GGCGAGTCGATCAAGTTGATCAGGAAACCCTTG
+HWUSI-EAS1795_0092:3:1:10388:1364#0/1
hhghhhhhghheghhfhh_hcgahfhfghhhgW
@HWUSI-EAS1795_0092:3:1:11068:1364#0/1
GAAAAGTTTAGGATGACTGACCTAAATGAAATA
+HWUSI-EAS1795_0092:3:1:11068:1364#0/1
geggggggggggggfggggggdfffffggggag
@HWUSI-EAS1795_0092:3:1:11267:1363#0/1
CAGAAGGAGACCATTGCCGCCAAGAACGGCCTC
+HWUSI-EAS1795_0092:3:1:11267:1363#0/1
ggegggg]ddffgggfffdff[db]db[`ff`f
@HWUSI-EAS1795_0092:3:1:11940:1357#0/1
ATGAAATGCTCAAAACCAAGGAGTTCTCCAAAG
+HWUSI-EAS1795_0092:3:1:11940:1357#0/1
hhghghhhhhhhhhhhhhhhhhghhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12004:1364#0/1
GGAACCAGATCCAGGAGGAGATCAACGCCTCCT
+HWUSI-EAS1795_0092:3:1:12004:1364#0/1
hhghhghgghhhghghgghgghhfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12344:1357#0/1
CGCCTGGCAACCCATTTCCATTCTTTTATTTGA
+HWUSI-EAS1795_0092:3:1:12344:1357#0/1
hhhhhhhhhhhhhhhhhhhchhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12999:1353#0/1
CCTCGCCATTCTTGACCTTGCCATTCGGCTTGC
+HWUSI-EAS1795_0092:3:1:12999:1353#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:13202:1361#0/1
CGACGCTCTGGGCGGTTCCCAGAACTTCCTTGC
+HWUSI-EAS1795_0092:3:1:13202:1361#0/1
hhhhhhhhhhhhhhhhhhhhgfhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:13504:1363#0/1
CACCGTAACATTACGTTTGGTTCATCCCACAGC
+HWUSI-EAS1795_0092:3:1:13504:1363#0/1
hhhhhhhhhhhhhhhhhhfhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13955:1364#0/1
AGAACACTGGCTGCTGACCAGTCAGCTGCTCCA
+HWUSI-EAS1795_0092:3:1:13955:1364#0/1
ggggggggggggggfggafcddggegbggdggg
@HWUSI-EAS1795_0092:3:1:14003:1353#0/1
CTGGTGAGGGTGGCGAGCTGCCAGGCTACAAGG
+HWUSI-EAS1795_0092:3:1:14003:1353#0/1
gggggggffffff`fffaffff_ggggf]fffc
@HWUSI-EAS1795_0092:3:1:14230:1360#0/1
CGCTGTACCCGCAGAATGTGGTAGCAAAAGTCC
+HWUSI-EAS1795_0092:3:1:14230:1360#0/1
hhghhhhhhhhhfhfhhhhhhghhfhhhhghhh
@HWUSI-EAS1795_0092:3:1:15308:1364#0/1
GTTGGCAAGGACGCTTTCAACTGCCAGATTGTG
+HWUSI-EAS1795_0092:3:1:15308:1364#0/1
hhhhhhhhhghhgghhhhhfhhghhhhhhgchg
@HWUSI-EAS1795_0092:3:1:16439:1361#0/1
TCAAGTGCTGCAGCTGGAGGAGAACATTTATGC
+HWUSI-EAS1795_0092:3:1:16439:1361#0/1
hhhhhhhhhhhhhhhghhhhgghhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:16509:1357#0/1
CAAGGGCCCCGTGCGCATGCCGACCAAGACCCT
+HWUSI-EAS1795_0092:3:1:16509:1357#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16764:1355#0/1
GAAGGAGATTGCCCAGCAGCTGCAATTGCGGAA
+HWUSI-EAS1795_0092:3:1:16764:1355#0/1
gggfgcgfafffggcggefgcgfdcfdgcgfgg
@HWUSI-EAS1795_0092:3:1:16841:1358#0/1
CTCGCCCTTGATGGATTGACCGGGAATTCCGGG
+HWUSI-EAS1795_0092:3:1:16841:1358#0/1
hhhhghhhhhgghfhhhahhfhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16961:1360#0/1
AGTGGATGAGGAGTGGATGCATAAATGCAAGTG
+HWUSI-EAS1795_0092:3:1:16961:1360#0/1
hhhhhhhhhhhhhghhhfhhggghhhhghggcf
@HWUSI-EAS1795_0092:3:1:17100:1359#0/1
CATCGCACACCAGTATCATCTCTTGCAGCAGCT
+HWUSI-EAS1795_0092:3:1:17100:1359#0/1
gggggggggggggdgfgfggfgggcggfgdggg
@HWUSI-EAS1795_0092:3:1:17265:1353#0/1
GTTCAATGTCCTTGTCACCACCCACACTCAGCA
+HWUSI-EAS1795_0092:3:1:17265:1353#0/1
hhghghhhhghhhghhhhfhhhhhgghfhhghh
@HWUSI-EAS1795_0092:3:1:17455:1360#0/1
GTTCCGAAGGCGTCGCGAAGGAAAGACCGATTA
+HWUSI-EAS1795_0092:3:1:17455:1360#0/1
hhhhhhfhghhhhhhhghhhhfhcfdhffhhaf
@HWUSI-EAS1795_0092:3:1:17491:1360#0/1
GTTTGCTGTTGCTGTTGTTGTTGTTGCTGCTGT
+HWUSI-EAS1795_0092:3:1:17491:1360#0/1
cfddfffdffafgaggggfgeeaffffggaecb
@HWUSI-EAS1795_0092:3:1:17554:1363#0/1
GAATTAATTTAGCGGTTTTTGATGCTGTGGCTG
+HWUSI-EAS1795_0092:3:1:17554:1363#0/1
\^acc^cffeffgggfgdffffYfffffff_]f
@HWUSI-EAS1795_0092:3:1:17806:1360#0/1
GCCGCAACGGGCAACCGCGCCCGCCTCACCAAA
+HWUSI-EAS1795_0092:3:1:17806:1360#0/1
gggggeggggegggg]affff]aa\IWGSTSV_
@HWUSI-EAS1795_0092:3:1:19149:1357#0/1
CGCGTACCTAAACTACTTGACGCCCAAGTCGCG
+HWUSI-EAS1795_0092:3:1:19149:1357#0/1
ff_afc_fd]ffffdfaYX_LXbddbdfeccaa
@HWUSI-EAS1795_0092:3:1:19306:1355#0/1
TGATCAACTGGAGGCTGTCGTTATCTGCGGTTA
+HWUSI-EAS1795_0092:3:1:19306:1355#0/1
hhffhhhhhhhghhffhhchggcffffaeedcd
@HWUSI-EAS1795_0092:3:1:19542:1357#0/1
TGGAAACCTGACTTGATGCTGGCCACCGAGCAG
+HWUSI-EAS1795_0092:3:1:19542:1357#0/1
gfgggggggggggggggdfafffffffgeeggd
@HWUSI-EAS1795_0092:3:1:3156:1372#0/1
TCTCCACCCCCTTTTCGCATTTTCACCGACTTT
+HWUSI-EAS1795_0092:3:1:3156:1372#0/1
Wegegfggggcggggggcggfgggaggefdfff
@HWUSI-EAS1795_0092:3:1:3533:1367#0/1
AAGTCAGCTGTCAAGCAAGCGCAGGCGGAAGGC
+HWUSI-EAS1795_0092:3:1:3533:1367#0/1
ffedffdfbbbfggggdgggggdd_ffbggggc
@HWUSI-EAS1795_0092:3:1:4266:1373#0/1
CACGAAGAGATTCAGCGAAGTACGGCGCTGGTG
+HWUSI-EAS1795_0092:3:1:4266:1373#0/1
hhhhhhehghhggfhhghfedhhhfhegggfce
@HWUSI-EAS1795_0092:3:1:4326:1365#0/1
TCGCTCGTCAATTCATTACGAAATCCTATTCCT
+HWUSI-EAS1795_0092:3:1:4326:1365#0/1
hhhhfghhhhhhhgghhhghfghhhhhhhghgf
@HWUSI-EAS1795_0092:3:1:4756:1366#0/1
CACAAACACACACACACTCAAACACAAAACCAC
+HWUSI-EAS1795_0092:3:1:4756:1366#0/1
adggffaggfgfggdgggfgggggggggfgcg]
@HWUSI-EAS1795_0092:3:1:5223:1370#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5223:1370#0/1
hhhhhhhghhhhfhghhchffhfhhhfhghhhh
@HWUSI-EAS1795_0092:3:1:6168:1365#0/1
GGGAGACATTGCTGACCGCCGCCGGTCCGCAGG
+HWUSI-EAS1795_0092:3:1:6168:1365#0/1
gggegggggggggeggg_fffffgcbggggfgg
@HWUSI-EAS1795_0092:3:1:6371:1369#0/1
CGAGCGCACCGAAAGTCGGCGAGTTTTCTGGCG
+HWUSI-EAS1795_0092:3:1:6371:1369#0/1
ggggggggggeggggggcggf_gfggggggagg
@HWUSI-EAS1795_0092:3:1:6664:1365#0/1
CAGAAGCGCCTGAAGGTCCCACCACCAATCCAC
+HWUSI-EAS1795_0092:3:1:6664:1365#0/1
hhhhhhhhhhhhhhehhhhhghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:6697:1371#0/1
TGGCATGTCCAGAAGCTGGTCCAAGTCGACACC
+HWUSI-EAS1795_0092:3:1:6697:1371#0/1
hhhhhhehhhhhhhhhhhghhhhghghhffhhf
@HWUSI-EAS1795_0092:3:1:7046:1368#0/1
GCGGATGGCATTGGGATTCTTTTCTATGATGTA
+HWUSI-EAS1795_0092:3:1:7046:1368#0/1
hhhhghhhhghhhhhfgfhhhhhhhhfhchghh
@HWUSI-EAS1795_0092:3:1:7737:1371#0/1
CTGCTGTTGGCGATGACCACATCCTTGACGGGA
+HWUSI-EAS1795_0092:3:1:7737:1371#0/1
gggggggggggggagggffffeggggggggggg
@HWUSI-EAS1795_0092:3:1:8036:1369#0/1
TGTGCCGCGACCTGATCAACGGTGCAAAGAACC
+HWUSI-EAS1795_0092:3:1:8036:1369#0/1
gggfggggggggfggfgggggg_afffdafcce
@HWUSI-EAS1795_0092:3:1:8258:1375#0/1
CAAGCAGCTGAGTCGCGAAGAGGTCAGCGAGTA
+HWUSI-EAS1795_0092:3:1:8258:1375#0/1
gggggggggggggggg_gggfggfgggggefgg
@HWUSI-EAS1795_0092:3:1:9833:1374#0/1
CGTGACTCGAGGATGGCGGACGTGGCCTCCGGA
+HWUSI-EAS1795_0092:3:1:9833:1374#0/1
ggggggfggfgggggggdffc_aafffcffdde
@HWUSI-EAS1795_0092:3:1:9858:1374#0/1
CCACCGTCAAGCGAGGCACATCCGCCGGTCGCA
+HWUSI-EAS1795_0092:3:1:9858:1374#0/1
ggggfgggggggfcadfafacffffcfcaaR[b
@HWUSI-EAS1795_0092:3:1:10023:1371#0/1
GTGAATTTGGGTCCAGGCCGGGTACTTCTTGGT
+HWUSI-EAS1795_0092:3:1:10023:1371#0/1
aff[ffdf]dcfffccadffffdafffggcg[c
@HWUSI-EAS1795_0092:3:1:10405:1373#0/1
CTCGTGTCCAAATCGTCAACGGCCCCGGGAAAG
+HWUSI-EAS1795_0092:3:1:10405:1373#0/1
fffffffffffffffff^d^[`Y\\PXffacf[
@HWUSI-EAS1795_0092:3:1:11415:1373#0/1
CCGGATTTGGTGTTTTCCACTGGACGTCCTTGA
+HWUSI-EAS1795_0092:3:1:11415:1373#0/1
hhhghghhghgchhhhhhhgggahghhhghhhg
@HWUSI-EAS1795_0092:3:1:12371:1366#0/1
GGGCACTGGCAATGGCGACAAGGAGCGCAAGCG
+HWUSI-EAS1795_0092:3:1:12371:1366#0/1
hhhhhhhhhhhghhfgfhghhggffcghhhahh
@HWUSI-EAS1795_0092:3:1:12480:1375#0/1
GGTCGCTACAGACAACACATACGGACTTAAGGG
+HWUSI-EAS1795_0092:3:1:12480:1375#0/1
SK\\[\ZaececffdffbfWRWVMHZV__WVVd
@HWUSI-EAS1795_0092:3:1:12608:1375#0/1
GAGACAGAGAGCGCAAAGAGCTATAGCTGGCTC
+HWUSI-EAS1795_0092:3:1:12608:1375#0/1
hhhhhhhhhhhhhhhhhchgghfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12783:1367#0/1
CGCCTGTTGTTGCTGTTGCTGCTGCTTCTTTTT
+HWUSI-EAS1795_0092:3:1:12783:1367#0/1
ggffggcfafffdfdcffagggeaaffggggec
@HWUSI-EAS1795_0092:3:1:12924:1373#0/1
TTCGATTCCCGGACGCGGCACCGTCGTCACTGG
+HWUSI-EAS1795_0092:3:1:12924:1373#0/1
ggggeggggfgggggggg_cedfefefgg__gc
@HWUSI-EAS1795_0092:3:1:13143:1372#0/1
TTGCTGGCCCCATACACCTTGCAGTTGTAGCCG
+HWUSI-EAS1795_0092:3:1:13143:1372#0/1
cdgfffgggfgcgggggggafgefggceaece^
@HWUSI-EAS1795_0092:3:1:14417:1367#0/1
ATCATCAAGGGCGCCTTCGGCACCCGTGCCCGC
+HWUSI-EAS1795_0092:3:1:14417:1367#0/1
hhhhhhhhhhhfhhhhhhhhhhhhghfhhhhhh
@HWUSI-EAS1795_0092:3:1:14595:1372#0/1
TTTTGCGCGACTGTTCAAGCCAAGATACCGCTA
+HWUSI-EAS1795_0092:3:1:14595:1372#0/1
cccaVccVVTUab^]]]ZaaaZSPVQScc[caX
@HWUSI-EAS1795_0092:3:1:14819:1365#0/1
GGGTAAACAACAAAATCAGGAGTGCAGCTAACG
+HWUSI-EAS1795_0092:3:1:14819:1365#0/1
f[d[daa`^ZZ`a`Y]dffccccfffff_ffec
@HWUSI-EAS1795_0092:3:1:14944:1374#0/1
CCGGCGAGCCAACCTCTCCCTTCTGCCCCTTGG
+HWUSI-EAS1795_0092:3:1:14944:1374#0/1
ggfcggfcf^ffgggggfffRda^^dcfffdfW
@HWUSI-EAS1795_0092:3:1:15068:1373#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:15068:1373#0/1
d[fff]cffff[\\IaaSUUWUZVZZX^a^d^c
@HWUSI-EAS1795_0092:3:1:15366:1368#0/1
TGCGAACAATGCGCCGCTTGTTGGAGCGTGTGT
+HWUSI-EAS1795_0092:3:1:15366:1368#0/1
hhhhhhhhhhhhhhhghhhggghffhhhfgchg
@HWUSI-EAS1795_0092:3:1:15881:1365#0/1
GCTGGAGAAGAAGAAATCACGTCCCACCAAGCG
+HWUSI-EAS1795_0092:3:1:15881:1365#0/1
hfhhhhhghfhhddfhhfhhhehhhhhhhhafg
@HWUSI-EAS1795_0092:3:1:16171:1366#0/1
GCGAGGCGATGTCCAGGAATTTGTTCTCCAATT
+HWUSI-EAS1795_0092:3:1:16171:1366#0/1
hhhhhhhhhhgghhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16285:1370#0/1
GTTCAGCTTGTCCCTGACTTTTCCCTTGGACCA
+HWUSI-EAS1795_0092:3:1:16285:1370#0/1
ffccf_dbbbbbfff_Wfffffggad]`b`bde
@HWUSI-EAS1795_0092:3:1:16814:1373#0/1
CCAGTTTCGACAGTCCTGGTGGCGTCTTTCCGG
+HWUSI-EAS1795_0092:3:1:16814:1373#0/1
agfffacggggafefcfaa^acffdffcafffc
@HWUSI-EAS1795_0092:3:1:18024:1368#0/1
GCTTGTTCTCGTCCCGAGCTAAGGCCATTTGTT
+HWUSI-EAS1795_0092:3:1:18024:1368#0/1
hhhhhghhhgchhhfhcdhdhhgghdhhhcehg
@HWUSI-EAS1795_0092:3:1:18935:1374#0/1
CTACGGTAAGGGAGTCACCGGCGGCGTAGTCCT
+HWUSI-EAS1795_0092:3:1:18935:1374#0/1
ffdffffffW]fdI^ddU_BBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:19382:1371#0/1
GCTGATTGTCGGATTCGTTGCAGTACAGCACAG
+HWUSI-EAS1795_0092:3:1:19382:1371#0/1
ggfffdffffffffffWdfafafafcfcdfffd
@HWUSI-EAS1795_0092:3:1:19787:1368#0/1
AGTATGCATTGGCACTTGGCGGACCCATCAGTT
+HWUSI-EAS1795_0092:3:1:19787:1368#0/1
hhhhhhhhhhhhhfhhhfhhhhhhhhhehhghh
@HWUSI-EAS1795_0092:3:1:2091:1386#0/1
ACGCCCTGATCCGCACCTGCATGGCGGACTACT
+HWUSI-EAS1795_0092:3:1:2091:1386#0/1
a`Yaaca`b[db]ddbdb^aWbc_cccccefcR
@HWUSI-EAS1795_0092:3:1:2966:1382#0/1
CTGCGCTAATTGGCGACCAAACTCGAGAAGACC
+HWUSI-EAS1795_0092:3:1:2966:1382#0/1
hhhhhhhhhhhgfhhhhhhhhhghhhghh_ghg
@HWUSI-EAS1795_0092:3:1:3009:1377#0/1
GTCTTCTCGTCTTTTAAATAAATTTTAGCTTTT
+HWUSI-EAS1795_0092:3:1:3009:1377#0/1
aafffcffacc[ffcc]^\Z^^_]cdcfdcffd
@HWUSI-EAS1795_0092:3:1:3543:1388#0/1
CCACAGGTCCATCGTTGCCAGTCAAGCCAGTAG
+HWUSI-EAS1795_0092:3:1:3543:1388#0/1
gggggfggggdffaafaaddffggggfcfeefg
@HWUSI-EAS1795_0092:3:1:4143:1388#0/1
ATGATCTCGAACGAGTGCTTGACGATGCGGCAG
+HWUSI-EAS1795_0092:3:1:4143:1388#0/1
gggggggggggggeedgggg_ggggggggdggg
@HWUSI-EAS1795_0092:3:1:4406:1377#0/1
ATCCACTCGAAGGCCGTGTCCACCTGCAACTCC
+HWUSI-EAS1795_0092:3:1:4406:1377#0/1
hhhhhhhhhhhhhhhhhhhhghhhehhhghfhh
@HWUSI-EAS1795_0092:3:1:4586:1383#0/1
GTTCGTTCGAAAGCCGTGCGCTAGCTTCAATTT
+HWUSI-EAS1795_0092:3:1:4586:1383#0/1
f_fafffgfggggfgggdfaddgggeggg_ggf
@HWUSI-EAS1795_0092:3:1:4680:1378#0/1
CGGCGCTTCAATTGACGACACGCCACAGCCACA
+HWUSI-EAS1795_0092:3:1:4680:1378#0/1
gggfggggcggfgggggf_faffffffaggg_f
@HWUSI-EAS1795_0092:3:1:4867:1388#0/1
CGAGATCGTGCCCCCGGGCAGCTACCTCCACCT
+HWUSI-EAS1795_0092:3:1:4867:1388#0/1
fff_YWfaY]b]\IZ[a[\[^T^BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5417:1379#0/1
CGGGAGTGTAGTTGGGGCCCATGATTCGGCACT
+HWUSI-EAS1795_0092:3:1:5417:1379#0/1
ad`bRbWbW`]`^^\X]ZZ]X^\Y^YTRRIPKa
@HWUSI-EAS1795_0092:3:1:5865:1386#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5865:1386#0/1
ggggegffdcfdf]dffafffcffd_ffWfaf_
@HWUSI-EAS1795_0092:3:1:6358:1382#0/1
ACGACTATGGCGAAGTGAACCAGCTCCTGGTGC
+HWUSI-EAS1795_0092:3:1:6358:1382#0/1
hhhhhhhhhhhghhdfgfffffghehhfhhdef
@HWUSI-EAS1795_0092:3:1:6647:1385#0/1
AAAATAATTGCTTCTATTGCAATTGGACAACAA
+HWUSI-EAS1795_0092:3:1:6647:1385#0/1
hhhhhhhfghhhhhghhhghfhghhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:6765:1385#0/1
CGAAATCGACTCCGTGGTGACTCAGCTAAAGAA
+HWUSI-EAS1795_0092:3:1:6765:1385#0/1
ggggfggfffafffcffafcfffdfffggfggc
@HWUSI-EAS1795_0092:3:1:6785:1384#0/1
GCAAGGAAGTTCTGGGAACCGCCCAGAGCGTCG
+HWUSI-EAS1795_0092:3:1:6785:1384#0/1
gggggggdggggggggafff]ffccd[`cc]cf
@HWUSI-EAS1795_0092:3:1:6852:1385#0/1
ACCCACTCGTGGGTACACGCCAACCGGACGGCC
+HWUSI-EAS1795_0092:3:1:6852:1385#0/1
VGS[TOLfffffcHeec^_a_^KYZ__d`]]Wf
@HWUSI-EAS1795_0092:3:1:7148:1385#0/1
GGATCACTTCATCAAGCTGTACAAGAAGAAGAA
+HWUSI-EAS1795_0092:3:1:7148:1385#0/1
gfcgggggecfggggegecgggggaggfgfgff
@HWUSI-EAS1795_0092:3:1:7770:1387#0/1
TTTAAGTTATGAAGCCATCTAAGAGGTTGATGG
+HWUSI-EAS1795_0092:3:1:7770:1387#0/1
hhhhhhhhhhcgfffffhhghhhhhchfcfhhh
@HWUSI-EAS1795_0092:3:1:8375:1380#0/1
CTGCCTGGACAGAAGGGTGAACCAGGAATGCTG
+HWUSI-EAS1795_0092:3:1:8375:1380#0/1
acaaccXc\ccccaaccaYcc_ccccccccc]c
@HWUSI-EAS1795_0092:3:1:8977:1382#0/1
CGAGATCAAGTCAGCATTTGCCCTTTTGCTCTA
+HWUSI-EAS1795_0092:3:1:8977:1382#0/1
hhhhhhhhhghhhhhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:9264:1385#0/1
TTTCAAAGTATCTGAGTCCGCTACGGAGGAGGA
+HWUSI-EAS1795_0092:3:1:9264:1385#0/1
hhhhhhhhghhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9474:1386#0/1
AAGAAGGATGGCCAATTTTTGGTTACCACCTCG
+HWUSI-EAS1795_0092:3:1:9474:1386#0/1
ggggegacfffcgfdggggcggegfgcfffcfg
@HWUSI-EAS1795_0092:3:1:9544:1381#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9544:1381#0/1
ggggggggggcgefgggggggggegggcgggfg
@HWUSI-EAS1795_0092:3:1:9936:1379#0/1
AGTCAAGATGCTCGATGCACGAGCTGCTAATCA
+HWUSI-EAS1795_0092:3:1:9936:1379#0/1
ggggggggcgdggefgggeggWfffffeggggg
@HWUSI-EAS1795_0092:3:1:10264:1386#0/1
GACAAACTGAAACAGCTAAATCACTCGTTTGAG
+HWUSI-EAS1795_0092:3:1:10264:1386#0/1
hhhhhhhhhghhhhhhhhhghhhhchfhhgehh
@HWUSI-EAS1795_0092:3:1:10877:1383#0/1
TGCGAGGTTGTCGTGTCCGGCAAACTGCGTGGT
+HWUSI-EAS1795_0092:3:1:10877:1383#0/1
hhhhhhhhhhhhhhgdhhhhhhhhghhfhdhhd
@HWUSI-EAS1795_0092:3:1:10939:1388#0/1
GTCGCAAGCGGAGGGTTGGATCTGCCGCCCCCA
+HWUSI-EAS1795_0092:3:1:10939:1388#0/1
hhhhhhhhhghghhhghgghhgbhghghghhhh
@HWUSI-EAS1795_0092:3:1:11162:1383#0/1
TGTGAAAGAAAAAACATGCCGCTAGCAAAAGAT
+HWUSI-EAS1795_0092:3:1:11162:1383#0/1
ggggggffgggg`fffcgggfggggfgggdeeg
@HWUSI-EAS1795_0092:3:1:11340:1378#0/1
TGTCAACCTACATTTATTAGAAAACAAATGGTT
+HWUSI-EAS1795_0092:3:1:11340:1378#0/1
hhhhhhhhhhhhhhhchhfhhfhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:11530:1379#0/1
GAAAAGAAAGCGAGATGATCACCTGAATGAAAG
+HWUSI-EAS1795_0092:3:1:11530:1379#0/1
hhhhhhhhhhhhhhhcdfhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:11936:1379#0/1
GAACGGCCTCGAGTCGTACTGCTTCAACATGAA
+HWUSI-EAS1795_0092:3:1:11936:1379#0/1
hhhhhhhhhhhhhfhhhhgheghhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11979:1383#0/1
CAACAGCAGTGTCGAGAAAAAGCGGGAAATCCA
+HWUSI-EAS1795_0092:3:1:11979:1383#0/1
hhhhhhhhhhhhhhgfhhghhcghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12160:1384#0/1
CGCGCTCATATATTTGGCCAGCACGTTGCAGAC
+HWUSI-EAS1795_0092:3:1:12160:1384#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:12415:1381#0/1
GCTGGAAGAAGGTCGAGAAGATCTTGATGTCAT
+HWUSI-EAS1795_0092:3:1:12415:1381#0/1
gggggfggggcggggag`d[dbffff]\d`dac
@HWUSI-EAS1795_0092:3:1:13216:1388#0/1
GTAATCGGTTCCACGGCTAGGAAGAACTCGTGC
+HWUSI-EAS1795_0092:3:1:13216:1388#0/1
hhhhhhhghhhhhhhhhghafdhfdhhhhhgfh
@HWUSI-EAS1795_0092:3:1:13400:1384#0/1
GCAAGAAGCAGGCGGCCGCTGAGGCTGCTGCTG
+HWUSI-EAS1795_0092:3:1:13400:1384#0/1
fffffffffffffffcdBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13631:1379#0/1
ATAATGTGCCCAGTGGGCCACTTTTGGTAAGCA
+HWUSI-EAS1795_0092:3:1:13631:1379#0/1
ggggg_ggggggggggdgggggggggfggegfd
@HWUSI-EAS1795_0092:3:1:13788:1380#0/1
GGGCTACACTTTGGATCCGGGGCTTGATGGGAG
+HWUSI-EAS1795_0092:3:1:13788:1380#0/1
ggggggefgggggggfgggggggggggdfffeg
@HWUSI-EAS1795_0092:3:1:13928:1378#0/1
CAAAAAACGTACAAGAAGGAAAGAAGGAATAAA
+HWUSI-EAS1795_0092:3:1:13928:1378#0/1
hhghhhhhhhhhghghghhhhhfhghhhfdhhg
@HWUSI-EAS1795_0092:3:1:14272:1381#0/1
TTAAGATATAATTTTGGGTGTAGCCGTTCAAAT
+HWUSI-EAS1795_0092:3:1:14272:1381#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:14626:1377#0/1
GGAAATGATACACGTTCCATTTAATCAAGTAAG
+HWUSI-EAS1795_0092:3:1:14626:1377#0/1
hhhhhfhhhhhhhhhhhhhhhhhghhhhhehhh
@HWUSI-EAS1795_0092:3:1:14765:1378#0/1
CCTTGATGGACACCCTGCTAGGGAAGTACTTGT
+HWUSI-EAS1795_0092:3:1:14765:1378#0/1
hhhhhhhhhhhhhhhhhghhhhghghghehhhh
@HWUSI-EAS1795_0092:3:1:15195:1384#0/1
AGACTGTCCACAAAGACGCCCTACAGAGCGATC
+HWUSI-EAS1795_0092:3:1:15195:1384#0/1
cfcdf_ffdfdcfd[ffffffffff]f]de]da
@HWUSI-EAS1795_0092:3:1:15495:1381#0/1
TGCAGCAGAAGCGCAGAGAACCCGTGCAGGCTG
+HWUSI-EAS1795_0092:3:1:15495:1381#0/1
hhhhhhhhhhhhhhhhhfhhfhhhghghhghah
@HWUSI-EAS1795_0092:3:1:15826:1378#0/1
TCCTGGCCGGCTACTATGGAGCAGCCGGTGCCG
+HWUSI-EAS1795_0092:3:1:15826:1378#0/1
faffcaffafad_cad]ffWfRccc]`bX`dbB
@HWUSI-EAS1795_0092:3:1:17614:1379#0/1
TTAGTCTTTAATCTCTCACTTCTTCTATTAATA
+HWUSI-EAS1795_0092:3:1:17614:1379#0/1
hhhghhhhhhhhhhhhhhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18215:1387#0/1
CCCGGGTAACAATGTAGCTGATAATAACGTTCT
+HWUSI-EAS1795_0092:3:1:18215:1387#0/1
hhhhhhghhhhhhghhhhhhgfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18430:1380#0/1
CGCTTGGTAAGATCGACATCGGCCTTCTTCAGC
+HWUSI-EAS1795_0092:3:1:18430:1380#0/1
hhhhhhhhhhhhfhhhhhghhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:18448:1383#0/1
GCTATCGTCGCGGCACACGGGACATGTTTTCCC
+HWUSI-EAS1795_0092:3:1:18448:1383#0/1
daffffffffdddfcfaaadfWfaccaffbcaf
@HWUSI-EAS1795_0092:3:1:18615:1387#0/1
TGATCGGTTCGAGGCTCCCACCACAAGTACCAG
+HWUSI-EAS1795_0092:3:1:18615:1387#0/1
d\ca\dadf_d\cccd[`Xa\PVS``_a^W[af
@HWUSI-EAS1795_0092:3:1:18913:1379#0/1
CAGCACTCCATGATCCCGCATGCCGACGATGGC
+HWUSI-EAS1795_0092:3:1:18913:1379#0/1
YT\`^[_a]ZY`UP^^Yccccaa`^]bXWWYXc
@HWUSI-EAS1795_0092:3:1:19303:1380#0/1
GCAGTGTGTTTGGTTTTGTTCTAGTATGAATTT
+HWUSI-EAS1795_0092:3:1:19303:1380#0/1
ggggfggdcffffeffdccccfgggggfc_ggc
@HWUSI-EAS1795_0092:3:1:2754:1389#0/1
TCCTCGCTGGCCATCGCTCCTCCGCACACTCTC
+HWUSI-EAS1795_0092:3:1:2754:1389#0/1
gggggfgdcffffcfcfdffdffdfffffdfdg
@HWUSI-EAS1795_0092:3:1:3163:1394#0/1
GTTGCGTTAAGCCACGTGCTGAATTTCTTAATT
+HWUSI-EAS1795_0092:3:1:3163:1394#0/1
gggggfgggggggggggfggeceggfefccdfg
@HWUSI-EAS1795_0092:3:1:3221:1391#0/1
GAAAAGTTAACAGAAATTAATGGATTTCGGTTT
+HWUSI-EAS1795_0092:3:1:3221:1391#0/1
hhhhhehhhhghaghhhfhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:3456:1397#0/1
AAGCTTGCTAACTTCTGGCTTACAGTGCGTTAA
+HWUSI-EAS1795_0092:3:1:3456:1397#0/1
_fdYffffcfffafffcafffcfdfefffefcf
@HWUSI-EAS1795_0092:3:1:3772:1394#0/1
GGCGGGTTGTGTGAGCAGTGGCCTCTGCATTCT
+HWUSI-EAS1795_0092:3:1:3772:1394#0/1
geggggggggegf_fffgfggcfffc]ggegcc
@HWUSI-EAS1795_0092:3:1:3941:1391#0/1
AGTACATGGGTCGATGACCGTACAAGATGATCC
+HWUSI-EAS1795_0092:3:1:3941:1391#0/1
ffffffcdff`ff]ffdggcggggggg[bddef
@HWUSI-EAS1795_0092:3:1:4115:1389#0/1
GTGGCTGTCTCGCGCGCCTGCAGGCGTGATATA
+HWUSI-EAS1795_0092:3:1:4115:1389#0/1
fffffffafffcab[dbdP^a^`b`b`^WZ^^c
@HWUSI-EAS1795_0092:3:1:4511:1395#0/1
TCCACCTTATCGGGAGTGCTCTTGTGCGTGTCC
+HWUSI-EAS1795_0092:3:1:4511:1395#0/1
hhhhghhhhhhhdghghfhfhhhafaeehfhhg
@HWUSI-EAS1795_0092:3:1:4558:1388#0/1
CCGAAAAGTCTGTGCTTTGTTCTTAAATTCACC
+HWUSI-EAS1795_0092:3:1:4558:1388#0/1
gfggfggggggfgggggdgggeggggggggggg
@HWUSI-EAS1795_0092:3:1:4905:1397#0/1
CTTGAGATCCATCCTTGCGCCGTCCCAGATTCC
+HWUSI-EAS1795_0092:3:1:4905:1397#0/1
c[c_aacJVN^P]`Z`]c_a]_]Z`Q`POTPZc
@HWUSI-EAS1795_0092:3:1:5014:1399#0/1
GACAAAATTCGTCCCCTGTGGAGGCACTACTTC
+HWUSI-EAS1795_0092:3:1:5014:1399#0/1
[_YaaaZZaY`aaaP_aW]\WVNRFSRc[cccc
@HWUSI-EAS1795_0092:3:1:5465:1396#0/1
TTTACACATACATATATTTAGCTACGTTCGTAT
+HWUSI-EAS1795_0092:3:1:5465:1396#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6026:1393#0/1
AGCAGCTGCTCCCTTAACCGCAGATAACGACAG
+HWUSI-EAS1795_0092:3:1:6026:1393#0/1
hhhhhhhhfghhhhhdhhhehhfhehhhghghh
@HWUSI-EAS1795_0092:3:1:6138:1392#0/1
GCAAAACTGAGCAAAGTATGCATATCCAAGTTG
+HWUSI-EAS1795_0092:3:1:6138:1392#0/1
aaggggggcegcggggafffffgfgWgggfgeg
@HWUSI-EAS1795_0092:3:1:6811:1392#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6811:1392#0/1
hhhhhhhhhhggchhhhehhhhdhhghhfhghe
@HWUSI-EAS1795_0092:3:1:6977:1397#0/1
ATAGCCCACAAAAATACTTTTAAATGATTTATC
+HWUSI-EAS1795_0092:3:1:6977:1397#0/1
hhhhhhhhhhhhhhghhhhhhhhghdhhhhhhh
@HWUSI-EAS1795_0092:3:1:7459:1399#0/1
AAGTATATAAACACCCCGTCCCTCCTCCTGAAC
+HWUSI-EAS1795_0092:3:1:7459:1399#0/1
ggfafddffffafffffggegecfccdggdggf
@HWUSI-EAS1795_0092:3:1:8588:1398#0/1
GGTGGCTGTCTTCTTTGGCGGAATGGCTATTCA
+HWUSI-EAS1795_0092:3:1:8588:1398#0/1
hhhhfhhhhghhhhhhchghhhfhhhgghhhgf
@HWUSI-EAS1795_0092:3:1:9115:1400#0/1
CGTTCCCTTGTGCAATAATTTGAATGGAAGCTT
+HWUSI-EAS1795_0092:3:1:9115:1400#0/1
ggggggfggdgggdggcggggcfffffgggggg
@HWUSI-EAS1795_0092:3:1:9147:1394#0/1
GCGGCAGATTAAAAGTGAAGTAGCAATTAAACG
+HWUSI-EAS1795_0092:3:1:9147:1394#0/1
ggggggggggggggggeff_dfgfggfggggfg
@HWUSI-EAS1795_0092:3:1:9577:1397#0/1
GTAAATGTGTGTGTGTGGTGTATGTGTGTATGA
+HWUSI-EAS1795_0092:3:1:9577:1397#0/1
hhhhhhhhhhhhhhfhhffdfffhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:9736:1399#0/1
GCAGGCATCACAAGTTGGTGGCTTCGAGTCAGA
+HWUSI-EAS1795_0092:3:1:9736:1399#0/1
hhhhhhhhhhhghhhhhhdhhhhghhhhdgehc
@HWUSI-EAS1795_0092:3:1:9918:1389#0/1
GTTTGTATATGTTTGTATATAGGAAATGCCTTT
+HWUSI-EAS1795_0092:3:1:9918:1389#0/1
hhhhfhhhhhhhhhhhchhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10095:1391#0/1
GCGGTGGGCGAAGCGGACATCTTAGCTGATTGA
+HWUSI-EAS1795_0092:3:1:10095:1391#0/1
hhhhghhhhfhhhhfhghhdehhghchh_hhga
@HWUSI-EAS1795_0092:3:1:11612:1396#0/1
AGCTGCTCGAACTGTTTACGATGCTCTTTCTCC
+HWUSI-EAS1795_0092:3:1:11612:1396#0/1
gggfdgggggggfdgggggggcegggggggggg
@HWUSI-EAS1795_0092:3:1:12474:1396#0/1
TGTTGCCTCAGCTTAAAAAACGCTTAACATTAG
+HWUSI-EAS1795_0092:3:1:12474:1396#0/1
ffeffffcfff_gaggggggcggfggefafccf
@HWUSI-EAS1795_0092:3:1:12570:1397#0/1
CTTGGACGAGGTGTCGATGAACTTGAGCTTGAT
+HWUSI-EAS1795_0092:3:1:12570:1397#0/1
gaggggggdgggfefffggdggggcefgggcgg
@HWUSI-EAS1795_0092:3:1:12876:1396#0/1
GCCTTCTCTCCCTCTATCTCGGATTATCTCGTT
+HWUSI-EAS1795_0092:3:1:12876:1396#0/1
hhhfhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12906:1389#0/1
TCTAGTTTAATGTTAATACTAGTTAATAAAAAT
+HWUSI-EAS1795_0092:3:1:12906:1389#0/1
fffdcddf[ddcffffcfcf]fcWfffdc___c
@HWUSI-EAS1795_0092:3:1:13165:1392#0/1
GTCCTTTCGTACTAAAATATCACAATTTTTTAA
+HWUSI-EAS1795_0092:3:1:13165:1392#0/1
hhhhhhhhhhhhhhhhhhhhghhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13600:1391#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13600:1391#0/1
hhhhhgehhchhhghhhghhhcghhdhhghhhh
@HWUSI-EAS1795_0092:3:1:13885:1393#0/1
AAGGTGTTGCGCGATCCCCGCAAGCGTGTGTTC
+HWUSI-EAS1795_0092:3:1:13885:1393#0/1
gagggcgffefeggggfggagefdfad_cfccg
@HWUSI-EAS1795_0092:3:1:14661:1396#0/1
GGTTAAGTGTGAGTGGGTGTGCGTGTTGATGGT
+HWUSI-EAS1795_0092:3:1:14661:1396#0/1
fffffafffff`a[a^aY\ZaZa`eda`Y^aa`
@HWUSI-EAS1795_0092:3:1:14770:1398#0/1
ATACGCTGGCCAACGCATCGCCAAAGCCTCTAT
+HWUSI-EAS1795_0092:3:1:14770:1398#0/1
gcgfgggggegggcgggdgggffggggfggggg
@HWUSI-EAS1795_0092:3:1:15002:1391#0/1
AGACTATCAAGATGGGTCGTATGCACGCTCCTG
+HWUSI-EAS1795_0092:3:1:15002:1391#0/1
hhhghhhhhhgghchhhhhhdhfhhghhhhhfh
@HWUSI-EAS1795_0092:3:1:15790:1393#0/1
GGGCGGACAGCGGGGAGTACAATCCAATGGAGC
+HWUSI-EAS1795_0092:3:1:15790:1393#0/1
hhffhhghghgffhg`ccghhhegggghhcdhh
@HWUSI-EAS1795_0092:3:1:16105:1399#0/1
GCTACACCCAAAATTATATCTTAATCCAACATC
+HWUSI-EAS1795_0092:3:1:16105:1399#0/1
dfagdgfc^fedcddffcafccfffdfffffaa
@HWUSI-EAS1795_0092:3:1:16563:1396#0/1
GTCCGTAGTCAAGTCCATTCCGTGAAAGTTACA
+HWUSI-EAS1795_0092:3:1:16563:1396#0/1
gggggfggggggfdfffgggggggggggfggeg
@HWUSI-EAS1795_0092:3:1:16766:1389#0/1
CCCGGAGCATTAGGACCTCGGGCATCGGAGTTA
+HWUSI-EAS1795_0092:3:1:16766:1389#0/1
ggggg_gggefggggggcfffffcfKfc_]ccg
@HWUSI-EAS1795_0092:3:1:17456:1392#0/1
CGTGAATTGCATGGTTGGTGCGGGCGAGTTATG
+HWUSI-EAS1795_0092:3:1:17456:1392#0/1
ffdgdggdfffc_ffff_dfffffaf]fffWce
@HWUSI-EAS1795_0092:3:1:17749:1398#0/1
GACATCTTGAGTTTATATTATTTGCTACGGAGC
+HWUSI-EAS1795_0092:3:1:17749:1398#0/1
ce_deadeeaecfcf_cfYffffcfffafffff
@HWUSI-EAS1795_0092:3:1:17922:1390#0/1
CGAAAGTGTGGGACCTCTTCTACGAGTCCGATC
+HWUSI-EAS1795_0092:3:1:17922:1390#0/1
]ffcacf`b[d`_c`cfdRabb^^W^^^^\Y\a
@HWUSI-EAS1795_0092:3:1:17968:1388#0/1
GCGCACACCAGATGGTTGAACAGCTTCACCCGG
+HWUSI-EAS1795_0092:3:1:17968:1388#0/1
ffgggggggg]]a^ddacffffbffdWff[ff]
@HWUSI-EAS1795_0092:3:1:18161:1392#0/1
GGCTCCCCCGACAGCCACCATTCATGAGATCCT
+HWUSI-EAS1795_0092:3:1:18161:1392#0/1
gggggggggggggdggdggegggggggegfggg
@HWUSI-EAS1795_0092:3:1:18320:1400#0/1
GAAAAACCTAAAAAAAATGTGAGACAAGTACGA
+HWUSI-EAS1795_0092:3:1:18320:1400#0/1
hhhhhhgghhhghfgfhhdgghghghhfafhhh
@HWUSI-EAS1795_0092:3:1:18457:1398#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:18457:1398#0/1
hhghhhhhhhhgfhhhhdfffffhhgcgghhhe
@HWUSI-EAS1795_0092:3:1:19587:1395#0/1
AATTCTGGAGGTATCACTGGAGTGTGTTCCACT
+HWUSI-EAS1795_0092:3:1:19587:1395#0/1
hfhhhhehhhhgffffffhge_affffghfggh
@HWUSI-EAS1795_0092:3:1:19745:1397#0/1
CTGGGCAGTCGTCTCCGTGAACATTATCGCAAG
+HWUSI-EAS1795_0092:3:1:19745:1397#0/1
hhhhhghhghhhhhhhhhhhhhahcghhhhhhh
@HWUSI-EAS1795_0092:3:1:19765:1398#0/1
CGTTCGGAAAGGCGCCCATCGCGTGCGACAGGA
+HWUSI-EAS1795_0092:3:1:19765:1398#0/1
ggggggggggggggggggggfggggggcacffg
@HWUSI-EAS1795_0092:3:1:2318:1404#0/1
TAGACCCCAACGCAGGTGATGGCGAGCCCAAAG
+HWUSI-EAS1795_0092:3:1:2318:1404#0/1
fagggggdefffffde`ffccfd^`\efffffc
@HWUSI-EAS1795_0092:3:1:2433:1402#0/1
CTCAAGCAGCCCGAAACCAAGGCCGTGCTTCTC
+HWUSI-EAS1795_0092:3:1:2433:1402#0/1
egfccffffffff_fcfccfcfed[^WNUVSTf
@HWUSI-EAS1795_0092:3:1:2555:1406#0/1
CTGCGTTTGTGCTTGTTTGACTTTGGCTTGAGC
+HWUSI-EAS1795_0092:3:1:2555:1406#0/1
ggfcgggfgggcfffffgggfgggg]dfc]afg
@HWUSI-EAS1795_0092:3:1:4004:1409#0/1
GATTGCGCAGGACACGCAGTAGTGGAGCTTCGC
+HWUSI-EAS1795_0092:3:1:4004:1409#0/1
hhhhhhhhhhghhhhhhghhhfhghhhghfhhh
@HWUSI-EAS1795_0092:3:1:4218:1403#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4218:1403#0/1
f_fffdff_dd\dadeefffffffgggffcfff
@HWUSI-EAS1795_0092:3:1:4416:1402#0/1
CTGGCCTTCATGGGACCGCTCAAGAAGGATCGT
+HWUSI-EAS1795_0092:3:1:4416:1402#0/1
hhhhhhhhhhghhhhhhhhhhhhhhfhghhhhf
@HWUSI-EAS1795_0092:3:1:4549:1408#0/1
GACAGACCCACATCTCCCTGGCCGCGTCGGAGC
+HWUSI-EAS1795_0092:3:1:4549:1408#0/1
SVTYS\Y\__WSPXS]`cP^aabV`aBBBBBBB
@HWUSI-EAS1795_0092:3:1:4667:1404#0/1
TTGCCTTCTTCATCTCTAAGATGTCCACCTTTG
+HWUSI-EAS1795_0092:3:1:4667:1404#0/1
hhhhhhhhhhhhghgghhggghghhfhhghhhh
@HWUSI-EAS1795_0092:3:1:4733:1408#0/1
CCGTGCCGTGTTCGTGCGCCGCCGCTCCCCATC
+HWUSI-EAS1795_0092:3:1:4733:1408#0/1
ggg_ffgfedffgaeggffggdfd_dfffcc_Y
@HWUSI-EAS1795_0092:3:1:5239:1406#0/1
AATGGATCCTCAGCAAAAACCATCGGCACTTTC
+HWUSI-EAS1795_0092:3:1:5239:1406#0/1
_ca\abcW\\]\cccccccaccccccacccccc
@HWUSI-EAS1795_0092:3:1:5875:1411#0/1
TCCAGATGCGTTCAGTGTTGGTGCACGCATGTT
+HWUSI-EAS1795_0092:3:1:5875:1411#0/1
cecddec]Yecc\\ZZ_baa]]a]aXa^a^cce
@HWUSI-EAS1795_0092:3:1:6004:1407#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6004:1407#0/1
ff_fffffdchdhhhggffc_fhhhfhhg[heh
@HWUSI-EAS1795_0092:3:1:6534:1411#0/1
GCGTACTTTACCGCGCGTTCAAATCGGCAATCT
+HWUSI-EAS1795_0092:3:1:6534:1411#0/1
ggggggggegggg]afggggggggggegggfgd
@HWUSI-EAS1795_0092:3:1:6797:1406#0/1
CAGATCCGCAGTTGCAGGATCCCTTGGTGGCCT
+HWUSI-EAS1795_0092:3:1:6797:1406#0/1
gggggdgggfggfcfcff]affffffa[dddfc
@HWUSI-EAS1795_0092:3:1:6842:1401#0/1
ATCCACTCGTGGGTACACGCCAACCGGACGGCC
+HWUSI-EAS1795_0092:3:1:6842:1401#0/1
hhhhhhhhhhghhhhfhfhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8524:1408#0/1
CCAGGAACTGCGGCCTGTAGCGGTTTCGCGGCT
+HWUSI-EAS1795_0092:3:1:8524:1408#0/1
hhhhhhhhhhhhhhhhhghhhhhghhhggggdg
@HWUSI-EAS1795_0092:3:1:8672:1402#0/1
ATCGATGGTACCTACATCGACAAGAAGTGCCCC
+HWUSI-EAS1795_0092:3:1:8672:1402#0/1
hhhhhhhhhhhhhghhghhhhhhhhfhghhhhg
@HWUSI-EAS1795_0092:3:1:8740:1402#0/1
GCACCTCGGAGATGTAGCTGGACCACTTGTCCA
+HWUSI-EAS1795_0092:3:1:8740:1402#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8916:1406#0/1
GAGAAATATGGAGAAAGATCACAACAGCAAAAG
+HWUSI-EAS1795_0092:3:1:8916:1406#0/1
hhhhhhhhffhghhhhcghhhghhhhegfhhhg
@HWUSI-EAS1795_0092:3:1:9174:1401#0/1
CGGGCTGGGTTCACGTTGCACCGCTTGCGCAGG
+HWUSI-EAS1795_0092:3:1:9174:1401#0/1
_a^_^\_ZaQaa[\a^\PZY[Yb\_S`ac_ccZ
@HWUSI-EAS1795_0092:3:1:9484:1407#0/1
AAGACGGCTGAGTACAAGAAGTACGGCGGTCCC
+HWUSI-EAS1795_0092:3:1:9484:1407#0/1
gggggggggggacffffafffcgggggggagge
@HWUSI-EAS1795_0092:3:1:9894:1408#0/1
GCAGGACAGCGGAAGCGCGGCGGAGGGCAGCCT
+HWUSI-EAS1795_0092:3:1:9894:1408#0/1
]fdfffac^WW^SSZ^PTQSR[fee[c_^^a^S
@HWUSI-EAS1795_0092:3:1:10039:1400#0/1
CAAGATCCCCCCGCCCAGCAAGCCACTGGACGA
+HWUSI-EAS1795_0092:3:1:10039:1400#0/1
hhhfhfhhhhhhhchhhdffgdhfhhggdhhgh
@HWUSI-EAS1795_0092:3:1:10442:1406#0/1
CTCAGGTCTTTGCCAATTCATTAAAAGAGTTGA
+HWUSI-EAS1795_0092:3:1:10442:1406#0/1
gggggggggggfggegggggggfggffggggeg
@HWUSI-EAS1795_0092:3:1:11200:1406#0/1
TCGAGGTCTTGTGGCCCTTGTTCAGGCCAATAG
+HWUSI-EAS1795_0092:3:1:11200:1406#0/1
gfggggggggfegggggggggggggggdffefg
@HWUSI-EAS1795_0092:3:1:11665:1400#0/1
GTTCACGAAACGAGTGCGACCTGTGGGGCTCTC
+HWUSI-EAS1795_0092:3:1:11665:1400#0/1
hhhfhhghhgffhhfhccfcffffghgffefff
@HWUSI-EAS1795_0092:3:1:12399:1402#0/1
CCTGGTTGTGGGCATAGTCATTGCCATCGACGT
+HWUSI-EAS1795_0092:3:1:12399:1402#0/1
hhghhhhhhhhhhhfhhhhhhhghfhhhhhhhg
@HWUSI-EAS1795_0092:3:1:12517:1410#0/1
CTGGAACCACTTCATGGCATCCTCCTTGGTGAG
+HWUSI-EAS1795_0092:3:1:12517:1410#0/1
hhhhhhhhhhhhhhhhhhghhhehhhhhghhhh
@HWUSI-EAS1795_0092:3:1:12674:1406#0/1
CGGTGTTCAGTACACACAGGGACAGCAAAAGCT
+HWUSI-EAS1795_0092:3:1:12674:1406#0/1
ggfaafafdaffaffffffcaccggggggg]cW
@HWUSI-EAS1795_0092:3:1:12787:1406#0/1
GAAGTTCGTCGTCTACGTCGAGAAGATCCAGCG
+HWUSI-EAS1795_0092:3:1:12787:1406#0/1
hhhhhhhhhhhhhhghhghghahhchhhhhfhf
@HWUSI-EAS1795_0092:3:1:13231:1409#0/1
GTGTCGGTGTGTGGGTGCGTTTCTGTTTTCAAG
+HWUSI-EAS1795_0092:3:1:13231:1409#0/1
fffffdfbdbcddddadca^ccWa_acfc`fac
@HWUSI-EAS1795_0092:3:1:13476:1409#0/1
CGATAAACATTTCGATGCAGATGAGGAAATTCT
+HWUSI-EAS1795_0092:3:1:13476:1409#0/1
hhhhhhhhhhhhhhhhhhhfgfdfhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:13522:1408#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13522:1408#0/1
hhhhhghhhgfhheghhghhhfcegafgehhhf
@HWUSI-EAS1795_0092:3:1:13550:1401#0/1
CCCAGCTCCTCAATTTGCTGCTGCTGGCCGAGA
+HWUSI-EAS1795_0092:3:1:13550:1401#0/1
hhhhhhhhhhhhhhhhghhhhhchdddhhffgg
@HWUSI-EAS1795_0092:3:1:13993:1402#0/1
TGAGTGTCTTACTATGCGAATGAGCGATTCCAC
+HWUSI-EAS1795_0092:3:1:13993:1402#0/1
ghhghhhhhhhhhghhhhhhhfhhhhhhhhhhe
@HWUSI-EAS1795_0092:3:1:14228:1408#0/1
GACATGTTCGTTTGCTTAGGGAACTTTCAAATA
+HWUSI-EAS1795_0092:3:1:14228:1408#0/1
hfhhhhhhhhghhhhhhfghffghghhhhhhhh
@HWUSI-EAS1795_0092:3:1:15366:1404#0/1
CGACCGATATCTTTGCCGGGTCGAGGAAATGCG
+HWUSI-EAS1795_0092:3:1:15366:1404#0/1
hhhhhhhgghhhhgehhhhhhhhhhhhhhaahh
@HWUSI-EAS1795_0092:3:1:15773:1411#0/1
CGGGGGACTGGGAGTCAAGAACTCAGGTCCTGT
+HWUSI-EAS1795_0092:3:1:15773:1411#0/1
hhhgfghhhhfhhhdhhhhhhhhhhhcfhhghd
@HWUSI-EAS1795_0092:3:1:15908:1410#0/1
ACCAACCTGTTCAAGAAAATCTACAGCTCATCC
+HWUSI-EAS1795_0092:3:1:15908:1410#0/1
dafgggcffdafcfcffgggfgcffffaf]dfc
@HWUSI-EAS1795_0092:3:1:15925:1405#0/1
GAGCATTTTTCGCCTAAGTCCTCCTCAATGAGA
+HWUSI-EAS1795_0092:3:1:15925:1405#0/1
fdfegggg_gfafbbffddfffaffdfafffcf
@HWUSI-EAS1795_0092:3:1:16174:1401#0/1
CTCGGTGTCCACCTTAACCTGGGTGCAGACCTC
+HWUSI-EAS1795_0092:3:1:16174:1401#0/1
gfggggffffffgggggggggggcgfgfffffg
@HWUSI-EAS1795_0092:3:1:16780:1411#0/1
GAAGGAGGAGTCCGAGTCCGAGGATGACGACAT
+HWUSI-EAS1795_0092:3:1:16780:1411#0/1
hhhhhehggfhhhhfghhhhhhhghhhhhhcgd
@HWUSI-EAS1795_0092:3:1:17373:1404#0/1
CGACGCCTATGTTGTCAAGTTGCTGGAGATCTC
+HWUSI-EAS1795_0092:3:1:17373:1404#0/1
hhhhhghhhghhhchhhhhhhhfgagddfdfff
@HWUSI-EAS1795_0092:3:1:17393:1402#0/1
GTATGTATGATTTATGGCTGGAATACCTGTTGA
+HWUSI-EAS1795_0092:3:1:17393:1402#0/1
fafffffffffffffffffffWa`^`b[cff_a
@HWUSI-EAS1795_0092:3:1:17435:1406#0/1
GTCGCTTGTTGCGAAATTTAAAAACGAGTCGCT
+HWUSI-EAS1795_0092:3:1:17435:1406#0/1
afgdggggggaggcggfggggggggggagggfg
@HWUSI-EAS1795_0092:3:1:17547:1411#0/1
GGCGGACAGAGCCAAGGCGAACAGGGCGAACAC
+HWUSI-EAS1795_0092:3:1:17547:1411#0/1
gggggegd_dfcgefgggaggggggadggafce
@HWUSI-EAS1795_0092:3:1:17844:1400#0/1
TATCTTTCAGGAACACTGTTTCAAATTTAACAG
+HWUSI-EAS1795_0092:3:1:17844:1400#0/1
hhhhhhhhhhhhhhhhhhhhhhhhfhhhhhhff
@HWUSI-EAS1795_0092:3:1:17922:1408#0/1
GTTGACTTCTCCTCGGAGGTGACCGCCGCCCTT
+HWUSI-EAS1795_0092:3:1:17922:1408#0/1
cffafffggggggg[gW`fcffffeddbdb]OR
@HWUSI-EAS1795_0092:3:1:18069:1405#0/1
CTTGATTCTGGTGCTAGTGACCATCTTATAAAT
+HWUSI-EAS1795_0092:3:1:18069:1405#0/1
hhhhhhhhhhhhhhhghhhhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:18298:1408#0/1
CACCTTTCTGCCCCTTAAATCCGCCAAGGGACA
+HWUSI-EAS1795_0092:3:1:18298:1408#0/1
hhhhhdhhh_fgfghggghhhhhgghhhfahfh
@HWUSI-EAS1795_0092:3:1:18638:1402#0/1
AGCTTACTGATCCTAACTCTCAAAACCACAACT
+HWUSI-EAS1795_0092:3:1:18638:1402#0/1
ggegggggggfgggggggggggggggfggfagg
@HWUSI-EAS1795_0092:3:1:18767:1409#0/1
TCCAAATGCTCGCGAGCCCACTTGACCTTGTCC
+HWUSI-EAS1795_0092:3:1:18767:1409#0/1
gggggggegggefacafffffcggggfgeWcgd
@HWUSI-EAS1795_0092:3:1:18906:1401#0/1
CGTACGAGTCCTTTTCGTTGGCCACCACACGGA
+HWUSI-EAS1795_0092:3:1:18906:1401#0/1
gaddca[a]]`^afdfddcff]d[``Wbdbdc_
@HWUSI-EAS1795_0092:3:1:19189:1411#0/1
GCGGTGGTCTTGTCCAGAGTCTGGCTGAACTGG
+HWUSI-EAS1795_0092:3:1:19189:1411#0/1
hhhhhhhhhhhhhhhhhehhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:19391:1410#0/1
ATGGGCATAGGTATTGTCATTTCCGGGCTCTTC
+HWUSI-EAS1795_0092:3:1:19391:1410#0/1
ggfgggdfggfafffcfggdgggggggcdfffg
@HWUSI-EAS1795_0092:3:1:1050:1417#0/1
ATGCCACAAGACTTGCGATGAGAGGGCCGAAGG
+HWUSI-EAS1795_0092:3:1:1050:1417#0/1
^Ydcabafd_df^ceSYef\fK\^eeaaff[ff
@HWUSI-EAS1795_0092:3:1:2365:1419#0/1
TTGGTGTTTGGGACAAGGTTCGCACTTACAGAA
+HWUSI-EAS1795_0092:3:1:2365:1419#0/1
ggggggafcffffggggfefffgggggcggggg
@HWUSI-EAS1795_0092:3:1:2476:1412#0/1
CGCTGCGCGGGTCCCACAAAGATGTTCGCGTAG
+HWUSI-EAS1795_0092:3:1:2476:1412#0/1
fafcfa_ffdfffffdfgggcg[cfffaff]fe
@HWUSI-EAS1795_0092:3:1:3038:1412#0/1
CCGTGAAGGAGCTGCGTCGTGGCTACGTTGCCG
+HWUSI-EAS1795_0092:3:1:3038:1412#0/1
ffffffffafdfadadba\\`Va^c^[ddJe[_
@HWUSI-EAS1795_0092:3:1:4046:1413#0/1
CCAGCTTCTTCACCAGCTTCTTGTTCTTGTTCA
+HWUSI-EAS1795_0092:3:1:4046:1413#0/1
cafffffdfdcaffffaffcffdffdfffffff
@HWUSI-EAS1795_0092:3:1:4160:1416#0/1
CTGGCGCTCCATCAGGTACTTCTTGAACTTCCG
+HWUSI-EAS1795_0092:3:1:4160:1416#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:5308:1423#0/1
GCAAATCTCGCAGACGGCTCATGGTAAGAAGAT
+HWUSI-EAS1795_0092:3:1:5308:1423#0/1
hhhhhhhhhhhhhhhhhhhhhhhffghdfaffh
@HWUSI-EAS1795_0092:3:1:5443:1414#0/1
GAGCAATCGGTTCTTCAAGTTTCTTAACAAAGT
+HWUSI-EAS1795_0092:3:1:5443:1414#0/1
fafgfgggggdgfafffggegggggfggggcga
@HWUSI-EAS1795_0092:3:1:5794:1412#0/1
GTGTGGCTCGTGTTGCTGCTGCAGTTGCTGCTG
+HWUSI-EAS1795_0092:3:1:5794:1412#0/1
gggfcggddfacf^cWfc^WYaffW]cfccc]c
@HWUSI-EAS1795_0092:3:1:5923:1421#0/1
TGTGTGTGTAAAAAGGTCTTCTCGAGTTTGGTC
+HWUSI-EAS1795_0092:3:1:5923:1421#0/1
gfgegggfggggggggfffffcggggggggagd
@HWUSI-EAS1795_0092:3:1:6324:1416#0/1
GCTTGAGGATGGACGCACCCTGTCCGATTACAA
+HWUSI-EAS1795_0092:3:1:6324:1416#0/1
hhhhhhhhhgfhhhhhhhhhhcghhghhhhghh
@HWUSI-EAS1795_0092:3:1:6491:1417#0/1
GCCACGCTTCTCAACGCTGCCCGTACTGTCGTG
+HWUSI-EAS1795_0092:3:1:6491:1417#0/1
hhhhhhhhhhghhhhhhgghhhaehggdegcde
@HWUSI-EAS1795_0092:3:1:6914:1420#0/1
GTTTTCCTCGAATACATGGCCACGTCGCCTGTT
+HWUSI-EAS1795_0092:3:1:6914:1420#0/1
hhhhhhhhhhhgghhhhgghhhffhhhhheehd
@HWUSI-EAS1795_0092:3:1:8218:1415#0/1
CGTACTTAAATAGCGAGCTAAAGGATACTGTGT
+HWUSI-EAS1795_0092:3:1:8218:1415#0/1
ccccaccccaa_BBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:9136:1416#0/1
TTCGCTTTCACAATTCTCAAATTGCTGCTTCGC
+HWUSI-EAS1795_0092:3:1:9136:1416#0/1
hhhhhhhhhhhehhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9219:1412#0/1
TGTGGATGTACTCCATGAGGACGCGCTTGTTCT
+HWUSI-EAS1795_0092:3:1:9219:1412#0/1
hhhhhghhhhhhhhhhfggghhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:9368:1421#0/1
AGAAGCGTCACCGCAACATGAGCGTCCACTGCT
+HWUSI-EAS1795_0092:3:1:9368:1421#0/1
ffgggggffffffffffcdffdffcfdcf`fff
@HWUSI-EAS1795_0092:3:1:9931:1412#0/1
TCCGCTTGATCAAGCAGCGCCAAAAGAAGGCCC
+HWUSI-EAS1795_0092:3:1:9931:1412#0/1
ggggadgggggggfggdfaff[ggg[geeg_gg
@HWUSI-EAS1795_0092:3:1:10144:1413#0/1
GGTTAAAATGCCAGCAGTGAATGTGGAACAATG
+HWUSI-EAS1795_0092:3:1:10144:1413#0/1
hhhghhhhghhhghhhhhgghghhhdhhgehgc
@HWUSI-EAS1795_0092:3:1:10406:1413#0/1
GTTGATCAGGAATTTCACATCCATACCCAGAGT
+HWUSI-EAS1795_0092:3:1:10406:1413#0/1
hhghhhhhhhghghhhhhhgghhhhhhhghehd
@HWUSI-EAS1795_0092:3:1:10635:1420#0/1
GCAGGTTGGGTGAAGGACTAGGGGTCGACGTGA
+HWUSI-EAS1795_0092:3:1:10635:1420#0/1
gfggffafcfaffdfddggacgdfdccaf_ccY
@HWUSI-EAS1795_0092:3:1:11107:1416#0/1
AAACACAACGTAGAAAGGCCTTAGCTCCACTGA
+HWUSI-EAS1795_0092:3:1:11107:1416#0/1
ahhhhghhhhhhghhhhchhheghhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:11308:1413#0/1
TGGAGGCATTCCATTTTTGGATTACCGGTCATA
+HWUSI-EAS1795_0092:3:1:11308:1413#0/1
hhhhhhhhhhhhhhhhhhhhdhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:11975:1422#0/1
GGGCAATGGTCGTGCTTATCACTGGTGCGGTGG
+HWUSI-EAS1795_0092:3:1:11975:1422#0/1
fghhhhhhhhhhhcghhhhddhghhhehhhhgh
@HWUSI-EAS1795_0092:3:1:12212:1412#0/1
TTCACAACAATTCGCATTACTCGCTGCCATTGG
+HWUSI-EAS1795_0092:3:1:12212:1412#0/1
hhhhhhhfhhhhhghhhhhgghdhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:12624:1419#0/1
GACGGCCTTCTTGCTGCCGAACTCGATCTCGCG
+HWUSI-EAS1795_0092:3:1:12624:1419#0/1
hhhhhhhhhghhghhfhhghhhahhhhhhhghh
@HWUSI-EAS1795_0092:3:1:13310:1422#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:13310:1422#0/1
gggggggggggcgggggd[fdfgfggggggggg
@HWUSI-EAS1795_0092:3:1:13496:1413#0/1
CACTGACCACCGAGGCGGCCATGAAGAAGATCG
+HWUSI-EAS1795_0092:3:1:13496:1413#0/1
gggggggggggdgggfggegggcegegfggacf
@HWUSI-EAS1795_0092:3:1:14637:1414#0/1
GTTTTGCGGCCGTTGATGCTGATGGTTCACTAT
+HWUSI-EAS1795_0092:3:1:14637:1414#0/1
hhhhghhhhhhghhghfhdhggehhhhghhffg
@HWUSI-EAS1795_0092:3:1:14684:1423#0/1
CCTTAACGCTAAACTTGTAAGCTTTGGATGGAA
+HWUSI-EAS1795_0092:3:1:14684:1423#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:14848:1422#0/1
CCGCGGTTGTCGTAGGCCTGGAGCAAGGCAACA
+HWUSI-EAS1795_0092:3:1:14848:1422#0/1
gfgggggggggggggggggggfggggggggggg
@HWUSI-EAS1795_0092:3:1:14944:1423#0/1
AGGCCCTGGAGGTTTCCCAGGATGCCACCATTG
+HWUSI-EAS1795_0092:3:1:14944:1423#0/1
hhhhhhhhhhhhhhhhhhhghfghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15069:1422#0/1
GCACGCAGACCGAAGGGAGTCTCGATGTAACCG
+HWUSI-EAS1795_0092:3:1:15069:1422#0/1
gefcfa_`aeeafdfc]affcfa`d^`Ycaac^
@HWUSI-EAS1795_0092:3:1:15814:1419#0/1
GTCAAGTTCCGAAGGCGTCGCGAAGGAAAGACC
+HWUSI-EAS1795_0092:3:1:15814:1419#0/1
hhhhhghhhhhhhhhhdhhhghhhhhhghfhhh
@HWUSI-EAS1795_0092:3:1:15959:1420#0/1
CTTTCGTCGTCCCATCGCAGGGCCATGACGGTG
+HWUSI-EAS1795_0092:3:1:15959:1420#0/1
hhhhhfhhhhhhhhhhghhfhfhhhhhhhhgch
@HWUSI-EAS1795_0092:3:1:16039:1418#0/1
GAGAAAGATATAGAACACCCGTCCCAGTATCAT
+HWUSI-EAS1795_0092:3:1:16039:1418#0/1
eggggfaddffdgggcgffffdffdcf^a[ddb
@HWUSI-EAS1795_0092:3:1:16566:1419#0/1
GCGGCGCTTGTACACGTACTGCGCCATCTGGAA
+HWUSI-EAS1795_0092:3:1:16566:1419#0/1
dcUOaaZI]_Z_fcaff`b`K^BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:16725:1412#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16725:1412#0/1
hhghhghhhhdgadfhhaffffghghhghfhga
@HWUSI-EAS1795_0092:3:1:16760:1421#0/1
CCGGAGGACCTCGTGGTCCTTGGTCACCCTGGA
+HWUSI-EAS1795_0092:3:1:16760:1421#0/1
f[fd__fc[dbdc`dfc``^]bc`cfBBBBBBB
@HWUSI-EAS1795_0092:3:1:16874:1419#0/1
TGGGTGAGCTGCAGGCCACGGATGTTGTGGAAG
+HWUSI-EAS1795_0092:3:1:16874:1419#0/1
hhhhhhhhgghhhhghhhhghafhfhhaffffh
@HWUSI-EAS1795_0092:3:1:16903:1421#0/1
TTTCCGTACACCTCGGGAGGGGGCTCCACATTA
+HWUSI-EAS1795_0092:3:1:16903:1421#0/1
ggggggggggggggggggggggggdgggggggg
@HWUSI-EAS1795_0092:3:1:17006:1417#0/1
TAGTCGGCGTTTTTCGTTTCGGTGTTAGCATCA
+HWUSI-EAS1795_0092:3:1:17006:1417#0/1
cffffd]fcfafa`bR^\\YZYYOW_^_NW_X]
@HWUSI-EAS1795_0092:3:1:17452:1420#0/1
CTTTATCAAACTGTTCTACGGCAGCAATCACTT
+HWUSI-EAS1795_0092:3:1:17452:1420#0/1
hhhhhhhhhhhhhhhhhhhhhhghdhh]ffafh
@HWUSI-EAS1795_0092:3:1:17495:1419#0/1
GTCCTCGCACCGCAAATGAAATAATATTTTGCA
+HWUSI-EAS1795_0092:3:1:17495:1419#0/1
ggfggggggggfgggggggggdggg_gggggdg
@HWUSI-EAS1795_0092:3:1:17739:1414#0/1
CCTCTTTAGTCTCAATTCGCTTCCGCCTGGCGA
+HWUSI-EAS1795_0092:3:1:17739:1414#0/1
gggggggggcggfgggggggggggfggcgggga
@HWUSI-EAS1795_0092:3:1:17901:1412#0/1
ACAAAATCTACATTTGGAATGGCTTGGGCGCAT
+HWUSI-EAS1795_0092:3:1:17901:1412#0/1
hhhhhhhhhhhhhhhhghgfghhhhddhffghh
@HWUSI-EAS1795_0092:3:1:18514:1417#0/1
GCCAGTTTGGAGGCGCCCCACAGCAGACCGTCC
+HWUSI-EAS1795_0092:3:1:18514:1417#0/1
gfggagggaggggdgggcgeggfgcaggggggg
@HWUSI-EAS1795_0092:3:1:18801:1420#0/1
GTCGTAAATATATGGTTATCCCTCCTAGAATTA
+HWUSI-EAS1795_0092:3:1:18801:1420#0/1
hhhhhhhhhhghhhhhhhhhhhghhghhhfhhh
@HWUSI-EAS1795_0092:3:1:18901:1423#0/1
ATTACATGCCCCGTCCCCGTTTGTCCGCCTCAA
+HWUSI-EAS1795_0092:3:1:18901:1423#0/1
hhhhhhhhghhhhhhhhgfhhhaehffhhahgh
@HWUSI-EAS1795_0092:3:1:19003:1413#0/1
CTGTGAACCGCGCGGCCGGTCAAAGAGTCATAA
+HWUSI-EAS1795_0092:3:1:19003:1413#0/1
ZaIVX\ZaZ^^\aIadRSRQXRNFH[H[YZ[^c
@HWUSI-EAS1795_0092:3:1:19073:1414#0/1
ATCGCTAGTTAATGATTACAATTGGGAAATTAA
+HWUSI-EAS1795_0092:3:1:19073:1414#0/1
hfhhhhfdbdbeddddbhhhhhhghghhhhhhh
@HWUSI-EAS1795_0092:3:1:19123:1421#0/1
CGGTTCTTCTCACAGCAGAGCACCTTGGTAAAT
+HWUSI-EAS1795_0092:3:1:19123:1421#0/1
hhhhhhhhghhhhhfhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19359:1419#0/1
TCACCCTGTAAGGTCTCTAGCGCTTCCTCCATT
+HWUSI-EAS1795_0092:3:1:19359:1419#0/1
hhhhhhhhhhhhhhhhhhhhhghhghhhhhehh
@HWUSI-EAS1795_0092:3:1:1146:1428#0/1
CGGGTAGCTTATGAAACTGATTAATTCCGTGAA
+HWUSI-EAS1795_0092:3:1:1146:1428#0/1
`fc__cY\^aa^afeYd^f]afffdcd]fccfc
@HWUSI-EAS1795_0092:3:1:1697:1429#0/1
TAGTTGGCTTTGGTGATGCCGAAGGTGAAGGTG
+HWUSI-EAS1795_0092:3:1:1697:1429#0/1
Y\aY\[Yd[a^ad^^^^dBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2322:1425#0/1
TTCTCGTACTCAAAATCAGATAGGTTCTTCAGA
+HWUSI-EAS1795_0092:3:1:2322:1425#0/1
gagggcegggggggggggggagggfggggfggg
@HWUSI-EAS1795_0092:3:1:2700:1429#0/1
CGGTGGTGTGTACAAAGGGCAGGGACGTAATCA
+HWUSI-EAS1795_0092:3:1:2700:1429#0/1
egfffffccfffggggggdgcggggggggcggg
@HWUSI-EAS1795_0092:3:1:3511:1426#0/1
AGAAGATCGGAGGACCCAAGAACGGCGGTGAGC
+HWUSI-EAS1795_0092:3:1:3511:1426#0/1
g[ffWf]fffcfggfgedff_aacWff`WYJ`B
@HWUSI-EAS1795_0092:3:1:3627:1428#0/1
GCGCCCTTGAAAAGCGGCTATCCCTCGGGCTAC
+HWUSI-EAS1795_0092:3:1:3627:1428#0/1
hhhhhhhhhhhhhhhhhhhhghhgchaeggghh
@HWUSI-EAS1795_0092:3:1:3926:1429#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3926:1429#0/1
ffffd[cZ_]_Y_cffcb`db[``ccff[bcfc
@HWUSI-EAS1795_0092:3:1:4134:1431#0/1
CCTTGGTGTCGGCGTCGACCTCGATGATGTCCT
+HWUSI-EAS1795_0092:3:1:4134:1431#0/1
hhhhhhhhhhhfhahhhhhhghhhhhgghghfh
@HWUSI-EAS1795_0092:3:1:4404:1433#0/1
CACAATGATAGGAAGAGCCGACATCGAAGGATC
+HWUSI-EAS1795_0092:3:1:4404:1433#0/1
W\\\\R\Sa_S[YZZPMJZYPV\NT\\\`aQ_c
@HWUSI-EAS1795_0092:3:1:4484:1432#0/1
CAATAATACCAGCAACAGCAGCAGCGAACACAA
+HWUSI-EAS1795_0092:3:1:4484:1432#0/1
hghhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4574:1434#0/1
CAGCAGTGCCTTGGAGTCGGGGATGGGCTCGGC
+HWUSI-EAS1795_0092:3:1:4574:1434#0/1
f^fff_ffcacddadWPZ]_GVSTQXSPNT]^[
@HWUSI-EAS1795_0092:3:1:5126:1432#0/1
TAGATAAAAGCTTTTGGGGCGAAGCAGTATTAA
+HWUSI-EAS1795_0092:3:1:5126:1432#0/1
ggggggggggggYbbabgffggf]a[aYV`b^d
@HWUSI-EAS1795_0092:3:1:5214:1428#0/1
CAACGGCGCAAGGTGGCCTTTAGCGGCAAGAAG
+HWUSI-EAS1795_0092:3:1:5214:1428#0/1
hhhhggghhhhghfhhghhhhchfhhhhghhfg
@HWUSI-EAS1795_0092:3:1:6230:1430#0/1
GCCGCCCTTTAGATACTTGTTGAGAATGGAGAA
+HWUSI-EAS1795_0092:3:1:6230:1430#0/1
hfhhhhhhhhhhhhhghhchhcfJffffffaed
@HWUSI-EAS1795_0092:3:1:7008:1433#0/1
CAGGCCAGTTGCCGTGGAGCGGCTCGTTCCTCG
+HWUSI-EAS1795_0092:3:1:7008:1433#0/1
hhghhhhfhhhhhhhghgghggdad___^_W]U
@HWUSI-EAS1795_0092:3:1:7090:1434#0/1
AGTTCCCCCGTGATTCCATTAAAGTGGGTGTGT
+HWUSI-EAS1795_0092:3:1:7090:1434#0/1
hhhhhhhhhhhfhhhhhhhhfhhhfghhghgfc
@HWUSI-EAS1795_0092:3:1:7368:1424#0/1
TACGATGATTTCCGAGGACTCTGCACCAACGAG
+HWUSI-EAS1795_0092:3:1:7368:1424#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:7692:1428#0/1
TCCCTGATGATGAAGGGTCGCAACAACGGCAAG
+HWUSI-EAS1795_0092:3:1:7692:1428#0/1
dea`ae`_d`da]daccbb[bbcdb[bfafddc
@HWUSI-EAS1795_0092:3:1:8058:1427#0/1
GGCATCTTCAACCTGGCGGCTGTTCTCCGCGAT
+HWUSI-EAS1795_0092:3:1:8058:1427#0/1
ffffffffffffffcdfffaf_ffcfffcdccY
@HWUSI-EAS1795_0092:3:1:8402:1424#0/1
CAAAAATAATATTCGCCTGTTTAACAAAAACAT
+HWUSI-EAS1795_0092:3:1:8402:1424#0/1
hhfhhhhfhhhhhhhhhhhhhhfhhghhhhhfh
@HWUSI-EAS1795_0092:3:1:8794:1433#0/1
CCCGCATATCCATTTGGTGATAAATTCTCCCGC
+HWUSI-EAS1795_0092:3:1:8794:1433#0/1
hhhhhhhhhhhghhhhhhhghghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8947:1431#0/1
GAGCATTTTAGGCTCATCCCAAAAGAGCGGATG
+HWUSI-EAS1795_0092:3:1:8947:1431#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhd
@HWUSI-EAS1795_0092:3:1:9085:1425#0/1
TGTGACCACCCCGCAGGGACTGAAGGAGTTGAA
+HWUSI-EAS1795_0092:3:1:9085:1425#0/1
hhhghhhhhhhhhhehhhhhhhhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:9106:1429#0/1
ACTACACGGACATATCGCCGCACTTCCTCGATC
+HWUSI-EAS1795_0092:3:1:9106:1429#0/1
gfgggggfgfgggggffggfeagggggdfg_gg
@HWUSI-EAS1795_0092:3:1:9647:1427#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9647:1427#0/1
hfhhhhhhhhhgehhhhhhhhhhhhchhghhhh
@HWUSI-EAS1795_0092:3:1:10293:1425#0/1
GGAAATTTGTGAACCCTGTTTAAATGGTAAACA
+HWUSI-EAS1795_0092:3:1:10293:1425#0/1
ggggggggggWgfffff_gggggggggffffff
@HWUSI-EAS1795_0092:3:1:10670:1424#0/1
CTGCGGGTTAACAGTGACAACGTGATTGCCAAA
+HWUSI-EAS1795_0092:3:1:10670:1424#0/1
gfgggggfggggfffffdcfdfeffffcgaggf
@HWUSI-EAS1795_0092:3:1:11485:1427#0/1
TCAAGCCAAGATACCGCTATGCCTCCCAAATTC
+HWUSI-EAS1795_0092:3:1:11485:1427#0/1
hhhhhhhhhghhhhhhhghhhhhghhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12109:1426#0/1
GCGACCCTGGCTCGCCCAGTATTCGGGATAAGT
+HWUSI-EAS1795_0092:3:1:12109:1426#0/1
ffggfgfe[fddfffffcaaca]fccccRccc]
@HWUSI-EAS1795_0092:3:1:12694:1429#0/1
GGAATTCCGACCAGTGTAAAAGAGCCGAGTAGA
+HWUSI-EAS1795_0092:3:1:12694:1429#0/1
fff_fffff_fcadadb_aaaZccdffacWc^f
@HWUSI-EAS1795_0092:3:1:13416:1433#0/1
GCCATTTCGTCCATGTCATCCTCGTCACTGGAC
+HWUSI-EAS1795_0092:3:1:13416:1433#0/1
hhhhghhhhghhehhhhhhhhhgghghehhhgh
@HWUSI-EAS1795_0092:3:1:13771:1426#0/1
CGGCGGCGCTATTCCGTTCTGGAGAAGACTTGG
+HWUSI-EAS1795_0092:3:1:13771:1426#0/1
fdfafffca[RdZO\^V\VVV]MWTTT`WWaaf
@HWUSI-EAS1795_0092:3:1:15010:1434#0/1
GAACGATTCCACGAGGAGCTAGTGGTTCGTCCA
+HWUSI-EAS1795_0092:3:1:15010:1434#0/1
gggggggggggeg[ggcfffffegggggggggg
@HWUSI-EAS1795_0092:3:1:15363:1430#0/1
GTTCGAAGGCGATCAGATACCGCCCTAGTTCTA
+HWUSI-EAS1795_0092:3:1:15363:1430#0/1
hhhhhhghhhhhhfgecfhhhhhhhhhahhggg
@HWUSI-EAS1795_0092:3:1:15454:1432#0/1
CTGCGGTTATGTCACTCACCGCATGGGCGTCTG
+HWUSI-EAS1795_0092:3:1:15454:1432#0/1
hhhhhhhhhghhhhhhhghggghhhhhhhehhh
@HWUSI-EAS1795_0092:3:1:15483:1424#0/1
GGGGAAGCTGGCACCCTTTTTTAATGTATAATT
+HWUSI-EAS1795_0092:3:1:15483:1424#0/1
hhhhhhhhhhhhhhhhghhhhhghhehhchhhh
@HWUSI-EAS1795_0092:3:1:16415:1424#0/1
GCGACGTTGTGATGGGCAGCTGGCTGGCGCTGC
+HWUSI-EAS1795_0092:3:1:16415:1424#0/1
hhggfghhhghfhhhghhdhhhhfehhhdcd[`
@HWUSI-EAS1795_0092:3:1:16842:1428#0/1
CCAGGAAATCGGTGCCCACCAGGAACCGCATGG
+HWUSI-EAS1795_0092:3:1:16842:1428#0/1
hhhhhhhhhhhgghhhhhhfhdahhhhhhfdhh
@HWUSI-EAS1795_0092:3:1:16993:1433#0/1
CTAACAATGGCTTTATTCTCGATTAACTGAAAC
+HWUSI-EAS1795_0092:3:1:16993:1433#0/1
ggffcffgggggggaggggfggeggfcgggfgg
@HWUSI-EAS1795_0092:3:1:17243:1435#0/1
TACGATTACCACCTTCAAGGACGCCCACAACAT
+HWUSI-EAS1795_0092:3:1:17243:1435#0/1
hhhhhhhghhhhhhhhhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17750:1434#0/1
ATTAAAGTCGAATCGGAAATCCGTTCCGGCAGG
+HWUSI-EAS1795_0092:3:1:17750:1434#0/1
dgfcfff`ffdcbcfffffcf_fccfcfefRfc
@HWUSI-EAS1795_0092:3:1:17799:1433#0/1
GGCCTTTGAACTGCACTTTACCAAGGAACTGGA
+HWUSI-EAS1795_0092:3:1:17799:1433#0/1
hhhhhhhghhhhhhhhfhgehhhehhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18560:1424#0/1
TGGCGCACGTTGGTCAGGGGGTTCAGGCGGCGC
+HWUSI-EAS1795_0092:3:1:18560:1424#0/1
hhhhhhfhhhhhhehghffffcghhhghhfcce
@HWUSI-EAS1795_0092:3:1:18673:1426#0/1
ACGCCATGTACATGTCTGTGTTTGCGTATGCGC
+HWUSI-EAS1795_0092:3:1:18673:1426#0/1
ffggggggggggf_gggaffffebSabfccffg
@HWUSI-EAS1795_0092:3:1:19013:1430#0/1
TTCACCTTGGAGACCAGCTGCGGATATTGGTAC
+HWUSI-EAS1795_0092:3:1:19013:1430#0/1
hhhhhhhhhhhhhhghghhhhhhhhhhhgghhg
@HWUSI-EAS1795_0092:3:1:1284:1435#0/1
GTGAAAGAGTAACCGCGCTCGGTCAGGATCTTC
+HWUSI-EAS1795_0092:3:1:1284:1435#0/1
fdd_ceaedeeccfdfafff^ffcfcdcdbddf
@HWUSI-EAS1795_0092:3:1:1828:1443#0/1
GAAATTGTTGCCATTTGACGGCAATGGTGTTGG
+HWUSI-EAS1795_0092:3:1:1828:1443#0/1
gfgggggggggggfgggaffafdffffffffff
@HWUSI-EAS1795_0092:3:1:3174:1440#0/1
GTTATCTGCGGTTAAGGGAGCAGCTGCTATCTC
+HWUSI-EAS1795_0092:3:1:3174:1440#0/1
ed^cdcefffffaf_\_f]f\fcafSdccdafc
@HWUSI-EAS1795_0092:3:1:3445:1443#0/1
AAAATTATCAGCCAGTCGTGTTATCTGTTATCT
+HWUSI-EAS1795_0092:3:1:3445:1443#0/1
hghhhghhhhhhhhhhhghfhghghhahgghhh
@HWUSI-EAS1795_0092:3:1:3870:1437#0/1
GGGGATTTCGCTGTAGTTCTTCTTGAGGTCCAG
+HWUSI-EAS1795_0092:3:1:3870:1437#0/1
ggggagggggfffggggggggegggeggggggf
@HWUSI-EAS1795_0092:3:1:5347:1447#0/1
GCTCCTTGTGCGGCACACAGAAACAGTTGGTAA
+HWUSI-EAS1795_0092:3:1:5347:1447#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:5526:1443#0/1
AAAAGGAAACGTAAATTTAAAGCTACAGTTAAT
+HWUSI-EAS1795_0092:3:1:5526:1443#0/1
fhhhghhhhhhhhhhhhhhhhhhghhhhhhheh
@HWUSI-EAS1795_0092:3:1:6089:1442#0/1
ATGCCTACCAGTTCGTGTATATGAGACGGAAAC
+HWUSI-EAS1795_0092:3:1:6089:1442#0/1
hhhhhhfhhdhhhhhhhh^hadfafdfhcchfh
@HWUSI-EAS1795_0092:3:1:6119:1443#0/1
CTTGTGTTTAGTCAATTGTCTGATGTGATTTTC
+HWUSI-EAS1795_0092:3:1:6119:1443#0/1
fgg]gggggcgfffffffggaeggcg]gggggg
@HWUSI-EAS1795_0092:3:1:6196:1443#0/1
CGGACCAGTTGTAGGAACGCAACTTGGCGGCGG
+HWUSI-EAS1795_0092:3:1:6196:1443#0/1
gegggdfdcfffaafcfggffgddcddddcaag
@HWUSI-EAS1795_0092:3:1:6215:1441#0/1
TCGGTATTGTATTTCGTCTATAGCAGAGTCTTT
+HWUSI-EAS1795_0092:3:1:6215:1441#0/1
ggggeggfdfffggggggfgaaggggggggggg
@HWUSI-EAS1795_0092:3:1:6535:1441#0/1
GGAAATTGAGCAGCAACTCCGAGTTAATGAATT
+HWUSI-EAS1795_0092:3:1:6535:1441#0/1
hhhhhhhhhhhhhhhhhhhhhghhhgghhhhhh
@HWUSI-EAS1795_0092:3:1:6584:1443#0/1
GCAAACCACAGGAAAATCGCGTTGTCAGATTAA
+HWUSI-EAS1795_0092:3:1:6584:1443#0/1
gghhhhhehhfhhehhhhfhghhagggffgegh
@HWUSI-EAS1795_0092:3:1:7609:1439#0/1
CCAGTAGTTATTGGGACACTTCATCACCGGAAC
+HWUSI-EAS1795_0092:3:1:7609:1439#0/1
hhhhhhhhhhhhhfhghhhhhhhhhhghfhhhf
@HWUSI-EAS1795_0092:3:1:7768:1438#0/1
ATCAGAAACAATGCGGGGCGGGCGCTTATCGGG
+HWUSI-EAS1795_0092:3:1:7768:1438#0/1
hhhhhhhhhhhhhhhhhhhhhhhgfhcgdghhh
@HWUSI-EAS1795_0092:3:1:7993:1442#0/1
GGTTCAGCACGATGACCTGGGCGGTGAAGTCGG
+HWUSI-EAS1795_0092:3:1:7993:1442#0/1
hhhhhhfhhhhhgehhhhhhhghhdghhfeghh
@HWUSI-EAS1795_0092:3:1:8183:1436#0/1
GTTTGCAGGTGTACACGCAATATCCGACACCGC
+HWUSI-EAS1795_0092:3:1:8183:1436#0/1
\V\\ZaZbbY`Z^\a\a`aa[aVa\[[c^acXZ
@HWUSI-EAS1795_0092:3:1:8210:1444#0/1
GCAAAGGATCCGCCCTCACATTACTTGAGTAAA
+HWUSI-EAS1795_0092:3:1:8210:1444#0/1
hhhhhchhhhhhhhhhhghghhhhhhhghdghh
@HWUSI-EAS1795_0092:3:1:8321:1444#0/1
CCGGCAAGAGCACCACCTACGTCGGGGTGAAGA
+HWUSI-EAS1795_0092:3:1:8321:1444#0/1
hhhhhhhhhhhghhhghghhhffhhhh_cc_fc
@HWUSI-EAS1795_0092:3:1:8369:1442#0/1
TTGGCAGGTGGCCGCGTAGTCGAGTATCTCCGT
+HWUSI-EAS1795_0092:3:1:8369:1442#0/1
ggggfgggggggggfggfgegg]dccffffffW
@HWUSI-EAS1795_0092:3:1:8605:1436#0/1
CTATGACAGCTATGCAGAACGTAACAAAACAAT
+HWUSI-EAS1795_0092:3:1:8605:1436#0/1
hhhhhhhhhhhhhhhhghhhhhghghhhhgghh
@HWUSI-EAS1795_0092:3:1:8678:1441#0/1
AGCCAGCCGTGTGTGTTGTGATCCAGCCAATTG
+HWUSI-EAS1795_0092:3:1:8678:1441#0/1
hhghhfhhhhfgheffhacfafhfhghhhhhgg
@HWUSI-EAS1795_0092:3:1:10293:1443#0/1
GGAAATTTGTGAACCCTGTTTAAATGGTAAACA
+HWUSI-EAS1795_0092:3:1:10293:1443#0/1
ffggfggfaffcffffbafff_ddffadffffc
@HWUSI-EAS1795_0092:3:1:10384:1436#0/1
ATATATCGCACATTTGTTTAACTTAAGCTAAAC
+HWUSI-EAS1795_0092:3:1:10384:1436#0/1
ggggggggfggggageggggggggggdgfgggf
@HWUSI-EAS1795_0092:3:1:10529:1440#0/1
CAACATCATAATGCAGCCAACAACACCACTCAA
+HWUSI-EAS1795_0092:3:1:10529:1440#0/1
fgggfffeggfgggggggggdggfggggggggg
@HWUSI-EAS1795_0092:3:1:10659:1444#0/1
TGCGCTTCCAACTCAATGGTGGCATCTTCAAGC
+HWUSI-EAS1795_0092:3:1:10659:1444#0/1
hhhhhhhhhhhhehhhhhhhghhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:11048:1446#0/1
CTCGGAGCGTAGACGTTGCAGCATGGGACGATA
+HWUSI-EAS1795_0092:3:1:11048:1446#0/1
hhhhhhhhhhhhghhghghghggghhggdhhhh
@HWUSI-EAS1795_0092:3:1:11074:1437#0/1
CAAAAATCACAGCATTCCATATCATAATATTAT
+HWUSI-EAS1795_0092:3:1:11074:1437#0/1
hhhhhhhhhhhhhhfhhhhhhhhhghghghhhh
@HWUSI-EAS1795_0092:3:1:11233:1443#0/1
CGAGAATCTGACTCGGGTGCTCAAGCAGCTGGA
+HWUSI-EAS1795_0092:3:1:11233:1443#0/1
ggggggfggggggggggggggggggggfggfgg
@HWUSI-EAS1795_0092:3:1:11370:1443#0/1
TACCGCTCTAGGCGTCGTCTTATTGCTGGCTAC
+HWUSI-EAS1795_0092:3:1:11370:1443#0/1
hhhhhhhhhhhhdhhhhhhhhhghghfhghehh
@HWUSI-EAS1795_0092:3:1:11805:1447#0/1
CCAACATCATAATGCAGCCAACAACACCACTCA
+HWUSI-EAS1795_0092:3:1:11805:1447#0/1
hghhhhhhhhhhghghhhhhhhhhhhhfhhhfh
@HWUSI-EAS1795_0092:3:1:12723:1438#0/1
CACTTCTTCTTTCCAGATCCCGATATTTTGCCA
+HWUSI-EAS1795_0092:3:1:12723:1438#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12941:1442#0/1
AGTAAAAAGAGCTTTGCAGAACCAGAGCGGAGA
+HWUSI-EAS1795_0092:3:1:12941:1442#0/1
gcgggaa\\WW^bbabddfacfbf`fbfb^[`T
@HWUSI-EAS1795_0092:3:1:13342:1444#0/1
CAGGGACCCATGAACTGCGTGGTGGATGCGGCA
+HWUSI-EAS1795_0092:3:1:13342:1444#0/1
hfhhhfhhhhhhghhhhgfdgdaffcchhhddg
@HWUSI-EAS1795_0092:3:1:13453:1436#0/1
AACACGGTGACCAAGCTGATCGAGCAGAAGAAG
+HWUSI-EAS1795_0092:3:1:13453:1436#0/1
hhhhhhhhhhhhhhhhhhhhhhfhghhhhggch
@HWUSI-EAS1795_0092:3:1:13625:1441#0/1
GCGGTAGATTGGGCTCCTTGAGTACTACCAGTG
+HWUSI-EAS1795_0092:3:1:13625:1441#0/1
hhhhhhhhfhhhhgdhhhhhfhghhhgghhggg
@HWUSI-EAS1795_0092:3:1:13652:1444#0/1
CGCACATTCGCCTCGACCTGATTCGATCACAAA
+HWUSI-EAS1795_0092:3:1:13652:1444#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:13800:1437#0/1
GTGACATCAGCATCCTTTTCCACACGCTGTTCC
+HWUSI-EAS1795_0092:3:1:13800:1437#0/1
hhhhhfhhhhhhhhhghhhhhhghghhdghghh
@HWUSI-EAS1795_0092:3:1:14113:1441#0/1
GGTTGTCGCCCGCCTGGAGCACCTTGCCGCTAA
+HWUSI-EAS1795_0092:3:1:14113:1441#0/1
gggggggggggdggcgfafdcfggggggggege
@HWUSI-EAS1795_0092:3:1:14209:1446#0/1
GATGAGAAAGAGGAGAGCCAAACAAAGAAGCAG
+HWUSI-EAS1795_0092:3:1:14209:1446#0/1
gehhhgghhhghhgfhhhgdhhhghhghhhhde
@HWUSI-EAS1795_0092:3:1:14252:1440#0/1
CACGAGAAGCTGCACCACCCTGGCAACAAGGCC
+HWUSI-EAS1795_0092:3:1:14252:1440#0/1
ffffffff_dcffffcfad_S[TZ_XXfff_c^
@HWUSI-EAS1795_0092:3:1:14545:1446#0/1
GAAAAATTAAAGTAGTTACTGAAAGAAATCAAG
+HWUSI-EAS1795_0092:3:1:14545:1446#0/1
hhhhhhhhhhhhghfhhhhhgchhghheghhgh
@HWUSI-EAS1795_0092:3:1:14623:1444#0/1
GCTACGTATCCACACCATACGCCCGCCCACATG
+HWUSI-EAS1795_0092:3:1:14623:1444#0/1
hhhhhhhgghhhhhhhhghhhhhhhhhhehhhh
@HWUSI-EAS1795_0092:3:1:14757:1446#0/1
CTATTACACGATATACCTTGAGGAAGTCTCATA
+HWUSI-EAS1795_0092:3:1:14757:1446#0/1
ggegggggggggfgfggggdfgggggggggggg
@HWUSI-EAS1795_0092:3:1:15129:1437#0/1
GCAGCCTCCTTCTTGCCGGCAGCGGGAGCCGCA
+HWUSI-EAS1795_0092:3:1:15129:1437#0/1
cfddfffdgeagggaaggggdgcdadafdd_f`
@HWUSI-EAS1795_0092:3:1:15150:1444#0/1
CTTGGATTGGGTGAACCAGCCAGTGTGCGGATA
+HWUSI-EAS1795_0092:3:1:15150:1444#0/1
hhhhhhhhhhhfhhhhhhhhhgghhghhhhheh
@HWUSI-EAS1795_0092:3:1:16139:1435#0/1
CGTGCTACTTCCTTCACCGGAACTGGGTTTCCT
+HWUSI-EAS1795_0092:3:1:16139:1435#0/1
hhhagghhhfhhhhhehhghghhhghhhhhhhf
@HWUSI-EAS1795_0092:3:1:16186:1440#0/1
GAAAGATTCAATTTCGTTTCCTGTGATGTAGTC
+HWUSI-EAS1795_0092:3:1:16186:1440#0/1
ggdgcggggggggggfgefffddggfgaffa]a
@HWUSI-EAS1795_0092:3:1:16296:1441#0/1
ATTTTATCCTATTAATCAAGTAATATTCTGATC
+HWUSI-EAS1795_0092:3:1:16296:1441#0/1
fffggecggggggfgcgfgegdcdfffggfdgg
@HWUSI-EAS1795_0092:3:1:16367:1436#0/1
CCGTTCAAAAGGGCGGCTGGGTGGTCCTGGTGA
+HWUSI-EAS1795_0092:3:1:16367:1436#0/1
hhhhhhhhhhfhhhhhgghghahhehhhhgfge
@HWUSI-EAS1795_0092:3:1:16774:1446#0/1
AATTATTAATAGAAGAAGTGAGAGATTAAAGAC
+HWUSI-EAS1795_0092:3:1:16774:1446#0/1
hhhhhhhhhhhghhhhhgfhhhhhhhfhhhedf
@HWUSI-EAS1795_0092:3:1:17524:1437#0/1
CGAAGTTGAGGAGCGACCCGTTATGATAGTGGC
+HWUSI-EAS1795_0092:3:1:17524:1437#0/1
hhhhhghhhhhhghhhghhhhhgdhhffhgghh
@HWUSI-EAS1795_0092:3:1:17772:1441#0/1
CGGAGAGTCCATTGCCCAACGCTGCCAGCAGCT
+HWUSI-EAS1795_0092:3:1:17772:1441#0/1
hhhhehhhfhhdcfhhhghhhfgfhhhgfgcf]
@HWUSI-EAS1795_0092:3:1:1266:1450#0/1
CCGGACACTGGTGCCCTCGCGAAGACCCAGCAC
+HWUSI-EAS1795_0092:3:1:1266:1450#0/1
faf_]fdcd]LWac^cP_a\]ac`]acdW^daf
@HWUSI-EAS1795_0092:3:1:1842:1454#0/1
GAAATTGTTGCCATTTGACGGCAATGGTGTTGG
+HWUSI-EAS1795_0092:3:1:1842:1454#0/1
_ddff[ffffdfa^^`Xf_ffffafcKU``^\^
@HWUSI-EAS1795_0092:3:1:1923:1448#0/1
CAGTGATTAGCCACAGCACTTCGACATGTCCAC
+HWUSI-EAS1795_0092:3:1:1923:1448#0/1
fdcbdeec_cfffd_aaedeceffcfffcffff
@HWUSI-EAS1795_0092:3:1:2336:1451#0/1
AGCTGACACCGCGTGGTGTTTTTGCTTTCGATT
+HWUSI-EAS1795_0092:3:1:2336:1451#0/1
_ffaffffffcddaaf`cddc_`ffffcfcafg
@HWUSI-EAS1795_0092:3:1:3397:1457#0/1
CCGTTTCGTTCGTCGCTTCCAGCTGTCCTTTGC
+HWUSI-EAS1795_0092:3:1:3397:1457#0/1
f_fddaff_ffcfcfcfdf^c]^acdcffffff
@HWUSI-EAS1795_0092:3:1:3705:1453#0/1
GCTTGCTTGAGTCCGTAAATTGCCTTATTCAAT
+HWUSI-EAS1795_0092:3:1:3705:1453#0/1
ggggggggaggggdgggggggggfggggggggg
@HWUSI-EAS1795_0092:3:1:4854:1453#0/1
GAAAGGTTTCTCTGCATCTTAAGGGATCCGATG
+HWUSI-EAS1795_0092:3:1:4854:1453#0/1
hhhhhhhhhhghhhhhhhhhhhhhhfhhhhghh
@HWUSI-EAS1795_0092:3:1:4940:1457#0/1
AGAACACTACCCACCCACACTCTACGTAAAAGT
+HWUSI-EAS1795_0092:3:1:4940:1457#0/1
hhhhhhhhhhhhhhhhhhhgggfhhhghhhhhg
@HWUSI-EAS1795_0092:3:1:5771:1457#0/1
AGCAGAGCGATGTGATGCGCTACTTGCTACGTA
+HWUSI-EAS1795_0092:3:1:5771:1457#0/1
ggggggfggg]gffffcgfgggggggggggggf
@HWUSI-EAS1795_0092:3:1:6379:1453#0/1
ATTAATTAGTAATTTTACAAATTTACGTCGTTA
+HWUSI-EAS1795_0092:3:1:6379:1453#0/1
hhhhhhhhhhhhghhhhhhhhhhghhfhhfhfh
@HWUSI-EAS1795_0092:3:1:6741:1458#0/1
GTACGGATGTCGCGAGAATTCATCCAGCTTGCC
+HWUSI-EAS1795_0092:3:1:6741:1458#0/1
hhhhhhhhghhhghdhhhfhfhhhhhhghgahh
@HWUSI-EAS1795_0092:3:1:7277:1452#0/1
TGGCGATCCGAGCGAGCCCTCAAGCAAGCCCTA
+HWUSI-EAS1795_0092:3:1:7277:1452#0/1
hhfghhhhhgchhfhfdhh_hehhgf]affece
@HWUSI-EAS1795_0092:3:1:7479:1454#0/1
ATCATGCAGCTGTTCGTCCGTGGACTAGAGACC
+HWUSI-EAS1795_0092:3:1:7479:1454#0/1
gggggggggggagggfgggfgggggggfgeggc
@HWUSI-EAS1795_0092:3:1:7638:1458#0/1
TCTGTGCTGTGGGTGTGTCTGTGTTGGGATTGG
+HWUSI-EAS1795_0092:3:1:7638:1458#0/1
hffKfffhhhehhfhhgghhehdffffdaghhg
@HWUSI-EAS1795_0092:3:1:7838:1451#0/1
CTGCATTTAAGCTCTTTAGAGTAGTCGTCTAAG
+HWUSI-EAS1795_0092:3:1:7838:1451#0/1
hhhgghhhhhhhhhhhhhfhhhhhhghghhhgh
@HWUSI-EAS1795_0092:3:1:7878:1450#0/1
GGACCCTCGATCAAGATCTGGGATCTGGCATGC
+HWUSI-EAS1795_0092:3:1:7878:1450#0/1
fggggfgggggggefggggggggggfgggdcgf
@HWUSI-EAS1795_0092:3:1:7949:1456#0/1
GCCAAAGAAGAAGCCAGTGACCAAGAAGGTGGC
+HWUSI-EAS1795_0092:3:1:7949:1456#0/1
hfhhhhghhhhhhhhhhghhghhhhghhfdhhh
@HWUSI-EAS1795_0092:3:1:8245:1449#0/1
CTCCAAGTCGTTGTCGTCGGCGGATGCCCTTAC
+HWUSI-EAS1795_0092:3:1:8245:1449#0/1
gfgggfgcggcgggggggce^edbKdfecWd`f
@HWUSI-EAS1795_0092:3:1:9459:1454#0/1
CGGGAGTCGGAAGATGGCGTCTAAATCGCTGGC
+HWUSI-EAS1795_0092:3:1:9459:1454#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhhfghhh
@HWUSI-EAS1795_0092:3:1:10598:1452#0/1
CGGCAAGATCGACGAGATCCTGGAGCTGCGCGC
+HWUSI-EAS1795_0092:3:1:10598:1452#0/1
gggggggggggggfgggggggefggggggeggg
@HWUSI-EAS1795_0092:3:1:10627:1449#0/1
TGATTGCGCATGAAGATCGTGTAGATCAGTATG
+HWUSI-EAS1795_0092:3:1:10627:1449#0/1
hgghhhhhhhhhhhhhhhhhfhghhhghfhhhh
@HWUSI-EAS1795_0092:3:1:11200:1453#0/1
CGGCGTTTTAAATTTCTGCTTATACGTGGCCAG
+HWUSI-EAS1795_0092:3:1:11200:1453#0/1
geggggggggggggccgcaff]ffffdffffcc
@HWUSI-EAS1795_0092:3:1:12744:1451#0/1
GTTTTGTAAATATGTCAGCCAGTTGATTCTCTG
+HWUSI-EAS1795_0092:3:1:12744:1451#0/1
hhhhhfhhghhhhhghhhhhhgghghhhhghhh
@HWUSI-EAS1795_0092:3:1:12768:1459#0/1
CAGATCTTGAAGTGGCAAGGCGACATATATTGT
+HWUSI-EAS1795_0092:3:1:12768:1459#0/1
hhhghhhhhhhhhhhhhgghhhcghhhhghfhh
@HWUSI-EAS1795_0092:3:1:13232:1450#0/1
GAAATATTGAGGCACTGCCATCATTTAGTAGTT
+HWUSI-EAS1795_0092:3:1:13232:1450#0/1
hhhhghhhfhhhhhh_hhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:13779:1447#0/1
CTCCTTCATCTGGGGAATGATGACGTCGTTCCA
+HWUSI-EAS1795_0092:3:1:13779:1447#0/1
hghhhhhhhhhhhghhhfheghhhhghfhghhg
@HWUSI-EAS1795_0092:3:1:14395:1449#0/1
GCTAACATCACCACTGAGGTCAAGTCCGTGGAG
+HWUSI-EAS1795_0092:3:1:14395:1449#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhge
@HWUSI-EAS1795_0092:3:1:15004:1452#0/1
GTCAAGGGTCTGCGCGGATCGCGCTTGAAGAAC
+HWUSI-EAS1795_0092:3:1:15004:1452#0/1
hfhhhhhfhhhhchchhfghhcggghhhdehha
@HWUSI-EAS1795_0092:3:1:15042:1458#0/1
TACGACTCCTGTTGGATCACCTTGATCAAATCC
+HWUSI-EAS1795_0092:3:1:15042:1458#0/1
ggfgdgggccggggggegfggggggggfggegc
@HWUSI-EAS1795_0092:3:1:15277:1456#0/1
CAGTTCGTAGGTCACCAGGGTCACACCGAACTG
+HWUSI-EAS1795_0092:3:1:15277:1456#0/1
ghhhghhhghhhhchhfhhhghhhhgdfhhfhg
@HWUSI-EAS1795_0092:3:1:17160:1452#0/1
CCGGAGGCGTCGTAGTGGGAGCCGTGGCAGGGG
+HWUSI-EAS1795_0092:3:1:17160:1452#0/1
faffdffcfac]_bbWb`]dbW[WN[Q]``\^a
@HWUSI-EAS1795_0092:3:1:17922:1458#0/1
GGAGGAGATGGGCGACGACTACACGCTGGACCT
+HWUSI-EAS1795_0092:3:1:17922:1458#0/1
fd_fccfdffffggaggfaff]ffcdcggggcg
@HWUSI-EAS1795_0092:3:1:17972:1449#0/1
GTTGGACTGTCTGGGTGCCTTGGACGCTGCTCT
+HWUSI-EAS1795_0092:3:1:17972:1449#0/1
hhhhhhhhhhhhhhhghhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18796:1448#0/1
CACCGAATAGGAACGAGACACATCCGCCAGGAC
+HWUSI-EAS1795_0092:3:1:18796:1448#0/1
hhhhgghhhhfghhghcghhhhhhhhhdhhfhf
@HWUSI-EAS1795_0092:3:1:19106:1457#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19106:1457#0/1
gfggggggfaggfcfdffffffgageaggggfg
@HWUSI-EAS1795_0092:3:1:19210:1451#0/1
CCTGACTAAAGCGTATCGATACATGCGCAAATT
+HWUSI-EAS1795_0092:3:1:19210:1451#0/1
cYdddadffccfaWc]cdd^ddfcefcdffcfc
@HWUSI-EAS1795_0092:3:1:19295:1454#0/1
CTTTTCCTTCGCCTCCTTCAGCAATCGCTCATT
+HWUSI-EAS1795_0092:3:1:19295:1454#0/1
hhhhhhhhhhhhhhhhhhhhhhhgghhhhhghh
@HWUSI-EAS1795_0092:3:1:19351:1451#0/1
CCTGTATATCCTGGCTTGCACTCACAATGGATT
+HWUSI-EAS1795_0092:3:1:19351:1451#0/1
gggeggggggggefgggaffffggggggfgggg
@HWUSI-EAS1795_0092:3:1:19792:1452#0/1
TGTACGTTTGTGTGAAAACTGGTTTGCAAAATT
+HWUSI-EAS1795_0092:3:1:19792:1452#0/1
ggggcggYfac]ffffffffffdffdfffdacf
@HWUSI-EAS1795_0092:3:1:2691:1465#0/1
AATTGATCATCAAAAAGCGGTATGTGTCCGTAA
+HWUSI-EAS1795_0092:3:1:2691:1465#0/1
ggggaggggdagffffdafaaffffcfgafdgg
@HWUSI-EAS1795_0092:3:1:3221:1461#0/1
GCGCACGCTGCGGAACACACGCTTGCGGGGAGC
+HWUSI-EAS1795_0092:3:1:3221:1461#0/1
fddfffffafc]c[aacBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3334:1460#0/1
GCGAACGATTCGCTGGCAACTGATGAGCAGTGG
+HWUSI-EAS1795_0092:3:1:3334:1460#0/1
deaffffdcffad[dbdfffffab`b]dfddea
@HWUSI-EAS1795_0092:3:1:4841:1469#0/1
TTTCGAAACCCATCCAATCAATCAGCTAAGATG
+HWUSI-EAS1795_0092:3:1:4841:1469#0/1
hhhhhhhhghhgfhhhhfhhgfhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:4992:1461#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4992:1461#0/1
hhhhhehghhhf_ffffhhhhhhefgghehhhh
@HWUSI-EAS1795_0092:3:1:5030:1464#0/1
GGGGAACGCCACCGGCTACGCCCACGATGAAAA
+HWUSI-EAS1795_0092:3:1:5030:1464#0/1
dcffdf[ffcffffffafc]fffffff`c_fff
@HWUSI-EAS1795_0092:3:1:5618:1462#0/1
CCGGCCCACAGCCACTGCCCGCGGAGCCAGTTG
+HWUSI-EAS1795_0092:3:1:5618:1462#0/1
gggggggggggggcggdaggdgfdggggfgggg
@HWUSI-EAS1795_0092:3:1:5702:1466#0/1
AAAGAACATACCGCAGGCCAAGAATCTGAACGC
+HWUSI-EAS1795_0092:3:1:5702:1466#0/1
hhghaehahhcfghhgghahhgchhdhfehhhh
@HWUSI-EAS1795_0092:3:1:6598:1465#0/1
CGGAAGTGATGGAGCTGGTGGATTCGGCGGGTC
+HWUSI-EAS1795_0092:3:1:6598:1465#0/1
hhhhhhghhhhhhhgghhghhgghhheghhg[_
@HWUSI-EAS1795_0092:3:1:6710:1468#0/1
GTGCATTCTGGGAAGTGTTAACTGATCCAGCAT
+HWUSI-EAS1795_0092:3:1:6710:1468#0/1
fcfdffdgggfggggfaggggg]gggggggggg
@HWUSI-EAS1795_0092:3:1:7967:1465#0/1
CGATCTTCTTGATGTAAGAGGACACTTCCTTCT
+HWUSI-EAS1795_0092:3:1:7967:1465#0/1
hghfhhhhhgehhfhhgghgghfhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:8022:1462#0/1
TGCGAGACCAGTTTGCAGCCAGAGCGCTTCGAA
+HWUSI-EAS1795_0092:3:1:8022:1462#0/1
hhhhhhhhhhhhhhghhghhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:8403:1467#0/1
TTCACACACGCCGGCGACAAAGTTAAATGCTTT
+HWUSI-EAS1795_0092:3:1:8403:1467#0/1
gggfgggeggggggggegefggeggfggggggg
@HWUSI-EAS1795_0092:3:1:8484:1468#0/1
TAGTAATAGGGCTTGAAGTTGAGTGCGTTGAAG
+HWUSI-EAS1795_0092:3:1:8484:1468#0/1
hghhhhhhhhhghhhhhhhhgcfhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:8565:1460#0/1
CTCGGTGTCTGTCAGATCGGAGCGTACATCCTC
+HWUSI-EAS1795_0092:3:1:8565:1460#0/1
hghhhhhhhhghhhgcfhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9250:1463#0/1
GGCGGGAGTAACTATGACTCTCTTAAGGTAGCC
+HWUSI-EAS1795_0092:3:1:9250:1463#0/1
hhhhhhghghhfhhhdhhhhhfhhhhfhfghhh
@HWUSI-EAS1795_0092:3:1:9880:1464#0/1
CGGACATTGTTCTCCATCTCCTTCATGTCGGTC
+HWUSI-EAS1795_0092:3:1:9880:1464#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhghhhbd
@HWUSI-EAS1795_0092:3:1:10025:1462#0/1
CAAGATTATTACGTTGCGCTGCCACTGAAATCC
+HWUSI-EAS1795_0092:3:1:10025:1462#0/1
hhhhghhhhhhhhhhfhhhhfhhhhhghhhhhf
@HWUSI-EAS1795_0092:3:1:10103:1462#0/1
CGGATGCAATAACATTGACGAACGTCGTCTTCC
+HWUSI-EAS1795_0092:3:1:10103:1462#0/1
ggggf]ggggggggaggggfggggcfggfgegg
@HWUSI-EAS1795_0092:3:1:10519:1461#0/1
GGGCACTGGATCTCGCACAGGTAAACAGGCTCC
+HWUSI-EAS1795_0092:3:1:10519:1461#0/1
hghfhhhhhhhhfhhhhhhhhfhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:10669:1463#0/1
TGGTAATCACTGGACGCAATTTACCGCCCAGAC
+HWUSI-EAS1795_0092:3:1:10669:1463#0/1
ghhhhhhhhhhfghhhahhgghghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:10833:1465#0/1
TTTAAGTACAAATGCTAAATTAGGCTTAGTAGG
+HWUSI-EAS1795_0092:3:1:10833:1465#0/1
hhhhhhhhhhhhhhhghhhhhhhhghhhgghhh
@HWUSI-EAS1795_0092:3:1:10911:1460#0/1
CTTCGGCTTGCCATAAGTGCATCCTTTGGGAAC
+HWUSI-EAS1795_0092:3:1:10911:1460#0/1
ffgggggfggggfafcdfffffgggggggggge
@HWUSI-EAS1795_0092:3:1:11085:1463#0/1
GTGCAAACTGCTCTGCAGCTGGTTCCAGTGGTG
+HWUSI-EAS1795_0092:3:1:11085:1463#0/1
Ybaabaa^K_a\dddcd`L\]aQSYWUSYYSRa
@HWUSI-EAS1795_0092:3:1:11382:1467#0/1
CTGATTCTGATGCGAGTGCTTGAGGGCGTCGGC
+HWUSI-EAS1795_0092:3:1:11382:1467#0/1
ggccggcfcfcaeee[`aacc\\]`]a[^cdaW
@HWUSI-EAS1795_0092:3:1:11467:1460#0/1
GTGCATACGAGCTGAACATCATGTGCGAATCCA
+HWUSI-EAS1795_0092:3:1:11467:1460#0/1
hhhhhghhhhhhhhhhhhhhhgchghghhhhgg
@HWUSI-EAS1795_0092:3:1:11635:1468#0/1
GCAGCTCAACCAGAAGCTGCAGGACGCCACCTT
+HWUSI-EAS1795_0092:3:1:11635:1468#0/1
gggggggfggggdggggcgggggdgace_aecg
@HWUSI-EAS1795_0092:3:1:12199:1459#0/1
TCACGATCCATCCGTCCACGGACCACCAGACTC
+HWUSI-EAS1795_0092:3:1:12199:1459#0/1
hhhghfhhhghhhgghhhhghhhhghhhchhhf
@HWUSI-EAS1795_0092:3:1:12319:1464#0/1
ATCGGAATTAACCAGACAAATCACTCCACGAAC
+HWUSI-EAS1795_0092:3:1:12319:1464#0/1
hhhhhhhhhhhhhhhhghhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12703:1467#0/1
GTCGTAACGACGCCTGCCCTGAGCTCCCTTGCG
+HWUSI-EAS1795_0092:3:1:12703:1467#0/1
ggffdffffdffffdffggfdggggggggccec
@HWUSI-EAS1795_0092:3:1:13266:1461#0/1
GAAACATCCTAAAGACAGCCAGCAGGCACGACA
+HWUSI-EAS1795_0092:3:1:13266:1461#0/1
hehhdhhhhhghhgfhghhhfhhhghghffhhf
@HWUSI-EAS1795_0092:3:1:13327:1467#0/1
TTAAATTAGAGCTCACGTGAAGTATATTTCCAC
+HWUSI-EAS1795_0092:3:1:13327:1467#0/1
gffffgggecgf[fdfdfddcfggggggggdgg
@HWUSI-EAS1795_0092:3:1:13459:1460#0/1
GAGAAGCCCGCCGAAAATGGATCAGCGACCGAG
+HWUSI-EAS1795_0092:3:1:13459:1460#0/1
hhhhhhhhhhhhhghghcffcdhhhhfhhhhef
@HWUSI-EAS1795_0092:3:1:13579:1462#0/1
GAAAATTTTAAATGGCCGCAGTATTTTGACTGT
+HWUSI-EAS1795_0092:3:1:13579:1462#0/1
fccdfccggcgafcabdcffffdffff\\cd^f
@HWUSI-EAS1795_0092:3:1:13682:1469#0/1
GTGTAAGCCAGGTTGGTTTCTATCTTTAAAAAA
+HWUSI-EAS1795_0092:3:1:13682:1469#0/1
hhhhhhhhhhhhhhhhhhhhhgfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14581:1469#0/1
CTGACGGATCAGGACGCGAGCATGATGGATGGA
+HWUSI-EAS1795_0092:3:1:14581:1469#0/1
hhhhhhhghfhhhhhhhhghgghggchhhghhh
@HWUSI-EAS1795_0092:3:1:15297:1467#0/1
GCGTCCTCCAGTCGGCTGGCACAAAATGGTAGC
+HWUSI-EAS1795_0092:3:1:15297:1467#0/1
f_fbffffdcfcffdfW[ac[dfddcPY]S]\f
@HWUSI-EAS1795_0092:3:1:16358:1469#0/1
TTTTTTTGTTTCGCGCAGACACATATACGAACA
+HWUSI-EAS1795_0092:3:1:16358:1469#0/1
gggggggggeggggfggcgfgggcdcggcggga
@HWUSI-EAS1795_0092:3:1:17028:1463#0/1
AGGAGGAGAGCGACGAAAGGGCCGCTGGTGATA
+HWUSI-EAS1795_0092:3:1:17028:1463#0/1
_cc^afccfffda\cbeWeffBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18616:1459#0/1
CACCGGTCCAGGGGCACTTCTTGTCGATGTAGG
+HWUSI-EAS1795_0092:3:1:18616:1459#0/1
hhhhgghhhhghghhghhhhhheghhhhhfghh
@HWUSI-EAS1795_0092:3:1:18862:1459#0/1
CGCGATTTAACCGACTACCTGATGAAGATTCTT
+HWUSI-EAS1795_0092:3:1:18862:1459#0/1
ffff_cd\aa^a[ZZY^]aZ\^JZZ]X[^^a^d
@HWUSI-EAS1795_0092:3:1:2402:1474#0/1
CAAACCTAATCTTAAGCGAAAAGTTGAACTTGC
+HWUSI-EAS1795_0092:3:1:2402:1474#0/1
hhefhhhghhhhhfhhhghhhhcafcfffffdf
@HWUSI-EAS1795_0092:3:1:2578:1480#0/1
CCTTGATCGCTTTGATGGTCATCTCGTTGCTGT
+HWUSI-EAS1795_0092:3:1:2578:1480#0/1
hghgdhhhhhhhgchh]ffhdhhhhhhgggheh
@HWUSI-EAS1795_0092:3:1:3081:1474#0/1
TCCGCTTCGACTGCCAGGTCACGAAAGCACTGA
+HWUSI-EAS1795_0092:3:1:3081:1474#0/1
fhhhghhhgghhhhhfhhgfhhghghgdafffh
@HWUSI-EAS1795_0092:3:1:3253:1477#0/1
GAATTGTCATCCTGCAAGATGGCCTTTAGGAAA
+HWUSI-EAS1795_0092:3:1:3253:1477#0/1
ddcWe[b__\_`WRcccfcaaddcfffff`cdc
@HWUSI-EAS1795_0092:3:1:3553:1471#0/1
GCCGTCTTCTCGGGCGCAGCATCGCCGGCCTGC
+HWUSI-EAS1795_0092:3:1:3553:1471#0/1
hhhhhhhhhhhghhghhhhfhhhhhhghhhegd
@HWUSI-EAS1795_0092:3:1:3640:1480#0/1
CGCCTGCATCAGCCCCATTGTCCAAAAATAGAT
+HWUSI-EAS1795_0092:3:1:3640:1480#0/1
egfaafffcfffaaKeefffdfcffffgggggg
@HWUSI-EAS1795_0092:3:1:4545:1471#0/1
ATGGCCGTATCGACTCCGCTGGTGATACTGATA
+HWUSI-EAS1795_0092:3:1:4545:1471#0/1
gggggggggcggdffffdf_ff^eddddffdff
@HWUSI-EAS1795_0092:3:1:4651:1478#0/1
GGAACAGTGAAGCTGAAGACTGATTTATGTACT
+HWUSI-EAS1795_0092:3:1:4651:1478#0/1
hhhhhhhhhhghhhhgffhhhhahhhhhfghhh
@HWUSI-EAS1795_0092:3:1:5834:1480#0/1
GTTCAGCGGGCGCAACTCACACGGGCCGTCGAG
+HWUSI-EAS1795_0092:3:1:5834:1480#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:6349:1472#0/1
TGACACTGGCCCAAAGGATTGGATCCGATTGCG
+HWUSI-EAS1795_0092:3:1:6349:1472#0/1
hhhhhhhhgghhhghhfdcggfhhhhhfhahhh
@HWUSI-EAS1795_0092:3:1:7071:1471#0/1
AGCTGCTCCCTTAACCGCAGATAACGACAGCCT
+HWUSI-EAS1795_0092:3:1:7071:1471#0/1
ggggggggggggggggcf[ffdgggggggfggd
@HWUSI-EAS1795_0092:3:1:7220:1472#0/1
TCCCAATCTTCCATTGGGCAAGGTGTGCCTTCA
+HWUSI-EAS1795_0092:3:1:7220:1472#0/1
hhhhghhhhhhhhhhhhhhhhfhehhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7237:1477#0/1
TTCATGGCCTCTGTGAAGCTGGTGGCGCCGGTG
+HWUSI-EAS1795_0092:3:1:7237:1477#0/1
gcgdgeggggggggdegdffffWbbabffcca_
@HWUSI-EAS1795_0092:3:1:7298:1473#0/1
AAAAAATGAAAATTACATAAAAAAAGGTCGCTT
+HWUSI-EAS1795_0092:3:1:7298:1473#0/1
hhhhhghhhhhhhhhhgghhhhhhghdefhfhg
@HWUSI-EAS1795_0092:3:1:8011:1476#0/1
GCCACCGCTGCGATTTCCGTACTCCCGTCGACG
+HWUSI-EAS1795_0092:3:1:8011:1476#0/1
a[dd[c]caW_caffW[aZY`]``b`N^]YZYa
@HWUSI-EAS1795_0092:3:1:8067:1471#0/1
CTGCCCGCAGAGTTTCCTTAAACGACCAGACGA
+HWUSI-EAS1795_0092:3:1:8067:1471#0/1
hhghhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8386:1482#0/1
CTGGGAAGTGTTAACTGATCCAGCATTTGCTGC
+HWUSI-EAS1795_0092:3:1:8386:1482#0/1
hhhghghhhghcghhhhchhhhghhhghaghhg
@HWUSI-EAS1795_0092:3:1:8447:1471#0/1
TGCACGGATCAATTACAGCAATGGAAATTAAAT
+HWUSI-EAS1795_0092:3:1:8447:1471#0/1
ggfgggfggcggggggagagg_ggegggggggg
@HWUSI-EAS1795_0092:3:1:8672:1482#0/1
GTCGGCGTCGAGGCCAAGCAGCCTAACTCTGCC
+HWUSI-EAS1795_0092:3:1:8672:1482#0/1
ccW\SaaQSVVTccc_ccaY[^\a^^Z\\^Z\^
@HWUSI-EAS1795_0092:3:1:8697:1480#0/1
CCTGCTTGCGGACACGAATGTGACGCTGACGGA
+HWUSI-EAS1795_0092:3:1:8697:1480#0/1
fgggfge_ffcfeggcgfdfafacdd]ffWffc
@HWUSI-EAS1795_0092:3:1:8968:1482#0/1
TTGAGATTTAAAATGCAGGAAGAGCACAATGCC
+HWUSI-EAS1795_0092:3:1:8968:1482#0/1
ggggccgddffffggggfcacaX^``Xffaadf
@HWUSI-EAS1795_0092:3:1:8999:1479#0/1
TGTGTTGAAGCGAACGCACCAGACCCAATGCGA
+HWUSI-EAS1795_0092:3:1:8999:1479#0/1
ffcffffggggcggecgeff[agggggggggcg
@HWUSI-EAS1795_0092:3:1:9858:1473#0/1
GCTTTGTGCAGACCTCCTTAAGGCGATAGTCCT
+HWUSI-EAS1795_0092:3:1:9858:1473#0/1
hhhhhhhhhhghhhhhhhhghhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:9943:1474#0/1
AAAGAAGACCCTTTTGAGCTTGACTCTAATCTG
+HWUSI-EAS1795_0092:3:1:9943:1474#0/1
hhhhhhhhhhhhhhheahehhfhghhhhhhhhf
@HWUSI-EAS1795_0092:3:1:10263:1479#0/1
CCAAAATGTACTCCAGCAGCTCCTGCTGGTTGT
+HWUSI-EAS1795_0092:3:1:10263:1479#0/1
hhhhhhhfhhhhhhhhhhfhghhhfhghhhhgg
@HWUSI-EAS1795_0092:3:1:11016:1480#0/1
CGGGACCGTCGGCATGATCCTTGGCAGGGCGAC
+HWUSI-EAS1795_0092:3:1:11016:1480#0/1
hhhhfhhhhhhhhhhfhhhhghafhhhhgchhg
@HWUSI-EAS1795_0092:3:1:11864:1479#0/1
GCCTGAGATGGTCCTTAACCACGTCCAAAGCGG
+HWUSI-EAS1795_0092:3:1:11864:1479#0/1
hhhhhhfhhhhhhhhhhhhhhhghhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12002:1473#0/1
AGAGGGTGTACGACTTCTTGTCGCCGAAGGCGA
+HWUSI-EAS1795_0092:3:1:12002:1473#0/1
hhfhhggfhhhhhhhhhhhfhhdhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:12106:1481#0/1
CCGATTTTCAGCTCGGTGGATGTCATTTTGTCG
+HWUSI-EAS1795_0092:3:1:12106:1481#0/1
hhghhhhhhhhhfhhghhhhcfhhghhhffhhc
@HWUSI-EAS1795_0092:3:1:12240:1473#0/1
GCTGCACTTGGATGTTGTGGGGGATCGGGTGGT
+HWUSI-EAS1795_0092:3:1:12240:1473#0/1
ggggggcggfgcgaggagagggfcgggffaff`
@HWUSI-EAS1795_0092:3:1:12286:1474#0/1
GCCGCCTTGATGTCGCGATGCAGCTTGCGCTCC
+HWUSI-EAS1795_0092:3:1:12286:1474#0/1
hfhhhhhhhhgfhhhdhhhghhhhgh]V]YK]b
@HWUSI-EAS1795_0092:3:1:13228:1474#0/1
CTAAGCTGTCGCACAAATGGCGCAAGCCCAAGG
+HWUSI-EAS1795_0092:3:1:13228:1474#0/1
hhhhghhhhhhhhhhghghfghhhgghhggehg
@HWUSI-EAS1795_0092:3:1:13280:1471#0/1
GTTGGCTGCATTATGATGTTGGTTATATGCTTG
+HWUSI-EAS1795_0092:3:1:13280:1471#0/1
ggggggggggggcgfgcfgggcggggggeggge
@HWUSI-EAS1795_0092:3:1:13388:1479#0/1
GCCGTACTACCATGGAAGTCTTTCGCAGAGAGA
+HWUSI-EAS1795_0092:3:1:13388:1479#0/1
hghhhhhhhhhhhhhhhhhhfhhhchhhhhghf
@HWUSI-EAS1795_0092:3:1:13784:1482#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13784:1482#0/1
hhhhgghhhghghhfhhhhhdehehffhehgfh
@HWUSI-EAS1795_0092:3:1:14285:1479#0/1
CGGATAACGTGGTCGGCCGCCAACGGCAATGAC
+HWUSI-EAS1795_0092:3:1:14285:1479#0/1
hhhhhhhhhghhghhhghfgheehhhchhfggh
@HWUSI-EAS1795_0092:3:1:14640:1480#0/1
ATTTTAGGGATCGGCATAACCGTATCTTTGGTT
+HWUSI-EAS1795_0092:3:1:14640:1480#0/1
ghhhhhhhhhhhhehhhhfhhhghhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:15158:1480#0/1
GTTAGCATCAATCAAGAGTTCCATTTAGTGGGC
+HWUSI-EAS1795_0092:3:1:15158:1480#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:15209:1471#0/1
AAGCTCTCCAAGAAGAAGCTGCAGCGCCAAAAG
+HWUSI-EAS1795_0092:3:1:15209:1471#0/1
hhhhhhhhhhhhhhfhhhhhhhhhhhhghfhhh
@HWUSI-EAS1795_0092:3:1:15443:1480#0/1
TAAAATACGAAATATATAGCAGCAACCAACCAA
+HWUSI-EAS1795_0092:3:1:15443:1480#0/1
acdd[[__d[dacaW^a\_ZZVfcffffcaWff
@HWUSI-EAS1795_0092:3:1:15510:1479#0/1
CAGCCAGGTTGAGGGACAATGCCGCCCGTGCCA
+HWUSI-EAS1795_0092:3:1:15510:1479#0/1
ggegggffdcfffcfdfffcffgdfgggedegg
@HWUSI-EAS1795_0092:3:1:16065:1472#0/1
CTACTCCATGCCTGGATATTCCTGCTCCGTGCG
+HWUSI-EAS1795_0092:3:1:16065:1472#0/1
gfggggffffffgefgfggfggfcfffff]]fc
@HWUSI-EAS1795_0092:3:1:16242:1479#0/1
CTGGTGACCTTCGAGCGAACGGCAAACATCAAT
+HWUSI-EAS1795_0092:3:1:16242:1479#0/1
gggggggggggggggggggggggggggggggge
@HWUSI-EAS1795_0092:3:1:16747:1481#0/1
CAAGTTTGTATTCTTCGATTATCGGTTTTTTGC
+HWUSI-EAS1795_0092:3:1:16747:1481#0/1
dccfffccfcfcffaffa\acccaaaaaIa[[Z
@HWUSI-EAS1795_0092:3:1:17441:1473#0/1
TGGAGTTGGCGTTGGGGCCGCGACGACGGCCGA
+HWUSI-EAS1795_0092:3:1:17441:1473#0/1
afdWddcfffffffffffd_df_ccc^]ad[aa
@HWUSI-EAS1795_0092:3:1:17832:1473#0/1
CGCGTTTGCAGTCCGGAGTCCAGTTGATTTCCA
+HWUSI-EAS1795_0092:3:1:17832:1473#0/1
ggagggggggggff_fcfdfdcd`ddbdaddfg
@HWUSI-EAS1795_0092:3:1:18236:1471#0/1
GCTGCCGCTTCCGCTGCTGCTGATGTTACTGCT
+HWUSI-EAS1795_0092:3:1:18236:1471#0/1
ggcgggggggfgggggaggfcf[_]cfgggggg
@HWUSI-EAS1795_0092:3:1:18352:1478#0/1
TGGGTGCGATCGCCTCACCGGAGATGGCCCGAG
+HWUSI-EAS1795_0092:3:1:18352:1478#0/1
hhhhhhhhhhhhhhfhghhghecfefehhfhdg
@HWUSI-EAS1795_0092:3:1:18933:1479#0/1
GTTAAGCGCCGCAGCATTGGCTGGTTAAGTGAT
+HWUSI-EAS1795_0092:3:1:18933:1479#0/1
hhhhhhghhhhhhhhahhhhgfff[addd``Qb
@HWUSI-EAS1795_0092:3:1:1521:1486#0/1
GAGATTATCCGTAGTCAACGTTACCCCCGATTC
+HWUSI-EAS1795_0092:3:1:1521:1486#0/1
c__cdccfffefcff_fcffaacfffaffRff`
@HWUSI-EAS1795_0092:3:1:1763:1488#0/1
CGGCGAGGCATCAAGAAGCTGGCTGGCTCGCTT
+HWUSI-EAS1795_0092:3:1:1763:1488#0/1
gdgfcgff^gafdc_ffacffffdcffWa^adb
@HWUSI-EAS1795_0092:3:1:2041:1486#0/1
CCTCGATGTTGGATTAAGATATAATTTTGGGTG
+HWUSI-EAS1795_0092:3:1:2041:1486#0/1
ffcdffcffffffgeggfcff^fcfffggfggg
@HWUSI-EAS1795_0092:3:1:2474:1490#0/1
AGATCACCGAGATGATGAAGGGCTACCACTCAA
+HWUSI-EAS1795_0092:3:1:2474:1490#0/1
fgfcfafff^fcfffRfcccb^c`Yedccfcfd
@HWUSI-EAS1795_0092:3:1:2535:1482#0/1
GCGTGACTGGGCGCTGCGCCTTCTCTATCTCCA
+HWUSI-EAS1795_0092:3:1:2535:1482#0/1
gggggagggggdfggggdfffdfdfcffggggf
@HWUSI-EAS1795_0092:3:1:2613:1493#0/1
CAAAGTCCAGCACCTTAAAGTGCTCGTCATCCG
+HWUSI-EAS1795_0092:3:1:2613:1493#0/1
hhhhhhhhhhhhhhhhhhhaghffffefffffd
@HWUSI-EAS1795_0092:3:1:3116:1487#0/1
GGTCGCTGCGCAAACTGCACGCCGTACTGTTGC
+HWUSI-EAS1795_0092:3:1:3116:1487#0/1
ffeffffghhhhhhhghhhhhhhfghhggggdf
@HWUSI-EAS1795_0092:3:1:3525:1484#0/1
CAGTGATCTGCAGCTGGAGCGCGTCAGTGTCTA
+HWUSI-EAS1795_0092:3:1:3525:1484#0/1
hhcfhhhhhhhhhfhfghhhhhhfgheefefff
@HWUSI-EAS1795_0092:3:1:3579:1493#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3579:1493#0/1
gggggggggggfcfaffcffdfgcgegc[fffg
@HWUSI-EAS1795_0092:3:1:3662:1485#0/1
GCAAGGTCGAGCAGGCCCTCGAGGATCAGTTCA
+HWUSI-EAS1795_0092:3:1:3662:1485#0/1
hghhhhghhhgfhehhhhhhhfgghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3875:1489#0/1
GCGGTACTTGGTCAGATGCAGATTGTTCAATCT
+HWUSI-EAS1795_0092:3:1:3875:1489#0/1
ggfffdfddfffggggcfdcdffffffgggggg
@HWUSI-EAS1795_0092:3:1:4064:1483#0/1
AGAACCTGCGCGTGTACACCCAGTACTCCGTGG
+HWUSI-EAS1795_0092:3:1:4064:1483#0/1
\W]aaaac\YacaabaSaaa^\a]aabcY_ccc
@HWUSI-EAS1795_0092:3:1:5343:1487#0/1
CGAGGACTCGCCAGCCAACAAAATCAACACCGG
+HWUSI-EAS1795_0092:3:1:5343:1487#0/1
hhhhghghhhhhhfhhgghghghhfhghghhhh
@HWUSI-EAS1795_0092:3:1:5391:1490#0/1
CTAGAACTGGATCATCTGTCCCTTGCGCTTCTT
+HWUSI-EAS1795_0092:3:1:5391:1490#0/1
hhhhghhhhhghhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5727:1483#0/1
CTGCAGTGTCTTCACAATCAAGTCCAAATCCGC
+HWUSI-EAS1795_0092:3:1:5727:1483#0/1
ffcc_fa^aabadaffcfffa_ffWffaU\Y^^
@HWUSI-EAS1795_0092:3:1:5902:1490#0/1
TCGAGGTCGACGCCGACACCAAGGAGATGTTGA
+HWUSI-EAS1795_0092:3:1:5902:1490#0/1
hhhhhhhhhhhhhhgheghghgghgfhhchffh
@HWUSI-EAS1795_0092:3:1:6973:1488#0/1
GCAAAATGTTAGGTGCGTTTGCGTTTAGCTGCA
+HWUSI-EAS1795_0092:3:1:6973:1488#0/1
hhhhgghhhhhhhgfhhhghgehhhhhdhghhf
@HWUSI-EAS1795_0092:3:1:7111:1490#0/1
GGAAGGTTGTCATCTCGGATCCGATCCAGATGC
+HWUSI-EAS1795_0092:3:1:7111:1490#0/1
ggggggggcggeggggggdggggfgggf_ffeg
@HWUSI-EAS1795_0092:3:1:7138:1492#0/1
TTAATTTATATGAAAAGTTTAAATAAAGAATTC
+HWUSI-EAS1795_0092:3:1:7138:1492#0/1
hhhghhhhhghhhhhhghhhghhhghhhdhhhf
@HWUSI-EAS1795_0092:3:1:7256:1488#0/1
CGGCTTACACCTCAAATATAATGGCTGGACACA
+HWUSI-EAS1795_0092:3:1:7256:1488#0/1
ff^fffdeggggggcgcgggffgfgfgc]afff
@HWUSI-EAS1795_0092:3:1:7711:1493#0/1
CTTAGCAGTGCACGCAGCAGCCTCTGGATCGGG
+HWUSI-EAS1795_0092:3:1:7711:1493#0/1
hhhhhhhhhhhhhhhhhhghghhhghhhhhfhh
@HWUSI-EAS1795_0092:3:1:8261:1482#0/1
TGGAGAACGAGGCTCTGCTGCAGCGGCAGCGCG
+HWUSI-EAS1795_0092:3:1:8261:1482#0/1
gggdffcfffffdffaddffffafcddSXVVOQ
@HWUSI-EAS1795_0092:3:1:8727:1489#0/1
TGCAACAATGCCACGGAGCTGGAGCTGCGGGAC
+HWUSI-EAS1795_0092:3:1:8727:1489#0/1
_eggggggggfgfffffgg_c^eaa[efff_]f
@HWUSI-EAS1795_0092:3:1:9285:1493#0/1
TTCAGTACAGGTTGATCTTCTTGAGTATTGTCT
+HWUSI-EAS1795_0092:3:1:9285:1493#0/1
gggggggggggggdfggggggg]fffffggggg
@HWUSI-EAS1795_0092:3:1:9800:1489#0/1
GCAATTGGAGCCACCACTGCCCTCCAGGCGAAA
+HWUSI-EAS1795_0092:3:1:9800:1489#0/1
hhghhghhhhhhffcfcbbedecfccchahdhh
@HWUSI-EAS1795_0092:3:1:10013:1487#0/1
TTCTGCGCTTACGCTTCAACCTACGCATACGCT
+HWUSI-EAS1795_0092:3:1:10013:1487#0/1
ggggdgffggggggeggggggggggfggfgggg
@HWUSI-EAS1795_0092:3:1:11394:1483#0/1
CACGTTGTGCACCAGGAACTTCTTGAATCCGGT
+HWUSI-EAS1795_0092:3:1:11394:1483#0/1
ggggggggggggg_ggggggggggcgdggggg`
@HWUSI-EAS1795_0092:3:1:12647:1491#0/1
GGGTGAAGTTGGCTGTGGGATCCTTCTTGATCC
+HWUSI-EAS1795_0092:3:1:12647:1491#0/1
gggcggggggggcggffggfgggggggggfggg
@HWUSI-EAS1795_0092:3:1:12833:1491#0/1
CTCGAGTGTGTGTGTGTGTGCCTGGATTGATTG
+HWUSI-EAS1795_0092:3:1:12833:1491#0/1
hhghehhfffffhfhghhhhcgahgcghccefa
@HWUSI-EAS1795_0092:3:1:13033:1489#0/1
ATGCACGACAGGTCGATCTCGATGTGCCAATTG
+HWUSI-EAS1795_0092:3:1:13033:1489#0/1
hghhhhhhhhhhhghhhhhghhfhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:13656:1486#0/1
CTCGAATACATGGCCACGTCGCCTGTTGAGCAC
+HWUSI-EAS1795_0092:3:1:13656:1486#0/1
hhhhghhhhhhhhhhhhhhhhhhhhhhhehhhh
@HWUSI-EAS1795_0092:3:1:14043:1493#0/1
TGGGGATTCGGTTTAACAAGTAAAACGTTTGTA
+HWUSI-EAS1795_0092:3:1:14043:1493#0/1
ff_fYffddddWfffffaffcffcff[fcadff
@HWUSI-EAS1795_0092:3:1:14162:1487#0/1
GGAGACAAAGCGTCTGCAGGACGAAGTGGAAGA
+HWUSI-EAS1795_0092:3:1:14162:1487#0/1
hhhhhghhhefhhhghhdhhgfchhheheggad
@HWUSI-EAS1795_0092:3:1:14340:1488#0/1
CCGCTCATAATCCGTACATGCCGCCCGCCAATG
+HWUSI-EAS1795_0092:3:1:14340:1488#0/1
hhhhhhhhghhghhhchhfdhhbffcchhggfg
@HWUSI-EAS1795_0092:3:1:14805:1484#0/1
CAAAAGATCGCTACAAAACAACGAATTACAACA
+HWUSI-EAS1795_0092:3:1:14805:1484#0/1
afggggeffc_acffffggcfg[ddcdf[fffg
@HWUSI-EAS1795_0092:3:1:14980:1492#0/1
GCAAGGATGCCAAGAAGAAGGTCCTCGCCGGCA
+HWUSI-EAS1795_0092:3:1:14980:1492#0/1
gggggggffgggggggggggcddffffgggggg
@HWUSI-EAS1795_0092:3:1:15056:1485#0/1
CTTCTTTCTCGGTAACTTGTTGAAAGTATTCAG
+HWUSI-EAS1795_0092:3:1:15056:1485#0/1
cfddcfccdfffadcddfdf_fcfcf]fffffg
@HWUSI-EAS1795_0092:3:1:15253:1493#0/1
GGCAAAATGATATTTAATATCAATATGTTTAGC
+HWUSI-EAS1795_0092:3:1:15253:1493#0/1
ggggggggdgggggggggggggggggcggggge
@HWUSI-EAS1795_0092:3:1:15632:1493#0/1
GTCCGACTACGGAATGACCATGAGATTACACTG
+HWUSI-EAS1795_0092:3:1:15632:1493#0/1
hhhhhhhhhhhhhhghhhhhfghhhhgghhheh
@HWUSI-EAS1795_0092:3:1:16261:1483#0/1
GTTTTTTCGTTAGTGAGTAATTTGACTTGTCTG
+HWUSI-EAS1795_0092:3:1:16261:1483#0/1
hhhhhhghhhhhhghhhhhhhhhhghhhhhghg
@HWUSI-EAS1795_0092:3:1:16935:1494#0/1
GTGCTCTGCTGTTTCACTTTCCCTACTCTCATT
+HWUSI-EAS1795_0092:3:1:16935:1494#0/1
hfhfhhhhhhhhhhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17095:1493#0/1
CGTGGGTCTGTCGAATCGGGGCTCCAGTTTCGG
+HWUSI-EAS1795_0092:3:1:17095:1493#0/1
gggggcgedddefafccffffafffafggaggg
@HWUSI-EAS1795_0092:3:1:17299:1493#0/1
CGTCGACATCCGTAAGGATCTGTACGCCAACAC
+HWUSI-EAS1795_0092:3:1:17299:1493#0/1
gggggffgggecggffggfgg[affffcg_ggg
@HWUSI-EAS1795_0092:3:1:18731:1491#0/1
GGGCGGGGCGTCCCAACTCGAACTTGCGCTTCT
+HWUSI-EAS1795_0092:3:1:18731:1491#0/1
gggggg`ggggggggaggggdageeggegg]ge
@HWUSI-EAS1795_0092:3:1:18813:1489#0/1
CGAGCTCACCACTGTAGTGTGTGCAGTTGCTGC
+HWUSI-EAS1795_0092:3:1:18813:1489#0/1
gegggggfggggggggggggeafffffgggggg
@HWUSI-EAS1795_0092:3:1:19087:1489#0/1
GCGCTTCAGGGTGCCGCGGGTGCCGGTGATGGG
+HWUSI-EAS1795_0092:3:1:19087:1489#0/1
ffffgggffef[[ddadddfddabbbBBBBBBB
@HWUSI-EAS1795_0092:3:1:19203:1493#0/1
CCCGTGCAGGCTGTCCAGGTCTTCGGACGCAAG
+HWUSI-EAS1795_0092:3:1:19203:1493#0/1
fa``bbcdbbebMWZ\ZY^\]`Z[TXXb^dbdb
@HWUSI-EAS1795_0092:3:1:19311:1486#0/1
ATTTTGAGGTAAACGGTCTGAACGTAAACACGG
+HWUSI-EAS1795_0092:3:1:19311:1486#0/1
ggeggcgY`Uabfffffggggfffdffggggeg
@HWUSI-EAS1795_0092:3:1:19763:1493#0/1
CTTTGCTTACATTCCGGATTTGGGTGCCTACGG
+HWUSI-EAS1795_0092:3:1:19763:1493#0/1
hhhhhhhhhhhhhhhhhhhhddffdffhhhhfh
@HWUSI-EAS1795_0092:3:1:2666:1496#0/1
CGAAAAACAAATAACCCGCTTCTACACCAAAGT
+HWUSI-EAS1795_0092:3:1:2666:1496#0/1
hchhhhhhhhhehhhhhchehhaghehhhefga
@HWUSI-EAS1795_0092:3:1:4159:1503#0/1
GTCGTCGATGCTCTTGCCAGCCAGCTCCTTGAT
+HWUSI-EAS1795_0092:3:1:4159:1503#0/1
hghhhhghghgdfhhechhhhhghfgghccdgf
@HWUSI-EAS1795_0092:3:1:4819:1501#0/1
CCCAAGCATGAAAGTGGTTCAGCGGTTTACCCG
+HWUSI-EAS1795_0092:3:1:4819:1501#0/1
hhhhhfhhhhhhdhghghhhghhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:4893:1495#0/1
CGAACTTCATGCAACGGGAGCTGGATAATCCAG
+HWUSI-EAS1795_0092:3:1:4893:1495#0/1
hhhhhhhhhhfhhhhhhhhghhhhhhhfghhhh
@HWUSI-EAS1795_0092:3:1:5678:1504#0/1
AGAAGGCTTCGGCAGGTGGTAAATTTAATCCGA
+HWUSI-EAS1795_0092:3:1:5678:1504#0/1
fgggggggggggffffdffdffggggfcfgggg
@HWUSI-EAS1795_0092:3:1:6325:1500#0/1
CGGGATTGTCAATGTAGATGAGATTGTGTGTCT
+HWUSI-EAS1795_0092:3:1:6325:1500#0/1
hhhhhfhhhhhhhhhhhfghfecgghhfhghgh
@HWUSI-EAS1795_0092:3:1:6526:1501#0/1
TGCCGTTCCAGTTAGGGATTTATGCTCCCGATA
+HWUSI-EAS1795_0092:3:1:6526:1501#0/1
hhhhhhhhhghhhhhhhhhhhgfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7965:1497#0/1
GTTTACCTGTGCGAGATCCAGTGCCCCGAGGTT
+HWUSI-EAS1795_0092:3:1:7965:1497#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhhghhhg
@HWUSI-EAS1795_0092:3:1:8661:1500#0/1
GTTGTTTGTTTTGTTGTAGTAGCTGTTCTTGTT
+HWUSI-EAS1795_0092:3:1:8661:1500#0/1
hhhhhhhhhhhhfhhghhhhfhhhfghhhhchg
@HWUSI-EAS1795_0092:3:1:8825:1501#0/1
TGGGTGAGCTGCAGGCCACGGATGTTGTGGAAG
+HWUSI-EAS1795_0092:3:1:8825:1501#0/1
ggggcfcggggggagfggggf[affffcff]_c
@HWUSI-EAS1795_0092:3:1:9032:1497#0/1
GCGTAATACTGCTGGCGAATCTTTCCCGTGTCT
+HWUSI-EAS1795_0092:3:1:9032:1497#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhacf
@HWUSI-EAS1795_0092:3:1:9418:1499#0/1
CTCGGGGATCCATCAGCGGCGGTGGCACTGGAT
+HWUSI-EAS1795_0092:3:1:9418:1499#0/1
hhhhhhhhghhhhhhhchhfghV_aBBBBBBBB
@HWUSI-EAS1795_0092:3:1:9562:1496#0/1
GAGAAATTACGCACATATCCAGCTCGAGTTGGA
+HWUSI-EAS1795_0092:3:1:9562:1496#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:10714:1501#0/1
GTCTTAGTCTGCTTGCACGGAATGCGGCAGTTG
+HWUSI-EAS1795_0092:3:1:10714:1501#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhc
@HWUSI-EAS1795_0092:3:1:10776:1496#0/1
GTATATATTACCTTTTCATGCGAAACTATGCCG
+HWUSI-EAS1795_0092:3:1:10776:1496#0/1
ggcgggcffgggfgggggggffggdggeggggf
@HWUSI-EAS1795_0092:3:1:11203:1501#0/1
CTGGGGTCATGTGGTGGATGCCCGTGCTGGACC
+HWUSI-EAS1795_0092:3:1:11203:1501#0/1
ggggeggggggggdgggddfffgdgggggffgf
@HWUSI-EAS1795_0092:3:1:11298:1499#0/1
CCTTCATCTCCTCGTCCAGAACCTTCTCCTTGC
+HWUSI-EAS1795_0092:3:1:11298:1499#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhch
@HWUSI-EAS1795_0092:3:1:11448:1496#0/1
CTCTGACCGATTCCCTTGTGTCGAAGGCTGGTA
+HWUSI-EAS1795_0092:3:1:11448:1496#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhfhh
@HWUSI-EAS1795_0092:3:1:11659:1499#0/1
GTTTCCACTGATGCCACCACTCGTGCAGGTCGT
+HWUSI-EAS1795_0092:3:1:11659:1499#0/1
ggggggggggfggggfggfgfggggggggdggd
@HWUSI-EAS1795_0092:3:1:11693:1494#0/1
CTGGGCACCCTTCACTCGCAGCTCGGCCTCCTT
+HWUSI-EAS1795_0092:3:1:11693:1494#0/1
ffdffffgegcggggfgdffefffecfgggggc
@HWUSI-EAS1795_0092:3:1:11710:1502#0/1
GTTCTTCTGCGCTAGGTCCATCTGACACTTCAG
+HWUSI-EAS1795_0092:3:1:11710:1502#0/1
hhhhhhhhhhghhhhhhhhhghhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:11984:1503#0/1
TTTTCGTTTCGGTGTTAGCATCAATCAAGAGTT
+HWUSI-EAS1795_0092:3:1:11984:1503#0/1
d```ggggggg_ddffafcfffgggfgggddgf
@HWUSI-EAS1795_0092:3:1:12361:1501#0/1
GGAATTGGTAGCTCTCCCATGATCTGGTTGCTT
+HWUSI-EAS1795_0092:3:1:12361:1501#0/1
hhhhhhhhhhhhghhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12482:1503#0/1
GATCACCGTCTTCAGCGAACGCGACCCGGCCAA
+HWUSI-EAS1795_0092:3:1:12482:1503#0/1
hhhhhhhhhhhhhhhhghhhhhghhhhhghghg
@HWUSI-EAS1795_0092:3:1:12599:1497#0/1
CAGCCCTGGTGCCATGTCGCTGTACCAGAACTG
+HWUSI-EAS1795_0092:3:1:12599:1497#0/1
hhhhhhhghhhhgfhchhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12704:1500#0/1
GCGATGCAGTCGCTCCACTCGCGCGGACTGGTT
+HWUSI-EAS1795_0092:3:1:12704:1500#0/1
gggggggfgggfggfggggggefffc[cfffeg
@HWUSI-EAS1795_0092:3:1:13116:1504#0/1
GGGTGGCTGGTGATCAGCAGCTGCGAAGCGTTC
+HWUSI-EAS1795_0092:3:1:13116:1504#0/1
cccXc_SK]VPXa[caacc_ccccccc]^aU[U
@HWUSI-EAS1795_0092:3:1:13477:1498#0/1
TAAGAACTTAGCATCTAGTTAATGGGTACACTA
+HWUSI-EAS1795_0092:3:1:13477:1498#0/1
cdffcdcfgggfgfggc_fffcdfffdcfadff
@HWUSI-EAS1795_0092:3:1:13493:1504#0/1
CGGGGAATCGCTTGTGGCACTTGGTGCACTTGA
+HWUSI-EAS1795_0092:3:1:13493:1504#0/1
fgggggggcgd]cffcdeggfggafggggfgag
@HWUSI-EAS1795_0092:3:1:13852:1505#0/1
GCAAGCGGCTAGATGCTGGTTTGAAGTATTTGA
+HWUSI-EAS1795_0092:3:1:13852:1505#0/1
cYfafffggcg_f_fffcfffdaacaaeeeccf
@HWUSI-EAS1795_0092:3:1:15023:1501#0/1
AACTGAAACTGTTCACATGAACTTGGAATTCCC
+HWUSI-EAS1795_0092:3:1:15023:1501#0/1
ggggggggggggggggggcggggggggfggggg
@HWUSI-EAS1795_0092:3:1:15896:1495#0/1
GGATGAAGTCCAGAATATTGGACTTATTTCCAA
+HWUSI-EAS1795_0092:3:1:15896:1495#0/1
hhhhhhhhhhhhhhdhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16324:1498#0/1
TGGAGATCTTAAGCGCCCCAGGGGGATGCAGGC
+HWUSI-EAS1795_0092:3:1:16324:1498#0/1
fff^f]fffdff\O]_`a\\ccff]fWbbbdaf
@HWUSI-EAS1795_0092:3:1:16914:1495#0/1
CAAGGAGGAGGCTGCCGCTACCACCGCTGCTGC
+HWUSI-EAS1795_0092:3:1:16914:1495#0/1
ggggggggggggggggdggaggfffeebefded
@HWUSI-EAS1795_0092:3:1:17332:1503#0/1
GGCGGATGTGGTGATGGCCGGCTGACAACTAAT
+HWUSI-EAS1795_0092:3:1:17332:1503#0/1
fffaf[^c[cc]a\\aa_fffcYdcddcfffff
@HWUSI-EAS1795_0092:3:1:18311:1499#0/1
CTCAAAATGGTTAACATAGTGGACAGCGGGTCG
+HWUSI-EAS1795_0092:3:1:18311:1499#0/1
hhhhhhhfhhhhhhhhhhgghhhhghhhhhggh
@HWUSI-EAS1795_0092:3:1:18559:1495#0/1
ATTCAACAAGCATGACCCGGAGAAAATCTTCGA
+HWUSI-EAS1795_0092:3:1:18559:1495#0/1
ffcgggdfdcfffdfffffdacggdgegggggg
@HWUSI-EAS1795_0092:3:1:18992:1498#0/1
CTGCCTTATCCACTGCTCGATCTCCTCGACGCG
+HWUSI-EAS1795_0092:3:1:18992:1498#0/1
gggggffgggggggfggggggfgggcggfggge
@HWUSI-EAS1795_0092:3:1:19345:1503#0/1
TCCCAAACGCACAGTGCGGCGGCTCCTTCCGCC
+HWUSI-EAS1795_0092:3:1:19345:1503#0/1
hhhfghfhhhffhhefhffccfZK^^BBBBBBB
@HWUSI-EAS1795_0092:3:1:19387:1494#0/1
TACCTGATGAAGATCCTGACCGAGCGCGGTTAC
+HWUSI-EAS1795_0092:3:1:19387:1494#0/1
agggcfddfffcfbfffffffedefdBBBBBBB
@HWUSI-EAS1795_0092:3:1:1057:1517#0/1
GAACGGTTTAAGAATCGAACGAAACTTGCAAGC
+HWUSI-EAS1795_0092:3:1:1057:1517#0/1
ffadfffc]ffdf_ff_ffcffffffdWbea]b
@HWUSI-EAS1795_0092:3:1:1392:1512#0/1
CGGAAGTGCACGTTGGTGCGGATCTTGCGGGCA
+HWUSI-EAS1795_0092:3:1:1392:1512#0/1
aIN]]]a`fffaee`[e^cZ^Ycc^c\\ddfff
@HWUSI-EAS1795_0092:3:1:1803:1517#0/1
CGGGGCGCTGGGCATACTTGCCCTTCTTCAGCA
+HWUSI-EAS1795_0092:3:1:1803:1517#0/1
cOOQV^Q_e`bd]fffdffdfdgggefgggcgc
@HWUSI-EAS1795_0092:3:1:2469:1512#0/1
GAAATGGCCAGCACGGGAGGATTAAGGGGTTCC
+HWUSI-EAS1795_0092:3:1:2469:1512#0/1
hhghhhhhhghhghhhgchhhdghhhhhhdchf
@HWUSI-EAS1795_0092:3:1:2734:1517#0/1
CAACGAAAAACATTATTACATTTTTCCGCGAGT
+HWUSI-EAS1795_0092:3:1:2734:1517#0/1
gcggggfggggggfegggggggfggggWcfacd
@HWUSI-EAS1795_0092:3:1:3447:1515#0/1
AACCAACACAAAAATGGCCAAGCTCGCAATTTG
+HWUSI-EAS1795_0092:3:1:3447:1515#0/1
eea^ee^ffffe__^decaee`ff_fffgffgg
@HWUSI-EAS1795_0092:3:1:3621:1513#0/1
AGTGGTATGACGCTACGTCCGTTGGATTATGCC
+HWUSI-EAS1795_0092:3:1:3621:1513#0/1
hfghhhghhhhhhhhhchhghghffahch[hhh
@HWUSI-EAS1795_0092:3:1:3799:1517#0/1
GTCGATTCCGGTAAGTCGACCACCACCGGACAC
+HWUSI-EAS1795_0092:3:1:3799:1517#0/1
ffffcffdfffcfffffffcffggfggaWdbfg
@HWUSI-EAS1795_0092:3:1:4468:1510#0/1
TGGGGGCGTACTTGAAGTTGGGCCCCACGGTGA
+HWUSI-EAS1795_0092:3:1:4468:1510#0/1
hhhhhghhhhhhhfhhfghhghhhhhhehhhfh
@HWUSI-EAS1795_0092:3:1:4596:1511#0/1
ATTATTGGTTATGTGGATTCTGATTGGGCTGGT
+HWUSI-EAS1795_0092:3:1:4596:1511#0/1
chhhhhhhhhhhhhhhghhfhhfhhhhhchhhh
@HWUSI-EAS1795_0092:3:1:5478:1508#0/1
GCCAAGGATGAGTTCAAGGCTCGTGCCCGTTAT
+HWUSI-EAS1795_0092:3:1:5478:1508#0/1
hhhghhcaghhhgfghhgchehhdchhff]fRd
@HWUSI-EAS1795_0092:3:1:5746:1511#0/1
ATTCTGTAGCATAAAACCAAAGTTTAGCATTTC
+HWUSI-EAS1795_0092:3:1:5746:1511#0/1
hhhghgfhhhhghhgfhghhhhhhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:5798:1511#0/1
CGGAGCAGCCTTCTTAGCCGCTGGGGCAGCAGC
+HWUSI-EAS1795_0092:3:1:5798:1511#0/1
hhfhehhehhhhhhgghhghehfeahghhffga
@HWUSI-EAS1795_0092:3:1:5937:1515#0/1
AAAAAAAGACGTGCGATCTCCGCCTGCAATAGC
+HWUSI-EAS1795_0092:3:1:5937:1515#0/1
fadfffcfccff][a`dfaffcf__[_a``^d[
@HWUSI-EAS1795_0092:3:1:6273:1511#0/1
CCTGCATAAATACTTTGCCGATAATGACATCGT
+HWUSI-EAS1795_0092:3:1:6273:1511#0/1
hhhhhhhhhhhhhhhhghhhhchhfhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6345:1515#0/1
AAAAGGTGGAGTTGTCGGAGATCAAGCAAAAGT
+HWUSI-EAS1795_0092:3:1:6345:1515#0/1
hhhhhhhghghhhhhhhhfghhhhghhhhhcgh
@HWUSI-EAS1795_0092:3:1:7454:1515#0/1
CACGAGTCCTCACCGGAAATCAAGAGAGCCATC
+HWUSI-EAS1795_0092:3:1:7454:1515#0/1
gegggggggcggfgggdgggggggggdgggggg
@HWUSI-EAS1795_0092:3:1:7480:1513#0/1
CGCATCATGAAGTCGGTGGGTCTGAAGCCCGAC
+HWUSI-EAS1795_0092:3:1:7480:1513#0/1
hhhhhhhfhhhhhhhhffghgffhhhhhhhhdh
@HWUSI-EAS1795_0092:3:1:7734:1516#0/1
GGGCACGGAAGTGGAATGGACCACGGGCTGGGT
+HWUSI-EAS1795_0092:3:1:7734:1516#0/1
hhhhhhhhhhgghhhhhhghhghchhhhehhhg
@HWUSI-EAS1795_0092:3:1:8103:1516#0/1
GGGCACTTCCTTGTACAGCTTCTCGTAGGTGGC
+HWUSI-EAS1795_0092:3:1:8103:1516#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:8230:1509#0/1
CGACCTCTCCGGCACCGGGTCCAACATCGCCCT
+HWUSI-EAS1795_0092:3:1:8230:1509#0/1
hhhhhhhghhhhhhhhhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8444:1506#0/1
CTTGGTGCTGATCTGCACATTGAGACCAGTGAC
+HWUSI-EAS1795_0092:3:1:8444:1506#0/1
fggcggggggggggggfggggaggfgfgggggg
@HWUSI-EAS1795_0092:3:1:8635:1513#0/1
ATTTCCGATTCGACTTTAATTTTCACATCAACC
+HWUSI-EAS1795_0092:3:1:8635:1513#0/1
hhhghhhfhhhfgfhhhgfhhhghhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:8745:1516#0/1
CTCGGAGAGACGATCCTCTGCGACGGACAGATC
+HWUSI-EAS1795_0092:3:1:8745:1516#0/1
ggggggfgcggggdgggfgfggfggfffgefgg
@HWUSI-EAS1795_0092:3:1:8901:1512#0/1
AAGTGATAAGAAATTCCTTTCTTAACACAAAAT
+HWUSI-EAS1795_0092:3:1:8901:1512#0/1
hhhhhhhhhghhhhhhhhhhghfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9113:1515#0/1
GACGGCTACACCCAAAATTATATCTTAATCCAA
+HWUSI-EAS1795_0092:3:1:9113:1515#0/1
hghghhghhhhhhhhhgfhggfhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9173:1508#0/1
GTCGGCTGTTGGGGATCAAACTGGGTGGAGGGA
+HWUSI-EAS1795_0092:3:1:9173:1508#0/1
ggggdfggfgcgffdffeded]]dd_dccfdfc
@HWUSI-EAS1795_0092:3:1:9334:1510#0/1
GAAAGATAGTAAGGAAAGTGAAAATAAAAATTT
+HWUSI-EAS1795_0092:3:1:9334:1510#0/1
hhhhhhhhhghhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9748:1506#0/1
TGAAGCTCTTGTTCGGTTTGCTGATGACCGTGC
+HWUSI-EAS1795_0092:3:1:9748:1506#0/1
hhhhhhhhhhehhhhhhhhhggehhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:9844:1517#0/1
GCTGTTTCACTTTCCCTACTCTCATTCGGGTTG
+HWUSI-EAS1795_0092:3:1:9844:1517#0/1
hhhhhhhhhhhhhghhhhhghhhhhhhhhhhhe
@HWUSI-EAS1795_0092:3:1:9892:1517#0/1
GGTCAATCAACTGCAGACCATCCTTTTTCAACC
+HWUSI-EAS1795_0092:3:1:9892:1517#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10051:1508#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:10051:1508#0/1
fa_Rc_fff]]ca`eca`d[``f[fffc_ccf_
@HWUSI-EAS1795_0092:3:1:11060:1512#0/1
GTTTTTATTTACTTTTATTTAGTTCCATGTCCG
+HWUSI-EAS1795_0092:3:1:11060:1512#0/1
dcf_ffc]`fffgfgfdfefffgggfaf_ffce
@HWUSI-EAS1795_0092:3:1:11508:1512#0/1
ATTTGGGGATTTAAGCAAGGACAAAGCGCATCG
+HWUSI-EAS1795_0092:3:1:11508:1512#0/1
fhfhhfhhhhghghhhhhhhfhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11892:1511#0/1
CGCGTCCGCGCCCACATCCGTTTCCGTTTCGAA
+HWUSI-EAS1795_0092:3:1:11892:1511#0/1
hhhhghhfhghhhhhhahhchhehhghhhhhhh
@HWUSI-EAS1795_0092:3:1:12029:1510#0/1
AATACCATGACATACAGTACCATGAAGGTGATA
+HWUSI-EAS1795_0092:3:1:12029:1510#0/1
hhhhhhhfhhghhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12811:1509#0/1
GTTTAGATAAAGATCTCTGTTCGCTTCCTGACT
+HWUSI-EAS1795_0092:3:1:12811:1509#0/1
ggggfgcffggggdgggggggdgggggggagfg
@HWUSI-EAS1795_0092:3:1:12953:1516#0/1
TGAAGCGTTTGTTCATGAGCAAGATCAACAGGC
+HWUSI-EAS1795_0092:3:1:12953:1516#0/1
hhhhhhhhhhhhhhhhhfhhhhghhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:13023:1517#0/1
CGCGAAAAAAACAAGGCGCGTGCGAAAAACAGT
+HWUSI-EAS1795_0092:3:1:13023:1517#0/1
hhghhhhhhhhhhhhhfhhhghhhhhhhghehh
@HWUSI-EAS1795_0092:3:1:13135:1512#0/1
CCTCCACCGGTATCTATGGTCTGGACTTCTACG
+HWUSI-EAS1795_0092:3:1:13135:1512#0/1
ggWWW[EWWVRYggggggcfgeafdffdffffg
@HWUSI-EAS1795_0092:3:1:13514:1513#0/1
GCGTGGACAGCATGACAGCTGCTGTACGAATGC
+HWUSI-EAS1795_0092:3:1:13514:1513#0/1
fafcffWYYSXYffffcffWfBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13752:1512#0/1
GGTCATCAATGTAAGGAAGCTATCGTCACTAAT
+HWUSI-EAS1795_0092:3:1:13752:1512#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:13946:1510#0/1
ATCATTTTCCACAGACCTTATTTGTTTACGTCC
+HWUSI-EAS1795_0092:3:1:13946:1510#0/1
hfhhhhhhhghhh\hghghghfgchghhhhghh
@HWUSI-EAS1795_0092:3:1:14292:1509#0/1
CGTGGATCTACAGCAAACATCCTGGCAAGGAGT
+HWUSI-EAS1795_0092:3:1:14292:1509#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:14318:1515#0/1
TGCGGCGAGGGCGTGGCCGATCCGATGTCCGCC
+HWUSI-EAS1795_0092:3:1:14318:1515#0/1
hhhhhhhhhhhhhhhhhhhgghhhhdgehhhhg
@HWUSI-EAS1795_0092:3:1:14769:1510#0/1
GCCACATTCAACCGCTTATTCGAAGAGAGCGAA
+HWUSI-EAS1795_0092:3:1:14769:1510#0/1
VNYaaaaacaaca\c\cYaaaacaccccccccc
@HWUSI-EAS1795_0092:3:1:14834:1510#0/1
TGAAGGTCTGGGTCTGCTTGGTCGGGATGGTGG
+HWUSI-EAS1795_0092:3:1:14834:1510#0/1
hhghhhhhhhhhhhhhhhghhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15411:1516#0/1
CCCGTCTTTGTCCTTGTGCTGCGAGTTGAGCTG
+HWUSI-EAS1795_0092:3:1:15411:1516#0/1
gggggggegcgfgggfggfgggggfgg[ddfef
@HWUSI-EAS1795_0092:3:1:15941:1508#0/1
CCTGGAGTGAAGGCGCCGGGAACGCCGAAGATG
+HWUSI-EAS1795_0092:3:1:15941:1508#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhggefdfg
@HWUSI-EAS1795_0092:3:1:16086:1506#0/1
TCCTCCTTGGCCAGCGACTCCTTAAACATGCAC
+HWUSI-EAS1795_0092:3:1:16086:1506#0/1
hhhhhhhhhchhghhghghhhhghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:16105:1512#0/1
GCAACATTAACAAATAGAAAGAAACAAAACAAA
+HWUSI-EAS1795_0092:3:1:16105:1512#0/1
fgffdff_fcffgggg]dfaafccffffegf`g
@HWUSI-EAS1795_0092:3:1:16727:1509#0/1
TGTCCACATACATGCGGGTTTTCAAGATCGGCG
+HWUSI-EAS1795_0092:3:1:16727:1509#0/1
[QaccXVa\cca\^\RLWSa[Rccc\cccc^Yc
@HWUSI-EAS1795_0092:3:1:16745:1507#0/1
TTTTAAACTTGTACTGGCAAATATCGCAATGTT
+HWUSI-EAS1795_0092:3:1:16745:1507#0/1
fcgggggggggcfdfffggggggggggggdggf
@HWUSI-EAS1795_0092:3:1:17289:1514#0/1
TCACTGGTCAGCAGCCAGTGTTCTCCAAGGCCC
+HWUSI-EAS1795_0092:3:1:17289:1514#0/1
eYedddeggggcdcffcfffffggggggggggg
@HWUSI-EAS1795_0092:3:1:17491:1507#0/1
CCGGTCCCCGCCGTTCCCTGAAGAAGCTGAAGA
+HWUSI-EAS1795_0092:3:1:17491:1507#0/1
afff_ffa]^[Z_^bddPM^UTXV]OXYYZWYd
@HWUSI-EAS1795_0092:3:1:18057:1508#0/1
AGGAAATCAAACACTCTTCATTTGTTAGTCTTC
+HWUSI-EAS1795_0092:3:1:18057:1508#0/1
ggggggcggg_fggggggggggdggcgggggcg
@HWUSI-EAS1795_0092:3:1:18149:1513#0/1
CGGGGCACGTACTTGCCACCGGACGCCTCATTG
+HWUSI-EAS1795_0092:3:1:18149:1513#0/1
hhhhfhhhhhghfhhhgfffhh[d`cbdfdfec
@HWUSI-EAS1795_0092:3:1:18211:1515#0/1
CTGGAGCTGGCTCAGGTTCGGGCTCTTGCTCGC
+HWUSI-EAS1795_0092:3:1:18211:1515#0/1
hhhhhhhhhhhghhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18503:1511#0/1
GTACAACTGCGACAAGATGATCTGCCGCAAGTG
+HWUSI-EAS1795_0092:3:1:18503:1511#0/1
ccc\cbaTZTYYaaaca\a^[acacccaa\^Y[
@HWUSI-EAS1795_0092:3:1:18546:1508#0/1
AAGCAGGAGACGCTGCTCCAGAACTCCATGCTC
+HWUSI-EAS1795_0092:3:1:18546:1508#0/1
ggggg_efaffaf\`f`bb`]^faaccc__cWb
@HWUSI-EAS1795_0092:3:1:18964:1513#0/1
TCCCAGTGTGCACTCTTATCCTTGGGATCCACC
+HWUSI-EAS1795_0092:3:1:18964:1513#0/1
fgffcf`cdcffgfgggcfffffcffcefdffg
@HWUSI-EAS1795_0092:3:1:19062:1507#0/1
CGGTGAACTTGTGGAGCACCTCGCGCGTGTTGC
+HWUSI-EAS1795_0092:3:1:19062:1507#0/1
hhhhhhhhhhghhhhhhhhhghhhhhhdhhgfh
@HWUSI-EAS1795_0092:3:1:19446:1512#0/1
TCAATGAGGTAGTAATCGGAGCTCCCTACTGTG
+HWUSI-EAS1795_0092:3:1:19446:1512#0/1
fgggf_gccdffdff_ffcccc^ac^aaccccf
@HWUSI-EAS1795_0092:3:1:3687:1523#0/1
CGCCCCTTATTTATCATTGCAGTCCAGCACGGA
+HWUSI-EAS1795_0092:3:1:3687:1523#0/1
eadffc]ffffc`aff[ddffbffffdfdfdff
@HWUSI-EAS1795_0092:3:1:3969:1528#0/1
CGCTTGCAATTTCATGTGATAGCGCATCTGTAT
+HWUSI-EAS1795_0092:3:1:3969:1528#0/1
c]aaZSa]^BBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4182:1528#0/1
ACTAAACCGACGGTTAAAACGTTAAATGCCAAA
+HWUSI-EAS1795_0092:3:1:4182:1528#0/1
gcgggggfgggggggggcffdfgggggggfggg
@HWUSI-EAS1795_0092:3:1:4311:1522#0/1
ATTTAAACGGAAATTACGCGGAGCAACGCAGCA
+HWUSI-EAS1795_0092:3:1:4311:1522#0/1
\Zcddddfcc]ddddddafff[aa^da^^^^af
@HWUSI-EAS1795_0092:3:1:5256:1520#0/1
ATCCACAAAGACACGTATAGCAGAAAAGCCAAG
+HWUSI-EAS1795_0092:3:1:5256:1520#0/1
hhghhhhehghhhhhhgghhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6322:1527#0/1
GCGGCCGCCCAGAAGAAGCAAAAGAAGAAGTTC
+HWUSI-EAS1795_0092:3:1:6322:1527#0/1
[gfffa_cfcca]`d[bggfcgggPgcfef_e]
@HWUSI-EAS1795_0092:3:1:6426:1518#0/1
CTAAAGTCCTTCCTCAAACTGGCGGGCTTCAAG
+HWUSI-EAS1795_0092:3:1:6426:1518#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7135:1529#0/1
TATCAAAAACCGCATTTGTTCGGATCCAATTTA
+HWUSI-EAS1795_0092:3:1:7135:1529#0/1
hhhhhhhhhhhhhhhhhhhhhghfghhhehhgh
@HWUSI-EAS1795_0092:3:1:7261:1527#0/1
GTTTTTCATTGCTGCTGTTGAAGGGCGGTGCAA
+HWUSI-EAS1795_0092:3:1:7261:1527#0/1
gggfgggggggfgdgggggffegggcggggggf
@HWUSI-EAS1795_0092:3:1:7435:1522#0/1
GGATGATTACACTATGGTCTCGAATAAGCTGAA
+HWUSI-EAS1795_0092:3:1:7435:1522#0/1
hhhhhhhhhhhhhfhhhhghghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:7650:1518#0/1
CCAGGTGTACCGTCAACTTTTACTCCTAAAGCA
+HWUSI-EAS1795_0092:3:1:7650:1518#0/1
hhhhhhchhhhhhhhhhhhhhhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:7860:1518#0/1
GTTTTGACAATAGAAAGCAATCGAGATAGAAGT
+HWUSI-EAS1795_0092:3:1:7860:1518#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhfe
@HWUSI-EAS1795_0092:3:1:8188:1527#0/1
GCTTATCGCGCCGCAATATGGGACGTTCGCTTT
+HWUSI-EAS1795_0092:3:1:8188:1527#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:8493:1525#0/1
GTTTGTAGCGCTCGACTATCTTGACCGGGACAT
+HWUSI-EAS1795_0092:3:1:8493:1525#0/1
hhhhhhhhhhhhhhhhhhhghhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10263:1519#0/1
GATTTCCTTATGGTCTGCTGCAACAAGGCATTC
+HWUSI-EAS1795_0092:3:1:10263:1519#0/1
gg_fgggggggggggggcfffffffdfffdffe
@HWUSI-EAS1795_0092:3:1:10626:1528#0/1
CGGCATTGGCGCCAACTTCGCCAAGACCATCGG
+HWUSI-EAS1795_0092:3:1:10626:1528#0/1
gfcgffac[cfcfffffggcggffcffdfWfcc
@HWUSI-EAS1795_0092:3:1:10830:1522#0/1
GACGGCACCGCCGACAGTCAGGTCACGGTACTC
+HWUSI-EAS1795_0092:3:1:10830:1522#0/1
hhghhghhhhhhgfghghhhhhghfhhhghhhh
@HWUSI-EAS1795_0092:3:1:11204:1521#0/1
CAGGAACACTGTTTCAAATTTAACAGCTCTAGA
+HWUSI-EAS1795_0092:3:1:11204:1521#0/1
gfggdgggggggggggggggggggfggggcggg
@HWUSI-EAS1795_0092:3:1:11377:1526#0/1
CTCGGGATCCTTGGGAGTTCCGGCCCTGTTCCA
+HWUSI-EAS1795_0092:3:1:11377:1526#0/1
hhhhhhhhhhhcahhhhhhhh_ghhhgggghhg
@HWUSI-EAS1795_0092:3:1:11602:1518#0/1
CGCCGGAAGGCGACGTCATCCGCCCGTCGAACG
+HWUSI-EAS1795_0092:3:1:11602:1518#0/1
hhghhhhhhghhhghhhhghhhhhheaghhhhg
@HWUSI-EAS1795_0092:3:1:12399:1523#0/1
GTACGATCCCTCCATCGGTATCTATGGTCTGGA
+HWUSI-EAS1795_0092:3:1:12399:1523#0/1
hhhhhghhhhhhhehghhhhhhgghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13099:1520#0/1
CCAAGAGGTCTGCGCACTGCCAGGAAGCATGTG
+HWUSI-EAS1795_0092:3:1:13099:1520#0/1
fffffdSdddWdaadYdafcffffffcaR_fdf
@HWUSI-EAS1795_0092:3:1:13356:1528#0/1
TCCGGCGGCGGCAAGGCCAAGAAGAAGAAGTGG
+HWUSI-EAS1795_0092:3:1:13356:1528#0/1
fcfdfffffcf[\^Y\\[dd`[d``bdBBBBBB
@HWUSI-EAS1795_0092:3:1:13379:1523#0/1
CATGGACCTCGGAGGAGCACCCTATGCCTACAC
+HWUSI-EAS1795_0092:3:1:13379:1523#0/1
hhhhhhhhhhhhffgehdghhhghghhhhchhh
@HWUSI-EAS1795_0092:3:1:13834:1522#0/1
GTTCCCTTCAACTCACGGGCCATGGACCTGGGC
+HWUSI-EAS1795_0092:3:1:13834:1522#0/1
fggfdcggggggacaf]fffffgggggfWdfff
@HWUSI-EAS1795_0092:3:1:14350:1528#0/1
GGAGTGTTGTTTGTAAGCATAATTTCCAGATTA
+HWUSI-EAS1795_0092:3:1:14350:1528#0/1
cfcffffggggg`ffffggefgdggggggccfg
@HWUSI-EAS1795_0092:3:1:14558:1528#0/1
CAACATTCCAATTACCCCACCAAATGCCATCGG
+HWUSI-EAS1795_0092:3:1:14558:1528#0/1
ffcffdfggagaggggggcgegggfgggfgdgg
@HWUSI-EAS1795_0092:3:1:16181:1523#0/1
ATGAAAGACACCGAGGTCAACGACAACACCACA
+HWUSI-EAS1795_0092:3:1:16181:1523#0/1
hhhhhhghhhhhhfhhdfhhfghhhhhhhg_hh
@HWUSI-EAS1795_0092:3:1:16632:1520#0/1
CTCGGGCGATACGGCTGATGATTTCATCGAAGG
+HWUSI-EAS1795_0092:3:1:16632:1520#0/1
b`_b^`afdfffdcffc[]ddacdaa[d^addZ
@HWUSI-EAS1795_0092:3:1:16993:1519#0/1
CGGCGCGCTACCAGGCCATGGTCCACTGCGGCA
+HWUSI-EAS1795_0092:3:1:16993:1519#0/1
hhhhghhhhhhhhghhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:17093:1522#0/1
TGTTCAGCTCCACTCGGCAGCCGGCCCTTGAAA
+HWUSI-EAS1795_0092:3:1:17093:1522#0/1
gggggagggggggfgggYcfdfcgggfcKe`dZ
@HWUSI-EAS1795_0092:3:1:18265:1522#0/1
CCTGTGAGCAGCTTTCACTCCTACATACCACAA
+HWUSI-EAS1795_0092:3:1:18265:1522#0/1
fffffW]ffffafafdfa[cdd]dd^cd]dcc^
@HWUSI-EAS1795_0092:3:1:18364:1528#0/1
CCATCATTTTTAGTTGGATTATCAATTCCAATT
+HWUSI-EAS1795_0092:3:1:18364:1528#0/1
gdgggggggggggdffgdffffgggeggfg^gg
@HWUSI-EAS1795_0092:3:1:1405:1537#0/1
CAGCTTTCACTCCTACATACCACAATGGCGGCG
+HWUSI-EAS1795_0092:3:1:1405:1537#0/1
^^Yaa\YYcYacfa^f\cffc^Sacac\^caaa
@HWUSI-EAS1795_0092:3:1:1666:1537#0/1
AACGCCGTTGAGGGAGAATCTGATCGAAAACGT
+HWUSI-EAS1795_0092:3:1:1666:1537#0/1
hhhhhghhhchhcghhhhhhhgahhhghhghgc
@HWUSI-EAS1795_0092:3:1:1954:1536#0/1
AAGAAACTGGGACAACCAACTCCAGTGGAAGGC
+HWUSI-EAS1795_0092:3:1:1954:1536#0/1
ggfgagggggefacfffcffffad^^effffd\
@HWUSI-EAS1795_0092:3:1:2684:1532#0/1
TGACCGATAAGATGATGTTTCAGCAGAAGCATA
+HWUSI-EAS1795_0092:3:1:2684:1532#0/1
ccb^b^\a^aJ^aQaaYc\dcfdaddcffcaaa
@HWUSI-EAS1795_0092:3:1:3155:1533#0/1
CAGGTTGTTGGTGTGTCCGCACTTCTTCTTGCG
+HWUSI-EAS1795_0092:3:1:3155:1533#0/1
ggggggggggggcgagggagegggggggggagg
@HWUSI-EAS1795_0092:3:1:3302:1541#0/1
CGCTGAACCACTTTCATGCTTGGGATTGTGAAC
+HWUSI-EAS1795_0092:3:1:3302:1541#0/1
\cWHR]][]aOaVZ]]ZUaaaBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3775:1533#0/1
AGCGTGCTCTGCGTCGTCTGCGCACCGCTTGCG
+HWUSI-EAS1795_0092:3:1:3775:1533#0/1
aaYaca\dadcddadcSU\]\\f_fff]_ffYf
@HWUSI-EAS1795_0092:3:1:3825:1541#0/1
GTATTTTTGATTTGAAAATTTGGTATAACTCCA
+HWUSI-EAS1795_0092:3:1:3825:1541#0/1
WWWRXZM[[SaSdddd\fffccaffdcf^dfff
@HWUSI-EAS1795_0092:3:1:4800:1536#0/1
GCACAGTGAGCTCTAAGGAGCCAAACTAGAGGG
+HWUSI-EAS1795_0092:3:1:4800:1536#0/1
hhhhhhhghhhhhhhhhhhhhhhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:5189:1540#0/1
CCGGTTTGAACTCAGATCATGTAAGAATTTAAA
+HWUSI-EAS1795_0092:3:1:5189:1540#0/1
dffffff\caccaddW[_aaaa_]cdf_cffaf
@HWUSI-EAS1795_0092:3:1:5215:1537#0/1
GCCCGTCTGGCGCTGGTGATGAAGTCCGGCAAA
+HWUSI-EAS1795_0092:3:1:5215:1537#0/1
ggggggggfgggaacfdfdfdfdgggggfcggg
@HWUSI-EAS1795_0092:3:1:5516:1530#0/1
CCCAGGAACACCACGTATGTGATCAGATCGCCC
+HWUSI-EAS1795_0092:3:1:5516:1530#0/1
cggfggcfcffdgggggdfcfccceeefafdfa
@HWUSI-EAS1795_0092:3:1:7184:1538#0/1
CAGCAACAAATCCGCACCACCAATCAACCAACC
+HWUSI-EAS1795_0092:3:1:7184:1538#0/1
hhhhhhhhhghghfhhhhhhfhcffffhhhghg
@HWUSI-EAS1795_0092:3:1:7453:1535#0/1
TGCGACTATGCGGTTGGCCTCTCAAGGATTTAC
+HWUSI-EAS1795_0092:3:1:7453:1535#0/1
ggggcggggdggfggdgggggfgggagggggge
@HWUSI-EAS1795_0092:3:1:7902:1540#0/1
GTCTCCTCTCCCATGGTCGATCTCAACGTCTTT
+HWUSI-EAS1795_0092:3:1:7902:1540#0/1
d`cffdffffcf]fcfacf[f]dffd[f_cfaf
@HWUSI-EAS1795_0092:3:1:7974:1534#0/1
CTTGTTGACGCAGTCTGGTGATTCTAGTGCACA
+HWUSI-EAS1795_0092:3:1:7974:1534#0/1
gggggggggggggegggggggfgggcgeffffg
@HWUSI-EAS1795_0092:3:1:8008:1532#0/1
CGAAGATGATGAAGATGACGATGTTGATGCCGA
+HWUSI-EAS1795_0092:3:1:8008:1532#0/1
fggffggfcgggfdgcggfcgeaffaad_fffe
@HWUSI-EAS1795_0092:3:1:8381:1531#0/1
GGGTGGTTCAGCACGATGACCTGGGCGGTGAAG
+HWUSI-EAS1795_0092:3:1:8381:1531#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhhbhhgf
@HWUSI-EAS1795_0092:3:1:8671:1534#0/1
TAAGAACAAGAACAAAACTAAAACCAAATGCAG
+HWUSI-EAS1795_0092:3:1:8671:1534#0/1
gggggggggefggfgggffgggggggggfddgg
@HWUSI-EAS1795_0092:3:1:8922:1529#0/1
GAAGACCGACGACGATCTGAAGAAGTTCCTGGA
+HWUSI-EAS1795_0092:3:1:8922:1529#0/1
hhhcchhhhghhehhhhhhhhfhcehhhghhhg
@HWUSI-EAS1795_0092:3:1:9288:1531#0/1
AGCGCCTGAAGGTCCCACCACCAATCCACCAGT
+HWUSI-EAS1795_0092:3:1:9288:1531#0/1
hghhhhhhhhhhdhhhghhhghhhhfhhghfhd
@HWUSI-EAS1795_0092:3:1:9518:1537#0/1
CGGGTCGCTTGTCGTTCGGATCGGGAATCTCGA
+HWUSI-EAS1795_0092:3:1:9518:1537#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:9807:1532#0/1
CCGGCGAATTTCTCCTTGCCGAGCAACAGAAGG
+HWUSI-EAS1795_0092:3:1:9807:1532#0/1
ggfgggaafff]ffaffX^b\`bf]b`gfgaga
@HWUSI-EAS1795_0092:3:1:9830:1538#0/1
CTTCGCGACGCCTTCGGAACTTGACTTGGTACC
+HWUSI-EAS1795_0092:3:1:9830:1538#0/1
hhhhhhfhhhghhhhhgeghhhchhhhghhhhc
@HWUSI-EAS1795_0092:3:1:11316:1538#0/1
GGAAAGACCACGTGTGTGGAAAAGAAGTGCCAG
+HWUSI-EAS1795_0092:3:1:11316:1538#0/1
hhhhhhhhhghhhfhfehhhheghhhebghhgh
@HWUSI-EAS1795_0092:3:1:11615:1534#0/1
CCGTTCTGGAGACTCCGCCCATGATTGTGGTCG
+HWUSI-EAS1795_0092:3:1:11615:1534#0/1
gggggggeggggggggfgggg]Wbbbdggedgg
@HWUSI-EAS1795_0092:3:1:11651:1540#0/1
GAAAAGGCGTCTGAGCCCACTGTTTCTTTTGCC
+HWUSI-EAS1795_0092:3:1:11651:1540#0/1
gggggfgggegggegggggggdgggggggeggg
@HWUSI-EAS1795_0092:3:1:11918:1534#0/1
CCATCATCAGCATGCCAGATGTATTTTGTTTGA
+HWUSI-EAS1795_0092:3:1:11918:1534#0/1
hhhhhghghhhehchhhgafehghhhhhhhhha
@HWUSI-EAS1795_0092:3:1:12130:1530#0/1
AAAAGATCATGGTGGTTCCGCCAGCAAAGGACT
+HWUSI-EAS1795_0092:3:1:12130:1530#0/1
gggggcggggggggggggfgfgfgggggggggg
@HWUSI-EAS1795_0092:3:1:12479:1537#0/1
GTTGGTTTTGTGTGTGTGTGTGTGAATGATTGC
+HWUSI-EAS1795_0092:3:1:12479:1537#0/1
fffdcffff]`dadadddbdbc^aRWdQQUWWd
@HWUSI-EAS1795_0092:3:1:13006:1539#0/1
CGTTTACGGGCCTCGGCGACCTTCTCGGCTGCC
+HWUSI-EAS1795_0092:3:1:13006:1539#0/1
hhhhhhhhgfhhhhhhhhhhhhhhhhacgedah
@HWUSI-EAS1795_0092:3:1:13276:1534#0/1
GTACAGTATGAATTCATTTCGTGTGGTAACTAA
+HWUSI-EAS1795_0092:3:1:13276:1534#0/1
hhgghhhhhhhhhhhhghhhhhghhhghhghhh
@HWUSI-EAS1795_0092:3:1:14085:1534#0/1
AGACAATTTTGTGTTAAGAAAGGAATTTCTTAT
+HWUSI-EAS1795_0092:3:1:14085:1534#0/1
hhhhhhhhhhfhhhhhhhhhhhghhghhhhhhh
@HWUSI-EAS1795_0092:3:1:14228:1531#0/1
GGCGGGATGAGCCAGCCTCTGGTGCTTAGCGTG
+HWUSI-EAS1795_0092:3:1:14228:1531#0/1
gggggggafff_fgcdgdcddf[f]ccggggeg
@HWUSI-EAS1795_0092:3:1:14766:1537#0/1
CGAAGACAATCAAGGCTGTATTAGCATAGCAAA
+HWUSI-EAS1795_0092:3:1:14766:1537#0/1
ggggggggggggggggcggfggfgggdggggge
@HWUSI-EAS1795_0092:3:1:15260:1531#0/1
CGTGCTCGTTCTGGGGATCGTAGAGTCCCTGCT
+HWUSI-EAS1795_0092:3:1:15260:1531#0/1
gggfffgfffffgcfggggfggfgeggegcagg
@HWUSI-EAS1795_0092:3:1:15850:1537#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:15850:1537#0/1
hghhhhhhhhhghhhhhhhhhghhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:16087:1533#0/1
CTCTGCTGTTTCACTTTCCCTACTCTCATTCGG
+HWUSI-EAS1795_0092:3:1:16087:1533#0/1
ggfcafaffffdfdfffcffcfffffaaf_f_b
@HWUSI-EAS1795_0092:3:1:16385:1540#0/1
CAGCACGAAACCAAATCCTGCTCCTTCTCCATC
+HWUSI-EAS1795_0092:3:1:16385:1540#0/1
fgdggggfggggfdffffdcffgggggfgggcg
@HWUSI-EAS1795_0092:3:1:16428:1540#0/1
GCGGAAGTCAAGCAATTACCGAGAATTACTAAG
+HWUSI-EAS1795_0092:3:1:16428:1540#0/1
hhhhghhhhghhhhhhhhhhhfehhhghhhhhh
@HWUSI-EAS1795_0092:3:1:16694:1536#0/1
AGTTGCTGCAAAACATAAACCTAATGCTGGATT
+HWUSI-EAS1795_0092:3:1:16694:1536#0/1
hhhhhhhhfhhhhghchhhhhdhhghhghhhhh
@HWUSI-EAS1795_0092:3:1:17271:1529#0/1
ATCACCGCCCTGGCACCGTCGACCATGAAGATC
+HWUSI-EAS1795_0092:3:1:17271:1529#0/1
dSfffffhhhhhfghhhhhhgghhhhhhdhggg
@HWUSI-EAS1795_0092:3:1:17442:1536#0/1
CCAAAACCCCGACGAACGCGATCCCGGCAGAAT
+HWUSI-EAS1795_0092:3:1:17442:1536#0/1
ffaadcfffacf^[^a\`d`_^dda^[ebddaf
@HWUSI-EAS1795_0092:3:1:18633:1531#0/1
AGCTGCGCGTCTTCTACGAGAAGCGTATGGGAC
+HWUSI-EAS1795_0092:3:1:18633:1531#0/1
`acceeeacdfffffdcccffceeebe\ba``g
@HWUSI-EAS1795_0092:3:1:18748:1532#0/1
CGGTTTCGTTGGTTAGTTGGATTGCTTTGAGTT
+HWUSI-EAS1795_0092:3:1:18748:1532#0/1
ggfggggggcgfff]fdffcdfggcgggfgggg
@HWUSI-EAS1795_0092:3:1:19504:1537#0/1
AAGAAAGCCAAAAAATCTAAGGCTCGTTCGAAG
+HWUSI-EAS1795_0092:3:1:19504:1537#0/1
hhhhhhhhhhhhhhhhhghhhh_ffffhhhhhf
@HWUSI-EAS1795_0092:3:1:19648:1536#0/1
GAAGCATTTGAAGTGTTTAGCCGCCCCCAAGGC
+HWUSI-EAS1795_0092:3:1:19648:1536#0/1
_f_fc[fdd]d^a^ddddd[dcadd``__[^aT
@HWUSI-EAS1795_0092:3:1:2310:1542#0/1
AGTACCTGCAGTCCGTCGAGGATCGCTCCAAGT
+HWUSI-EAS1795_0092:3:1:2310:1542#0/1
ee`dfffggcgggggcgfcfffgggfdggfgff
@HWUSI-EAS1795_0092:3:1:2340:1546#0/1
CCGGACTCTGCATCACTGGGCAACATGACCAAG
+HWUSI-EAS1795_0092:3:1:2340:1546#0/1
hhhfhhhhhhhhcgfhghfghhghhggghghhh
@HWUSI-EAS1795_0092:3:1:2516:1544#0/1
CCCGGTTCAGACATCGCATCACACGGCTTGGCA
+HWUSI-EAS1795_0092:3:1:2516:1544#0/1
hhhgfehhhhhfhhhhhfehahdhffhhhh_gg
@HWUSI-EAS1795_0092:3:1:2885:1542#0/1
GGGAGAACAAGGCAGCGTGGAAGGCTCAGTACT
+HWUSI-EAS1795_0092:3:1:2885:1542#0/1
ffff_fffaffffdc_f[eeWWccadaWd``ac
@HWUSI-EAS1795_0092:3:1:3100:1542#0/1
CGGCGTGCTGAGTCACATTGAATATGCGCCCGG
+HWUSI-EAS1795_0092:3:1:3100:1542#0/1
hhhhhhcffRfafffdfhhhhhdfhaehhhegg
@HWUSI-EAS1795_0092:3:1:3961:1549#0/1
CGCCCTTGGCACGTCCGAATTATCGTTATTGTT
+HWUSI-EAS1795_0092:3:1:3961:1549#0/1
]WP^\^aYc_cBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4001:1542#0/1
CCGCAATTGGACACGAGTAGGCGCAGCATCTCT
+HWUSI-EAS1795_0092:3:1:4001:1542#0/1
gggggggggggggggg]fffffgfggggfgggg
@HWUSI-EAS1795_0092:3:1:4701:1543#0/1
CTTTAATACAGTGTCGCTGCTTAATACTTTTGC
+HWUSI-EAS1795_0092:3:1:4701:1543#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhf
@HWUSI-EAS1795_0092:3:1:5092:1545#0/1
TGTGACTCTGAAGCATGAAGACAAGGACAAAGA
+HWUSI-EAS1795_0092:3:1:5092:1545#0/1
aebcdae\_ZZ`addcacffdfff_df^edbb]
@HWUSI-EAS1795_0092:3:1:5451:1551#0/1
CGTGGAGCTGCTCCTCCAGATAGACACCGGTCA
+HWUSI-EAS1795_0092:3:1:5451:1551#0/1
hhhghhhhhhhghhfhhhhfdhfhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:5596:1548#0/1
GCAATATCTAGCAACAATTGTCTGCACAATATC
+HWUSI-EAS1795_0092:3:1:5596:1548#0/1
hhhgfhhhhhfhhhghhhhchgfhhhhgehahh
@HWUSI-EAS1795_0092:3:1:5769:1544#0/1
GGGCCAGCGCGAGTGTTTTCCTGCGCACCTCGA
+HWUSI-EAS1795_0092:3:1:5769:1544#0/1
gfggdgadfcf]ffffcgggggggcgggceggY
@HWUSI-EAS1795_0092:3:1:6290:1549#0/1
GTTGTTGTTGTTGGTCTAAATGAGGGCGGCTGC
+HWUSI-EAS1795_0092:3:1:6290:1549#0/1
gggggggggggggfggggggg_gggggfggggf
@HWUSI-EAS1795_0092:3:1:7805:1552#0/1
TTCGGATGATTTTCTAAGTAAACCCGCACACAC
+HWUSI-EAS1795_0092:3:1:7805:1552#0/1
ffca]ffafaffff_`f[deeedfff__ffcfc
@HWUSI-EAS1795_0092:3:1:8946:1542#0/1
GCTTTCATCAGCAGACGGTTGTGCTTGTTGGGC
+HWUSI-EAS1795_0092:3:1:8946:1542#0/1
gggggggcgggggcgfgggg_fffffaggfega
@HWUSI-EAS1795_0092:3:1:9070:1541#0/1
CGGCATAGCCATGGGAAAGAACGGGACAGATGT
+HWUSI-EAS1795_0092:3:1:9070:1541#0/1
gggggggggggggggaggadg`gggegdfddf`
@HWUSI-EAS1795_0092:3:1:9132:1542#0/1
GATCGGTTTATTTTAATAACAGTATAAATATGT
+HWUSI-EAS1795_0092:3:1:9132:1542#0/1
f[ffffffffcfcgggggggagfffffffdffg
@HWUSI-EAS1795_0092:3:1:9340:1548#0/1
GCGGTCGTGGCCGTGGACGCTGGGCCCGTGGAC
+HWUSI-EAS1795_0092:3:1:9340:1548#0/1
gggggggfggfae^edd]dcdfggggdfaffQY
@HWUSI-EAS1795_0092:3:1:9778:1550#0/1
GAGAAATGTATTGGTGCCTCCGCCTTTCGACCA
+HWUSI-EAS1795_0092:3:1:9778:1550#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhchghhhh
@HWUSI-EAS1795_0092:3:1:11864:1547#0/1
GCAAGCGAATTTGTCGATTCCCCCGTTTAACTC
+HWUSI-EAS1795_0092:3:1:11864:1547#0/1
hhhhgghhhhhhfhhhhhhghhhhhhhhgfhhh
@HWUSI-EAS1795_0092:3:1:12121:1547#0/1
GTTTATTTAACATAAATGGTTACAAAGTTTTAT
+HWUSI-EAS1795_0092:3:1:12121:1547#0/1
hhhhgghhhhghhdhfhhhghfhhdhehhhchh
@HWUSI-EAS1795_0092:3:1:12536:1545#0/1
AAACAAGTTCAAACTGCAACATCACACGGCATT
+HWUSI-EAS1795_0092:3:1:12536:1545#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12708:1548#0/1
TGTGTGTGTGTGTGTGGCTGGCACAGCTCTAGC
+HWUSI-EAS1795_0092:3:1:12708:1548#0/1
gfgfggggfgegggggagfggfcafffgggggf
@HWUSI-EAS1795_0092:3:1:13260:1547#0/1
CAGGTACACCAATTTAACTTCCGTTGGGTCGAA
+HWUSI-EAS1795_0092:3:1:13260:1547#0/1
hhhhhhhhhhghghhchhhghhghhhhggghhh
@HWUSI-EAS1795_0092:3:1:13437:1541#0/1
GTGCTTGTTCTCGTCCCGAGCTAAGGCCATTTG
+HWUSI-EAS1795_0092:3:1:13437:1541#0/1
hhhhhhhhhhhhhhhhhgfghghhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:13710:1547#0/1
CGGCAAGAAGAGCATCGAGAATGACTTCCGCAA
+HWUSI-EAS1795_0092:3:1:13710:1547#0/1
ccc_cc_RTNTR]]ZW]a[[]]ZZW]]abcc[Z
@HWUSI-EAS1795_0092:3:1:14152:1542#0/1
CGGATGTGCAGATCCCTCATCGGGTTCTTCGCG
+HWUSI-EAS1795_0092:3:1:14152:1542#0/1
hhhhhhgfghehhhhhhgghhhhhhhfghffdh
@HWUSI-EAS1795_0092:3:1:14273:1552#0/1
GGCAACTTCGCCAAGGCTACATATGCCGCCATC
+HWUSI-EAS1795_0092:3:1:14273:1552#0/1
gfgfggggggggfffgggggaaggggggggggg
@HWUSI-EAS1795_0092:3:1:14300:1553#0/1
CAAGGTGACGTTGGAGAACTACTACAGCAACCT
+HWUSI-EAS1795_0092:3:1:14300:1553#0/1
hhhhhhhhhhhhhhfghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14568:1543#0/1
GTGCTAATCTAAAGATTCTAATAAAAAAAAGTG
+HWUSI-EAS1795_0092:3:1:14568:1543#0/1
fff_cccX``a`[ddbddfcdfdfcc_cc]cbd
@HWUSI-EAS1795_0092:3:1:14899:1551#0/1
GCCACGGTTACTACTGCTACACCTGCTCCTGCT
+HWUSI-EAS1795_0092:3:1:14899:1551#0/1
hhhhhehhhhhhhhhhhghhffhhhgchchegh
@HWUSI-EAS1795_0092:3:1:15111:1541#0/1
GGAAACACTCAAGAGAATCCAGAGCCACAAAGG
+HWUSI-EAS1795_0092:3:1:15111:1541#0/1
f_ggfgggggcfggggag_gfaacea_cff]ff
@HWUSI-EAS1795_0092:3:1:15456:1547#0/1
AATTAGACGAGGAAGAGGGCGACGACTATCTGT
+HWUSI-EAS1795_0092:3:1:15456:1547#0/1
hhhfhfchhdhhcghefgfhhhae[dfaggfhg
@HWUSI-EAS1795_0092:3:1:15755:1543#0/1
TCGCTGTATTCCATCTCAAAGTATGGATACCGA
+HWUSI-EAS1795_0092:3:1:15755:1543#0/1
hhhhhhhhhhhhhghhhhhhfhhhhhghhfhhd
@HWUSI-EAS1795_0092:3:1:16180:1545#0/1
TCCATCGCACCAGACGCGCACATCCTTCCGCTG
+HWUSI-EAS1795_0092:3:1:16180:1545#0/1
a^deea[eded[^^c[[ZTV]]Wd`b^BBBBBB
@HWUSI-EAS1795_0092:3:1:16269:1541#0/1
GGGGGTGTTTGGTGTTGGGTGCTTCAAAAAACA
+HWUSI-EAS1795_0092:3:1:16269:1541#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:16881:1544#0/1
CTTGGACATGTTTCTATCGGTGGGTTTTCTTTG
+HWUSI-EAS1795_0092:3:1:16881:1544#0/1
faaff]_ff_fffffdf[ca^_d`]`dfcccc`
@HWUSI-EAS1795_0092:3:1:16933:1552#0/1
CCTCGAAGGTCTCCACCACGTTTTCAGCAACTT
+HWUSI-EAS1795_0092:3:1:16933:1552#0/1
hhghhghhhhhhhghhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:17394:1545#0/1
CGAAAGTGGCCCAATGCTAGCTAAGCATTTGCC
+HWUSI-EAS1795_0092:3:1:17394:1545#0/1
aaQ\\\XadYdaa]b\aadca[_aSa^]fffda
@HWUSI-EAS1795_0092:3:1:17427:1552#0/1
CCGGTGACCGCAGAAATTTCTCTCCCCTCGCTT
+HWUSI-EAS1795_0092:3:1:17427:1552#0/1
hhhhghhhhhhhhhhhhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17932:1550#0/1
GGAATCACCGCCGAATGCTTCGATGTTTTGTTG
+HWUSI-EAS1795_0092:3:1:17932:1550#0/1
hhhhhhhhhhhhhhhghdhhhhecfhhhhehch
@HWUSI-EAS1795_0092:3:1:18167:1545#0/1
CAAACGGATGGTAGCCTTGCTCCAAAAATGGCA
+HWUSI-EAS1795_0092:3:1:18167:1545#0/1
hhhhhhghhhhhhehhhhehhghhghhhggccg
@HWUSI-EAS1795_0092:3:1:18883:1546#0/1
CTGGGATTGTGGGATCCGAAGCGGGCTGTGCAC
+HWUSI-EAS1795_0092:3:1:18883:1546#0/1
cgff^fcf_ffWffafffc^cffffdRZVZZZf
@HWUSI-EAS1795_0092:3:1:19050:1549#0/1
ATGATATTTTAAGACCACTCTTAAACAAACACT
+HWUSI-EAS1795_0092:3:1:19050:1549#0/1
gfggggggeggggaggggggggggggggegggf
@HWUSI-EAS1795_0092:3:1:19255:1551#0/1
GCAGAAGCAGGAGAAGAAGCCCAAGGAAAAGAA
+HWUSI-EAS1795_0092:3:1:19255:1551#0/1
gfgggggcfggggcggfgggggffgdgggeggg
@HWUSI-EAS1795_0092:3:1:19301:1542#0/1
CCCAAGGATAAGAGTGCACACTGGGAAAACACT
+HWUSI-EAS1795_0092:3:1:19301:1542#0/1
ffcdfffc_ffd\a_ccfffdf]ffdf\`Q][f
@HWUSI-EAS1795_0092:3:1:19790:1549#0/1
GACGAGCTTTCCTCCATCAGGCTTACTTCTTGC
+HWUSI-EAS1795_0092:3:1:19790:1549#0/1
Wbfcf`fgegcgggggddfbefdgdggded]af
@HWUSI-EAS1795_0092:3:1:1556:1555#0/1
CACGGGTCAGCCTGTCACCGGACTCGCCCACGC
+HWUSI-EAS1795_0092:3:1:1556:1555#0/1
ZWa[K]]aSXKaW^aca^M^aSabaKY\W\]_S
@HWUSI-EAS1795_0092:3:1:2320:1564#0/1
TGGCGCTGCGAAAACGTTTGCTTTCTCTGAAGC
+HWUSI-EAS1795_0092:3:1:2320:1564#0/1
ggfggf_ggfgeccfdbg_gcgffgegggc]ga
@HWUSI-EAS1795_0092:3:1:2772:1554#0/1
TAGTACTTGGCAGTTTCGAACTTCCACAGGGCG
+HWUSI-EAS1795_0092:3:1:2772:1554#0/1
dfffdffdaffdggfagggggggggggfddd[Y
@HWUSI-EAS1795_0092:3:1:2820:1563#0/1
CGATGATGTCCTTCTGCCTGTTGAGGAACCAGT
+HWUSI-EAS1795_0092:3:1:2820:1563#0/1
ggfgagcgggggdfcffgggggagg_ggfgggg
@HWUSI-EAS1795_0092:3:1:3688:1557#0/1
CCGACTGTCTAATTAAAACAAAGCATTGTGATG
+HWUSI-EAS1795_0092:3:1:3688:1557#0/1
gggagfggcgegggeggfgcg`ccfdfeef[ff
@HWUSI-EAS1795_0092:3:1:3868:1561#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3868:1561#0/1
fffffccaa``a[dddcL\^Ya^add^ecffff
@HWUSI-EAS1795_0092:3:1:4144:1553#0/1
ATGACATTGAGAGAAGGCGACAAATTGCCTTGA
+HWUSI-EAS1795_0092:3:1:4144:1553#0/1
hhhhhhhhhhhghhgghhghghhghhhhhhgfh
@HWUSI-EAS1795_0092:3:1:4780:1558#0/1
GTTGGCGTCGCGCGGAGACAGGGCCTTGCGGAT
+HWUSI-EAS1795_0092:3:1:4780:1558#0/1
gggggfggffgddffafgggggdfga_cffffd
@HWUSI-EAS1795_0092:3:1:6316:1555#0/1
CAACTACGGCTACCCCCAGAAGCGTCTCTACGG
+HWUSI-EAS1795_0092:3:1:6316:1555#0/1
hhhhhhhhhhhhfhhhhfehh]ffdffhehggh
@HWUSI-EAS1795_0092:3:1:6809:1557#0/1
TTCGCGGTTCGCCCACGGGTGATCTTCATAGAT
+HWUSI-EAS1795_0092:3:1:6809:1557#0/1
hhhhhhhhhhhhhhhhhhhfhfhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:7429:1563#0/1
CGCCTGCTGCCTTCCTTAGATGTGGTAGCCGTT
+HWUSI-EAS1795_0092:3:1:7429:1563#0/1
hhhhhghhdhhhhhhghhghgfghhghhhhehg
@HWUSI-EAS1795_0092:3:1:7466:1554#0/1
AGAAGCTGCTGACCATGGCCGGTATTGAGGATT
+HWUSI-EAS1795_0092:3:1:7466:1554#0/1
hhhhhhhhhhhhhhgfhhhhhhfhhhhehdgdh
@HWUSI-EAS1795_0092:3:1:8060:1558#0/1
ACAAGCAAGTGACATTGACTCCCAACCGAAAGT
+HWUSI-EAS1795_0092:3:1:8060:1558#0/1
hhhhhhhhghhhhhhhahhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8473:1563#0/1
GCCAATGTCATGGTGACGGCGTACCTTCACCGG
+HWUSI-EAS1795_0092:3:1:8473:1563#0/1
hfhhhhhhhhhhhhhhhhhgahhhhhfhhehhd
@HWUSI-EAS1795_0092:3:1:8611:1554#0/1
CTTGTTCAGCATGATCTTGGCGCCCTCGAAGGT
+HWUSI-EAS1795_0092:3:1:8611:1554#0/1
hhhhhhhhhhhhhhhhhheghhhhhhhhhhhhe
@HWUSI-EAS1795_0092:3:1:8757:1560#0/1
GTCATATTTAAGGAATAGAATTGGTACACACGG
+HWUSI-EAS1795_0092:3:1:8757:1560#0/1
hhhhhhhhhhhhhhhhhhhhhh[fhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9170:1561#0/1
GAAATGCGATGGCAAAGTGGAGTGGTCAGTGCA
+HWUSI-EAS1795_0092:3:1:9170:1561#0/1
hhhhhhhhhhhhhhhggdhhfddffdfffeffg
@HWUSI-EAS1795_0092:3:1:9442:1561#0/1
CCCAGATCGATTGGGCCAACTACAAGAAGCTTG
+HWUSI-EAS1795_0092:3:1:9442:1561#0/1
ggggggggggcgfggcggggfdgggeffgacg]
@HWUSI-EAS1795_0092:3:1:9557:1556#0/1
TAAAAAAGCCCACCAGGCAATTCGTAACGACCC
+HWUSI-EAS1795_0092:3:1:9557:1556#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10270:1558#0/1
CCTGACCTAAGCAGATTTGACTGCCCTCTTTCA
+HWUSI-EAS1795_0092:3:1:10270:1558#0/1
d_fff]f^ca]^dWa_aUTTRUUZ_VScc^a^a
@HWUSI-EAS1795_0092:3:1:10675:1558#0/1
GTCGTGCCTGAGTGTGGCCACCCAAGTCGAATG
+HWUSI-EAS1795_0092:3:1:10675:1558#0/1
gggggggggggadddafggggggg_gdedddcf
@HWUSI-EAS1795_0092:3:1:11046:1563#0/1
TTTCGTACTAAAATATCACAATTTTTTAAAGAT
+HWUSI-EAS1795_0092:3:1:11046:1563#0/1
fgggggggggggggggegggggggggggggggg
@HWUSI-EAS1795_0092:3:1:11300:1555#0/1
ATAAAACCCAATTCTGTGCGAAGAACAAAAGAA
+HWUSI-EAS1795_0092:3:1:11300:1555#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhchh
@HWUSI-EAS1795_0092:3:1:11348:1556#0/1
TGATGTCCCTGCCCCTGCACGCCCGCTGGGAGT
+HWUSI-EAS1795_0092:3:1:11348:1556#0/1
hhhhhhhhhhghhghghhhhghhhggfgggdgc
@HWUSI-EAS1795_0092:3:1:12383:1561#0/1
CAAAGAGCATGGGACTCGTCTCCAATCCCATCG
+HWUSI-EAS1795_0092:3:1:12383:1561#0/1
hhhhhhhhhhhhhhhhhhhhhhhhgghhhhghh
@HWUSI-EAS1795_0092:3:1:12452:1553#0/1
CTGCGAGGGACCACTGTTCACACCGCATTGTGA
+HWUSI-EAS1795_0092:3:1:12452:1553#0/1
hghehhchahhffafffgghghfhef_hfhehg
@HWUSI-EAS1795_0092:3:1:12900:1562#0/1
CGGTTCCATTTCCAGCTCCCCACAGACCGGCGA
+HWUSI-EAS1795_0092:3:1:12900:1562#0/1
hhhhhhhhhhhhhhhhhhhhhhhhfhhhghhhh
@HWUSI-EAS1795_0092:3:1:12918:1559#0/1
CATCGCGTCCCGTTCCCGTTTCATAAATCCTCT
+HWUSI-EAS1795_0092:3:1:12918:1559#0/1
gdfffffggggfgggggccfffdffffdggggf
@HWUSI-EAS1795_0092:3:1:13034:1562#0/1
GCCTGCCCTCCTTGTCGATCTTGCACAGACCGG
+HWUSI-EAS1795_0092:3:1:13034:1562#0/1
gggffgggggggffggggcfggfdfgcggg]g[
@HWUSI-EAS1795_0092:3:1:13207:1558#0/1
TGAAGGGTCAGCTCTATATCGATACGGTGGCCG
+HWUSI-EAS1795_0092:3:1:13207:1558#0/1
fgfgggagggggcdgdgcffffffffac`dfff
@HWUSI-EAS1795_0092:3:1:13351:1554#0/1
CGCCGAGAAGGTGTTCCTCGCCCAGAAGGCCAT
+HWUSI-EAS1795_0092:3:1:13351:1554#0/1
ggfff_dcfffcffdff_f_fffffcWbbcdbg
@HWUSI-EAS1795_0092:3:1:13579:1561#0/1
ACAAGATGGACGAGCTGAAGTCGCGCGGCAAGC
+HWUSI-EAS1795_0092:3:1:13579:1561#0/1
hhhghdhhhhhhhhhhfhhhhhfhhegcfchee
@HWUSI-EAS1795_0092:3:1:13665:1555#0/1
CTGGGGATTACAATTACAATTATAATGCTGCAC
+HWUSI-EAS1795_0092:3:1:13665:1555#0/1
hhhhhhhhhhhhghgghhghhgfhghhffhfge
@HWUSI-EAS1795_0092:3:1:14182:1561#0/1
AATGCCCATGTGACGAATGAGGATGGCCTTAAA
+HWUSI-EAS1795_0092:3:1:14182:1561#0/1
ghhhhhhehhhhhghhfhegghccfcfhhghag
@HWUSI-EAS1795_0092:3:1:14370:1560#0/1
TGTCTACAAATGTTTATGGTTGTTCTATATGAT
+HWUSI-EAS1795_0092:3:1:14370:1560#0/1
a^eadee\baaaeecdaffcfdacaacacca^f
@HWUSI-EAS1795_0092:3:1:14839:1560#0/1
CAACATACCACCAAGACAGTCATTTAACGCTAT
+HWUSI-EAS1795_0092:3:1:14839:1560#0/1
hhhhhhhhhhhhhhfhhhhhhhghhhhhhehhh
@HWUSI-EAS1795_0092:3:1:15110:1562#0/1
ACCGCATCGAGTCCAACTTCCAGGTCTTCGACT
+HWUSI-EAS1795_0092:3:1:15110:1562#0/1
cggggggggfggfffcegegggdfafddffddg
@HWUSI-EAS1795_0092:3:1:15333:1556#0/1
TGAGGAACTGCTGTAATCCTTTCGGGTGAACAC
+HWUSI-EAS1795_0092:3:1:15333:1556#0/1
_\U^^USdacaa_caa^a^dada`]aYRY___c
@HWUSI-EAS1795_0092:3:1:15514:1561#0/1
CACGCGGTTCCCGCTGGGCATGCCAATGAAATG
+HWUSI-EAS1795_0092:3:1:15514:1561#0/1
gggggfgggggggggggcdggfgggggcggggg
@HWUSI-EAS1795_0092:3:1:15582:1561#0/1
CTGCTGACGAATTGTACAAAACGCTAGTGTGTT
+HWUSI-EAS1795_0092:3:1:15582:1561#0/1
hhhhhhfhhhhhhhhhhhhhhghghfhhhhhhe
@HWUSI-EAS1795_0092:3:1:16037:1558#0/1
TTGACATTTTCGATAGTATCCGACGGTTCGACC
+HWUSI-EAS1795_0092:3:1:16037:1558#0/1
hhhhhhhhhehhhghhhhhhhhghhhhghhchh
@HWUSI-EAS1795_0092:3:1:16285:1555#0/1
TCCGTCGCCGCTTAGACTTCGTGATTTCTCATT
+HWUSI-EAS1795_0092:3:1:16285:1555#0/1
hhhhhhhhhhhhhhgghhhhhhhhhhdhhhhhh
@HWUSI-EAS1795_0092:3:1:16329:1561#0/1
TGTTGCTGCTGTGGCGAGTGTTGGTGTTGTGTT
+HWUSI-EAS1795_0092:3:1:16329:1561#0/1
gggggggggggggggggfdfcf^b]abfffdfg
@HWUSI-EAS1795_0092:3:1:16708:1556#0/1
GTCGCTTCGTTGTGCGTCGCCCTTTGCCCGCCA
+HWUSI-EAS1795_0092:3:1:16708:1556#0/1
gggggggggf[acfffcf[fffgeg[ggggggg
@HWUSI-EAS1795_0092:3:1:17497:1555#0/1
GCCTTCCTTAGATGTGGTAGCCGTTTCTCAGGC
+HWUSI-EAS1795_0092:3:1:17497:1555#0/1
gdggcgfggggfgfggggggggfggggfggggg
@HWUSI-EAS1795_0092:3:1:17984:1558#0/1
GGACATTCTGGTGCAGTACGACAGAACCCTGCT
+HWUSI-EAS1795_0092:3:1:17984:1558#0/1
dfcf[cf_^a`\caeceffggdfaadacac\Rf
@HWUSI-EAS1795_0092:3:1:18972:1560#0/1
GAGTAGGCAGGCGTGGAGGTTGTATCGAAGCCT
+HWUSI-EAS1795_0092:3:1:18972:1560#0/1
gaffffff_ffefgggaggga]_fffcdffffe
@HWUSI-EAS1795_0092:3:1:19237:1561#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19237:1561#0/1
gfgfgaacf[dc]aacc_ffffgggagfaefeg
@HWUSI-EAS1795_0092:3:1:19447:1556#0/1
TATCCTTCCACGCCAGTCTGCCCCCCAACAGCC
+HWUSI-EAS1795_0092:3:1:19447:1556#0/1
ffbcc^b\\ZZXddd^Xaaa^^BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:1857:1565#0/1
CTTCTTTATGGTCGTTCCTGTTGCCAGAATGAG
+HWUSI-EAS1795_0092:3:1:1857:1565#0/1
ggggg^g_adeafff]ff]fffffadccfdfdf
@HWUSI-EAS1795_0092:3:1:2022:1570#0/1
GCTACCTTGGCGCCACCGAGAATTGCCAGGAAG
+HWUSI-EAS1795_0092:3:1:2022:1570#0/1
afdcffcf]]fffc]fecKccc[accf^][]a^
@HWUSI-EAS1795_0092:3:1:2397:1571#0/1
ATCTTGAATAGAGTAACGTAGTTATCGAACTCC
+HWUSI-EAS1795_0092:3:1:2397:1571#0/1
caeeccccacbc\Y_aa]^bX^febfcfccffg
@HWUSI-EAS1795_0092:3:1:2505:1569#0/1
GTCTTGACCTGATCCTTCGATCTCAGTAGTTGT
+HWUSI-EAS1795_0092:3:1:2505:1569#0/1
hhhhhhhhhhghhhhehhhhhhfhhhgghhhhg
@HWUSI-EAS1795_0092:3:1:3119:1575#0/1
TGATCATCTCCTCCTTCATGTCCATCATTTCCG
+HWUSI-EAS1795_0092:3:1:3119:1575#0/1
affffffdafffggcgffffcffggggggggge
@HWUSI-EAS1795_0092:3:1:3187:1567#0/1
GTGCATTCTGGGAAGTGTTAACTGATCCAGCAT
+HWUSI-EAS1795_0092:3:1:3187:1567#0/1
hhhhhhhhhhhhggfehhghhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:3620:1576#0/1
CTTTGACATTCTGGATCAAAGAATTGAACTTGA
+HWUSI-EAS1795_0092:3:1:3620:1576#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhghhgg
@HWUSI-EAS1795_0092:3:1:4195:1573#0/1
GCCGGGCTTCTTGCCAGCGGCTCCCTTGGCGCC
+HWUSI-EAS1795_0092:3:1:4195:1573#0/1
fcggggegggggggggfggggegggbeadeffg
@HWUSI-EAS1795_0092:3:1:4368:1571#0/1
ATCCAGTTGCATAAGCGCTCGTCCTCCGGCAGA
+HWUSI-EAS1795_0092:3:1:4368:1571#0/1
hhhghhhhhhhhhhhhhhghhhhhhhghghhhg
@HWUSI-EAS1795_0092:3:1:4572:1569#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4572:1569#0/1
ffaffffffaffeggggfdaff]_fffaffffa
@HWUSI-EAS1795_0092:3:1:4625:1566#0/1
GCTCGATTGCGAAAAGACACAGTGGAATCTCGG
+HWUSI-EAS1795_0092:3:1:4625:1566#0/1
hhhhhhhhhhhhhhhgghhhhhghhhhhhghhg
@HWUSI-EAS1795_0092:3:1:4665:1570#0/1
CGGTACCGTTGTGGTCTTCGCCCCTGCTAACAT
+HWUSI-EAS1795_0092:3:1:4665:1570#0/1
hhhhhhhhhhehgghhhhhfhhhhhehhhhhhh
@HWUSI-EAS1795_0092:3:1:5237:1571#0/1
CTCCTCAGTTGCTGTAAGCATTGCACCCAAAAT
+HWUSI-EAS1795_0092:3:1:5237:1571#0/1
`ZZaZY^Z_X_aWd^dd^a^a^dfdfc`cddbf
@HWUSI-EAS1795_0092:3:1:5358:1568#0/1
CCGATGATAAATCTTCTGATAACGCAACCAATG
+HWUSI-EAS1795_0092:3:1:5358:1568#0/1
fc]eaceaacacaccaafffffffcdf]fffcg
@HWUSI-EAS1795_0092:3:1:5543:1567#0/1
ATGAAAACAGGCCAAAAAAGTGCGACAAACGAA
+HWUSI-EAS1795_0092:3:1:5543:1567#0/1
ghhghhhhhhhhhhghhhfcghhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:5732:1566#0/1
CCCGTATGAAGCACAAGTTCAACTACGAACGTT
+HWUSI-EAS1795_0092:3:1:5732:1566#0/1
hhhhhhhhhhhhhhhhhhhhhhghhgghhhhhh
@HWUSI-EAS1795_0092:3:1:6204:1574#0/1
TTCGCAAGTCACACGCTTTAAAAACCGTCATCT
+HWUSI-EAS1795_0092:3:1:6204:1574#0/1
ggfggggfgfggg]ggggggfggggfgbfdddd
@HWUSI-EAS1795_0092:3:1:6250:1566#0/1
CCGATTTCCTGGGGTACTTGGGACTCCTGGGCA
+HWUSI-EAS1795_0092:3:1:6250:1566#0/1
hhhhhfhhhhhhhhehhhhghhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:6643:1571#0/1
TAGGGATCGTAGGAGATGACGTTGAAGCCGAAC
+HWUSI-EAS1795_0092:3:1:6643:1571#0/1
hhhghhhhhhhhhgghQfffffhhhchhhhhhg
@HWUSI-EAS1795_0092:3:1:6864:1568#0/1
GAGCTGCAGTCGAAGGTGTCGTAGGCTGAGCCT
+HWUSI-EAS1795_0092:3:1:6864:1568#0/1
ggggggggggggggggggggggggggdgggggd
@HWUSI-EAS1795_0092:3:1:7308:1572#0/1
CGGAGGGCGCGGCGTGCTAACGGGCGTGGCCAC
+HWUSI-EAS1795_0092:3:1:7308:1572#0/1
fffaafcceffebd^`cbbd][YO\WKZW_a_c
@HWUSI-EAS1795_0092:3:1:7562:1568#0/1
GTTTGGTGCAACTGTTTATGTGCATATTAAAAA
+HWUSI-EAS1795_0092:3:1:7562:1568#0/1
fafdffafcfffcffffafd_fffdffgggggc
@HWUSI-EAS1795_0092:3:1:7957:1573#0/1
CCAACACCGATCTGTCGCGTCTGCTCAAGTCTG
+HWUSI-EAS1795_0092:3:1:7957:1573#0/1
hhghghhhhhhggghhahhhhghhdfghgdgg]
@HWUSI-EAS1795_0092:3:1:8127:1567#0/1
GAAGAAGGTCGCCGCCAAGAAGCCAGCGGCCAA
+HWUSI-EAS1795_0092:3:1:8127:1567#0/1
hgghhhhhhhhhhffhhfdhhhgcahhhhghhe
@HWUSI-EAS1795_0092:3:1:8807:1572#0/1
GCAGTATTGGTTTTAATTGCGATAACGCACTCC
+HWUSI-EAS1795_0092:3:1:8807:1572#0/1
gggggggggggggcgfgggggd_ffffffffff
@HWUSI-EAS1795_0092:3:1:9030:1575#0/1
CAACAAGCACGTCGTCTTCGGCGAGGTCGTCGA
+HWUSI-EAS1795_0092:3:1:9030:1575#0/1
hhhh_hhhhhhhhhhhhhhgfhhhhhdhhghhg
@HWUSI-EAS1795_0092:3:1:9622:1564#0/1
CCGCTCTTAAAAAAAACAATTCCAAGTTTTTAT
+HWUSI-EAS1795_0092:3:1:9622:1564#0/1
hagghhhhhhghgfggfhhhhhghhehhghghh
@HWUSI-EAS1795_0092:3:1:9924:1574#0/1
CAGAGACGACCGACTGGCAACGGCTCTGCATGG
+HWUSI-EAS1795_0092:3:1:9924:1574#0/1
fffda_f\_a^[^[`ZY\\\Y[ba^bbb^^[dU
@HWUSI-EAS1795_0092:3:1:10095:1565#0/1
TCACGCTCTTCTGCACGATGCCTATGTGGACGA
+HWUSI-EAS1795_0092:3:1:10095:1565#0/1
ffddffcfdfdfffcfeaa^cd`a]^]ac]cdg
@HWUSI-EAS1795_0092:3:1:10639:1565#0/1
GGCGCCAAGCAAATCGTGGAGGAAAACAAGACT
+HWUSI-EAS1795_0092:3:1:10639:1565#0/1
hghhhhhghghhhfhhhfhghgghhgahegfhf
@HWUSI-EAS1795_0092:3:1:11979:1572#0/1
GCCGGTGCAGTGCGGTGAGGTGCGCGAAAGTCA
+HWUSI-EAS1795_0092:3:1:11979:1572#0/1
hhhhhhhhhhhhhhhehfhhdhhhhhchehehe
@HWUSI-EAS1795_0092:3:1:12494:1564#0/1
TTCGTAATGGAGCAGTATTACTCACCTTTGCTT
+HWUSI-EAS1795_0092:3:1:12494:1564#0/1
hhhhhhhhhhgghhhhhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12622:1566#0/1
CGACGCGATTCTTGATCTCCGCCGCCATCGTCA
+HWUSI-EAS1795_0092:3:1:12622:1566#0/1
_O\ZW]Zdfffffff]ffffIc`]`^^W^Zacf
@HWUSI-EAS1795_0092:3:1:13430:1566#0/1
CTGAGCTGACAGCAGTCTGTAGTTGCTGTTGCT
+HWUSI-EAS1795_0092:3:1:13430:1566#0/1
hhhfhhhhhhhhhgfhhhhhdfhfhhgghhhgh
@HWUSI-EAS1795_0092:3:1:13712:1574#0/1
GGGTGGTGTGCATTCTGGGAAGTGTTAACTGAT
+HWUSI-EAS1795_0092:3:1:13712:1574#0/1
hhghhhhhhghhhhhhhhhhhhhghhhhfgfcc
@HWUSI-EAS1795_0092:3:1:13805:1570#0/1
GTTAAATTTGGGTAGCTTAACATCATAACTAGG
+HWUSI-EAS1795_0092:3:1:13805:1570#0/1
ff[ffffeffffcdffffafffeggfggcgggc
@HWUSI-EAS1795_0092:3:1:13822:1574#0/1
AAAATTCAGAGAATCAACTGGCTGACATATTTA
+HWUSI-EAS1795_0092:3:1:13822:1574#0/1
hhhhhhhfhhhhhhhhhhhhhhhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:13947:1564#0/1
CCTTGTTCGCCATACTCGCCGACATCTCCCTTC
+HWUSI-EAS1795_0092:3:1:13947:1564#0/1
hhhhhhhhhhhhhhhhhfhhhfhhhhhhhhheh
@HWUSI-EAS1795_0092:3:1:14066:1564#0/1
CTGCACCATACGGCAGGAAAACAAAGCTATTAA
+HWUSI-EAS1795_0092:3:1:14066:1564#0/1
gggggggggggggggggaggg]````bedfaff
@HWUSI-EAS1795_0092:3:1:14247:1570#0/1
CCGAAATCCTTGATCACGACCACGGAGCAGCCG
+HWUSI-EAS1795_0092:3:1:14247:1570#0/1
hhgghhhhhhhhhhhhhhhhhghhghdhhhhhe
@HWUSI-EAS1795_0092:3:1:14697:1570#0/1
TAGGAAATGGTTTGGAAGAGAACCGTAATAATT
+HWUSI-EAS1795_0092:3:1:14697:1570#0/1
hhhhhhghhghhghhfegghhhghhfhhhhghh
@HWUSI-EAS1795_0092:3:1:14935:1567#0/1
CACAAGCGCATCATCGACTTGCACTCGCCCTCT
+HWUSI-EAS1795_0092:3:1:14935:1567#0/1
hhhhhhhhhhghhhhghhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:15159:1574#0/1
ATCAAAGGCCAGTTATCTGCGACACCTAGACCA
+HWUSI-EAS1795_0092:3:1:15159:1574#0/1
hhhhhhhehhhhhhhhhhhhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:15245:1575#0/1
AACGCATCGATATTCGGCACAGTCCCAAAAGCA
+HWUSI-EAS1795_0092:3:1:15245:1575#0/1
hhfhhhhhhhhghhhhhhhhhhhhhhhhhhheh
@HWUSI-EAS1795_0092:3:1:15875:1571#0/1
GCTGGCCAAGGCCAAGAAGCAGAACGTCGAGCT
+HWUSI-EAS1795_0092:3:1:15875:1571#0/1
hhhhhghhhhhhhhhhhhhghghhhhhfhhehf
@HWUSI-EAS1795_0092:3:1:16461:1569#0/1
AAGACATCCTGAAGCAGCACTGGTCTGTGTATG
+HWUSI-EAS1795_0092:3:1:16461:1569#0/1
hehghhghhhhhghfhhfhhhcghhhgdffdfh
@HWUSI-EAS1795_0092:3:1:16483:1565#0/1
CAACGGCGCACATCTTCCGACCCGAGGAGCAAA
+HWUSI-EAS1795_0092:3:1:16483:1565#0/1
gfggfggcgcfgcgggfgggfgfgggg_eagff
@HWUSI-EAS1795_0092:3:1:17372:1571#0/1
CCAATTTGTCTCGTAACTCCACAAATCTCGCAG
+HWUSI-EAS1795_0092:3:1:17372:1571#0/1
hhhhhhhehhhhhhghhhhhhghhhghgggghh
@HWUSI-EAS1795_0092:3:1:17600:1571#0/1
GAAACTCTCACCAGCGCAGCGTGAACGATATCC
+HWUSI-EAS1795_0092:3:1:17600:1571#0/1
hhhhhhhhhhhhhhhhhhfghghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19656:1566#0/1
CAGGTGCACCGCGTCACCGAGCCCGCCAACTAA
+HWUSI-EAS1795_0092:3:1:19656:1566#0/1
ffad[ddaa^^ad^ddda^aZbffafcZ`^N`Z
@HWUSI-EAS1795_0092:3:1:19806:1570#0/1
TGCNGCTGGGGCTTGGCGGCTCCGGGCTTGNNN
+HWUSI-EAS1795_0092:3:1:19806:1570#0/1
ffaBaa^____\dfcffdd^JaBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:1465:1578#0/1
GAAAAGGTGGAATGCTAAGAAACTCACAAACGA
+HWUSI-EAS1795_0092:3:1:1465:1578#0/1
^aa]^\WIFV\Y]ZL]]ZaaR[IW__R\a\_^c
@HWUSI-EAS1795_0092:3:1:1832:1582#0/1
GCCGAGCGGGCGGCAAAGAAAAAGGCTCGCATC
+HWUSI-EAS1795_0092:3:1:1832:1582#0/1
gfca_fcaP^b^__ecegcgfgfVfaa_`d[`a
@HWUSI-EAS1795_0092:3:1:2343:1580#0/1
CCACAAGCTACGCTATCAGATTGACAAACTGGT
+HWUSI-EAS1795_0092:3:1:2343:1580#0/1
a]ff[]ccbba^]Y^BBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2372:1587#0/1
CGGGGACGGGGCATGTAATGACTTCAGTCTCAT
+HWUSI-EAS1795_0092:3:1:2372:1587#0/1
hhgffhghfhhhhhhhhQW^ZZhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:2792:1586#0/1
CTTGAATTACAGTTTGCGCATCGTATGGCATCT
+HWUSI-EAS1795_0092:3:1:2792:1586#0/1
c\ccacccccccaccccccacc_ccc[c\ccca
@HWUSI-EAS1795_0092:3:1:3370:1581#0/1
ATGAAAGGCGTTGGTTGCTTAAAACAGCAGGAC
+HWUSI-EAS1795_0092:3:1:3370:1581#0/1
fhhhghghhhhhfghhhhhhhghhhghhghhhh
@HWUSI-EAS1795_0092:3:1:3576:1585#0/1
CTCCTTTTGGATGTTGTAATCGGACAGGGTGCG
+HWUSI-EAS1795_0092:3:1:3576:1585#0/1
gggggggggcaggggcgdgggggggfgcc]fa_
@HWUSI-EAS1795_0092:3:1:3986:1587#0/1
GCACACACTAAAACTCTTACACAACACACACAC
+HWUSI-EAS1795_0092:3:1:3986:1587#0/1
hhhfghghhghhfghhhhghghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:4102:1576#0/1
GCGGAGTTCTTCTGGCAAATGCCGATCATGCAG
+HWUSI-EAS1795_0092:3:1:4102:1576#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:4805:1579#0/1
CCTGTACACTCTGGAGCACAACGACATCATCAA
+HWUSI-EAS1795_0092:3:1:4805:1579#0/1
ffffcf[a^aacWaccaffff[fc_cfZ^^^af
@HWUSI-EAS1795_0092:3:1:5169:1579#0/1
TGGATGGCCTTTGGAAGATACAAAGGCTGGAAA
+HWUSI-EAS1795_0092:3:1:5169:1579#0/1
hghhhdhghhhghhgggfhhfhhchhhhhhghf
@HWUSI-EAS1795_0092:3:1:5462:1587#0/1
GAAGACCACCTGGGACTGGACCCTGATCAACGA
+HWUSI-EAS1795_0092:3:1:5462:1587#0/1
gfgggggfdfddb]bdbaffffgggggfdggag
@HWUSI-EAS1795_0092:3:1:5496:1581#0/1
TGGTCAGATGCAGATTGTTCAATCTGTATTCCT
+HWUSI-EAS1795_0092:3:1:5496:1581#0/1
gfhhhhhghfhhhghhghhhhfhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:5902:1582#0/1
TCGTACCACTGGCGGAAGGGCGTGGCATCGATG
+HWUSI-EAS1795_0092:3:1:5902:1582#0/1
hhhhhhhhhghhhhhfhhhgfhehhhhhhgagc
@HWUSI-EAS1795_0092:3:1:6111:1579#0/1
GCCCGGGCGTGCTGTTGCTGGCATTGTTTCCCT
+HWUSI-EAS1795_0092:3:1:6111:1579#0/1
hhhhhhghfhhhhfhgghhhhhdhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7056:1581#0/1
AGAAGATCTACCGCATCGGCGCTGGCATCCACA
+HWUSI-EAS1795_0092:3:1:7056:1581#0/1
hhhhhhgfhhhhhfhhhgfdhfeggghhhhfhf
@HWUSI-EAS1795_0092:3:1:7622:1577#0/1
CACCAAGACGTTCCGTCGCTGGCACCGCAAGGT
+HWUSI-EAS1795_0092:3:1:7622:1577#0/1
gggggggfggggggggggfeafggggcgeggg]
@HWUSI-EAS1795_0092:3:1:7689:1579#0/1
ACAAGAACTGGTTACCCCACCGCTGAGCGGTCT
+HWUSI-EAS1795_0092:3:1:7689:1579#0/1
ggfcfffddfcfdfcdfeccggfegagaaa`ef
@HWUSI-EAS1795_0092:3:1:7861:1579#0/1
GAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTG
+HWUSI-EAS1795_0092:3:1:7861:1579#0/1
hhhhhhhhhhhhhhhhhhhehhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:8637:1577#0/1
CTGGCCTTCGAATCCGAGTTACGGGAAACATTT
+HWUSI-EAS1795_0092:3:1:8637:1577#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:8942:1585#0/1
GTTCGTTATCGGAATTAACCAGACAAATCACTC
+HWUSI-EAS1795_0092:3:1:8942:1585#0/1
hhhhhhhghhhhhghhghhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:9641:1585#0/1
TGCGGATGGACTTGGTCACCTTGATCTCCAGGT
+HWUSI-EAS1795_0092:3:1:9641:1585#0/1
cgfggggcgggcfcfdffafcfgggggfddfdc
@HWUSI-EAS1795_0092:3:1:9822:1580#0/1
TGCGGGATACATGGTATCGAAGTTTCATGTACA
+HWUSI-EAS1795_0092:3:1:9822:1580#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10477:1584#0/1
TTTTAATATATTTTCTTTATTCTCGAGTAGAAA
+HWUSI-EAS1795_0092:3:1:10477:1584#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10755:1581#0/1
CAACTACGTAAAGCAGGTGATCGAGGATCTGCG
+HWUSI-EAS1795_0092:3:1:10755:1581#0/1
hhhghhhhhhhhhhhhhghchhhghhfhhhhhg
@HWUSI-EAS1795_0092:3:1:11598:1577#0/1
ATTTGCCAATTCCTGTGTTCTTTTTGTTCTCTG
+HWUSI-EAS1795_0092:3:1:11598:1577#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhehhhhhhh
@HWUSI-EAS1795_0092:3:1:11791:1579#0/1
GTGTGCGTGGGCACCTGCTTCGGCAAGTTCTCC
+HWUSI-EAS1795_0092:3:1:11791:1579#0/1
hhghhggdghhfhhhfgdghhhgehffhhgahh
@HWUSI-EAS1795_0092:3:1:12070:1577#0/1
GTCAGCCGCCACTGTGATCATGATGTTTGCAGG
+HWUSI-EAS1795_0092:3:1:12070:1577#0/1
hhhhhhhhhhghhghfhhhhhhghghhhhhhhg
@HWUSI-EAS1795_0092:3:1:12558:1577#0/1
GTTAAGGCCATACTTGCGGATCAGACCGTGGCG
+HWUSI-EAS1795_0092:3:1:12558:1577#0/1
hhhghghhhhhhhhhfhhhdhhhfhhhhghhhh
@HWUSI-EAS1795_0092:3:1:12956:1580#0/1
AGAAAATCGGTTTGCATGGTATGGGTTCCATGT
+HWUSI-EAS1795_0092:3:1:12956:1580#0/1
hhhhhhhhhhhhhhhhhhhgfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13539:1581#0/1
GCACGCTCTCCCTCGTACACCTGGATCAGCACA
+HWUSI-EAS1795_0092:3:1:13539:1581#0/1
hhhghhhhhhhhhhfhghhhhhghhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:13792:1587#0/1
CCGAGATGTCGAATCAGATTCCGTCCGTTTACT
+HWUSI-EAS1795_0092:3:1:13792:1587#0/1
bdcddd[a^aa^ddaddff_faff^fSX\TZVd
@HWUSI-EAS1795_0092:3:1:13892:1578#0/1
TGACAATATTGCACGTTCACCTCGCCCTTGTAC
+HWUSI-EAS1795_0092:3:1:13892:1578#0/1
hhhhhhhhhhhhhhhhhhhhhhhchhhgfahhh
@HWUSI-EAS1795_0092:3:1:14200:1580#0/1
GAAACTTAAGACGCAGTTTCTATCCAGCGATTT
+HWUSI-EAS1795_0092:3:1:14200:1580#0/1
gggggggadegfggggfgggggafdffggggga
@HWUSI-EAS1795_0092:3:1:14290:1580#0/1
CTACACCCAAAATTATATCTTAATCCAACATCG
+HWUSI-EAS1795_0092:3:1:14290:1580#0/1
hhhhhhhhhhhhhhfhehhhhhhghhhghfhfg
@HWUSI-EAS1795_0092:3:1:14467:1586#0/1
CATCAGCTTTGAGAAGCTGTCGCCCAAGGACCT
+HWUSI-EAS1795_0092:3:1:14467:1586#0/1
hhghhhhghhfhfhghghhhhdhhghhhcWhhh
@HWUSI-EAS1795_0092:3:1:14981:1582#0/1
GGGAGAGCCTGAAGAAGACCCCGGACATGGAGC
+HWUSI-EAS1795_0092:3:1:14981:1582#0/1
cccVcVPUSWT\c^ca^acc[[aZabYVaaVZc
@HWUSI-EAS1795_0092:3:1:15105:1584#0/1
GGAGAATCTGCGCAAGGTCTTCAAGAACAAGAA
+HWUSI-EAS1795_0092:3:1:15105:1584#0/1
hghhfghhghhghhghhhhhhhhhhfhfffhhg
@HWUSI-EAS1795_0092:3:1:15213:1577#0/1
GCCAGTCCATCTGACCTGCTTCATCGGCTACAA
+HWUSI-EAS1795_0092:3:1:15213:1577#0/1
`\aeaeeccffdgfaggdfff_d\fccc\ca^R
@HWUSI-EAS1795_0092:3:1:15384:1587#0/1
GGCGTGTTGGAATATACTATTCAACCTACAAAA
+HWUSI-EAS1795_0092:3:1:15384:1587#0/1
gfggggggagdgdffffgdgggggggagggggg
@HWUSI-EAS1795_0092:3:1:15442:1579#0/1
CTTGTTTACAAAAAAGGTAGGTATGGGCTATTT
+HWUSI-EAS1795_0092:3:1:15442:1579#0/1
ggffgfgfcfff[ZZ^a\eeeaa]a``_dcffg
@HWUSI-EAS1795_0092:3:1:16649:1576#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16649:1576#0/1
hhhhhhhhhhghhhghghhhhhhhhfhhghhhh
@HWUSI-EAS1795_0092:3:1:16698:1586#0/1
TCGCTTAGAAAAAAGCAACAGCCACCTGTGAGC
+HWUSI-EAS1795_0092:3:1:16698:1586#0/1
afffaacMUVVY__VeedWa`efd[dd`^`[`c
@HWUSI-EAS1795_0092:3:1:16954:1582#0/1
TTAATTTCTACACTGAGGGAAAGAAGAAGTAGC
+HWUSI-EAS1795_0092:3:1:16954:1582#0/1
hghhhhhhhhhhhhhdhhhhhghhehhhhghgf
@HWUSI-EAS1795_0092:3:1:17037:1579#0/1
CCGATTTCTTGTACTGCAGTCTCTCGACCGTGT
+HWUSI-EAS1795_0092:3:1:17037:1579#0/1
gggcggggggcgggggggfgggfffffggcgfg
@HWUSI-EAS1795_0092:3:1:17808:1581#0/1
CGCAAGGACAAGGATAAAAAGAAATCTAAGAAA
+HWUSI-EAS1795_0092:3:1:17808:1581#0/1
hhhghhdghggghhdhhhfhchhhhhhfhhhhe
@HWUSI-EAS1795_0092:3:1:17863:1585#0/1
CCCAAACACACAGGACACGATCGATGGACGGAC
+HWUSI-EAS1795_0092:3:1:17863:1585#0/1
hhhhhhhhhhhhhhhhhhhhfhghghchhhghg
@HWUSI-EAS1795_0092:3:1:18107:1578#0/1
AGGGTGACTTTCTTGGTGCCGGAGGAGTAGGAC
+HWUSI-EAS1795_0092:3:1:18107:1578#0/1
hhhhfdhhhghhfhhhehhhhhhhhfhghhhhh
@HWUSI-EAS1795_0092:3:1:18250:1588#0/1
CGTCGATGTTCGTATTCATGATACGCAGGATGT
+HWUSI-EAS1795_0092:3:1:18250:1588#0/1
ffeggggf`ffcc_cffffW_dfc`fcdddddd
@HWUSI-EAS1795_0092:3:1:18678:1579#0/1
CTCGTCTCAAAGGCCAAGCAATCGCGCGGCGAG
+HWUSI-EAS1795_0092:3:1:18678:1579#0/1
ggggggfggggfgfgggc_cgafdfffgagfcc
@HWUSI-EAS1795_0092:3:1:18734:1584#0/1
AGAACAGCATCGTGGTCATCGATGCCACGCCCT
+HWUSI-EAS1795_0092:3:1:18734:1584#0/1
hghhhhhhhhhhhhhehhghhhghhhhhghhhf
@HWUSI-EAS1795_0092:3:1:18809:1587#0/1
CTCCTCCTCCGCACGACCCGCAGCTCCCTGGCT
+HWUSI-EAS1795_0092:3:1:18809:1587#0/1
gfgggggfgggggggggggggaeecffcW``f\
@HWUSI-EAS1795_0092:3:1:19394:1579#0/1
GTTCTGGTGGCTCATCGGCATGGGCATCTGCAC
+HWUSI-EAS1795_0092:3:1:19394:1579#0/1
ggfgfgfggggggggggfggdfggggcgg_agg
@HWUSI-EAS1795_0092:3:1:1377:1591#0/1
TGCTCACGCTGATCTGCCAGTCCTTGATGTGTT
+HWUSI-EAS1795_0092:3:1:1377:1591#0/1
ccc_[cccYJa___acc\aaVcVaacccccccc
@HWUSI-EAS1795_0092:3:1:1548:1594#0/1
CAAGAAGAAGGATGAGTTGGAGCGTGTCGCCAA
+HWUSI-EAS1795_0092:3:1:1548:1594#0/1
\P^aW[^a^c^c^]aa[IZV_RSZT_BBBBBBB
@HWUSI-EAS1795_0092:3:1:3594:1589#0/1
CGACATTCCTGCCTCTTGGAGACGCTTTACGGA
+HWUSI-EAS1795_0092:3:1:3594:1589#0/1
caSc_cc\^Y^\Z_ZS_BBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3692:1589#0/1
TATAAAACAGATACACGGTTAAGCTCTGACCGG
+HWUSI-EAS1795_0092:3:1:3692:1589#0/1
ggggfggggcdggcggaffdff]cffcafffcf
@HWUSI-EAS1795_0092:3:1:4288:1594#0/1
CTGTAGACCAGCGACGACACCTTTGGATGCAGG
+HWUSI-EAS1795_0092:3:1:4288:1594#0/1
gfgggegcggggagggefefgcggagabafaee
@HWUSI-EAS1795_0092:3:1:4552:1592#0/1
ATGCCACCGCGCATCAGAGCAAGGCCGCCGAAT
+HWUSI-EAS1795_0092:3:1:4552:1592#0/1
hhfhhhhhhhhhhghhghhhhhhhhgfhffhhc
@HWUSI-EAS1795_0092:3:1:5033:1597#0/1
CACCCTTTCTAGTTCCGTCTCCTTTGCATTTTC
+HWUSI-EAS1795_0092:3:1:5033:1597#0/1
gfggggggfgfgggggggggcgffcffgggggg
@HWUSI-EAS1795_0092:3:1:5343:1596#0/1
CTTCGAGATACCTGCCTCGAATTCTCCGGTTCC
+HWUSI-EAS1795_0092:3:1:5343:1596#0/1
gggghhhhfhhhhfhhgdaaffhhehhghgahh
@HWUSI-EAS1795_0092:3:1:5769:1596#0/1
CCCGCCACGAGTCTTCCGGCTCCGTGAGCACCA
+HWUSI-EAS1795_0092:3:1:5769:1596#0/1
hhhhhhhhhghhhhhhhghhghggfhghahhch
@HWUSI-EAS1795_0092:3:1:6455:1588#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6455:1588#0/1
a_^aZVKa[Y^Yd^]`aWNY^PYY^Y\YWaO^Y
@HWUSI-EAS1795_0092:3:1:6475:1590#0/1
CACGCAGGATATATGTAAGTACAGGTACAGGTC
+HWUSI-EAS1795_0092:3:1:6475:1590#0/1
hhhhhghhhhghfhfhhhdfhhhhhghhfhegg
@HWUSI-EAS1795_0092:3:1:6988:1595#0/1
CTGCATGTACTTGATCAGGTCGATGACGCGGTT
+HWUSI-EAS1795_0092:3:1:6988:1595#0/1
hhhhhhghhhhhfhhghhhhhhhhfhghhhghf
@HWUSI-EAS1795_0092:3:1:7320:1588#0/1
TGCGTCGAAAGTGGGTGACTGTCTGAGATACAG
+HWUSI-EAS1795_0092:3:1:7320:1588#0/1
gggggggggggaggggggggggfdggggfgggg
@HWUSI-EAS1795_0092:3:1:7706:1599#0/1
CGCGCGTGCAGCCCAGGACATCTAAGGGCATCA
+HWUSI-EAS1795_0092:3:1:7706:1599#0/1
ggggggcgggggggegg[ffffggggfgggegg
@HWUSI-EAS1795_0092:3:1:7735:1596#0/1
AATTGCTCGACCAAGGTAGCATCGCTTCCCTTC
+HWUSI-EAS1795_0092:3:1:7735:1596#0/1
hhhhhhhhghhhhhhgghhdhhhfghhhhhhhh
@HWUSI-EAS1795_0092:3:1:7945:1595#0/1
TGGAAATGTGGGCGTCTTCTTGAACACCTGTTT
+HWUSI-EAS1795_0092:3:1:7945:1595#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:7973:1599#0/1
CTTTGGCAAAGGCATGTATTCCAGCAATACATT
+HWUSI-EAS1795_0092:3:1:7973:1599#0/1
hhhhhfghhhhhghhfhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:8039:1598#0/1
TGTGGCCATTCATATCAAATATAAAGTAGTGTT
+HWUSI-EAS1795_0092:3:1:8039:1598#0/1
ffff_faWcc\^ZVVVadca[ca_S^OPQPQ[Z
@HWUSI-EAS1795_0092:3:1:8059:1590#0/1
CACCACGGGGAGCTGGTAGGAGCCGTCCGGCAT
+HWUSI-EAS1795_0092:3:1:8059:1590#0/1
hghhhhhhhhhhhhhhhhhhdghhhghhhgggh
@HWUSI-EAS1795_0092:3:1:8379:1593#0/1
GTTTCAAGGAAACAGACGATGTTTAGGAAGTCC
+HWUSI-EAS1795_0092:3:1:8379:1593#0/1
hhhhhhhhhhhhhhfhhhhfhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9121:1592#0/1
GAAAAAACATGCCGCTAGCAAAAGATCTTCTGC
+HWUSI-EAS1795_0092:3:1:9121:1592#0/1
hhhhhhhhhghhhghhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:9212:1590#0/1
AAAGAAGGCCCATGTCATGGAGATCCAGCTGAA
+HWUSI-EAS1795_0092:3:1:9212:1590#0/1
hhhhhhhhhhhhhhhhhhhhgffhhhhhhgehh
@HWUSI-EAS1795_0092:3:1:9353:1596#0/1
TGTCGCTGTTGTTGTTTGTTTTTGTTCACCCCT
+HWUSI-EAS1795_0092:3:1:9353:1596#0/1
ggggggggggggggggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:9532:1599#0/1
CAGATTTGTCCAACAAATTGCACCGGAAGAAAG
+HWUSI-EAS1795_0092:3:1:9532:1599#0/1
hhhhhhhhhhhhhhhhhggdhhhhhhhfhhhce
@HWUSI-EAS1795_0092:3:1:9790:1594#0/1
CACTGGACCGGTGGCCAAGGAATGCGCCGATCT
+HWUSI-EAS1795_0092:3:1:9790:1594#0/1
ggggffgfffc[ebedecffffaaddfbb`bb_
@HWUSI-EAS1795_0092:3:1:10578:1594#0/1
CGTCCAGCAACGCGTTCCGCAAGATCGATGTGG
+HWUSI-EAS1795_0092:3:1:10578:1594#0/1
hgghhfhhhhegdhhgghghghchdhccffeff
@HWUSI-EAS1795_0092:3:1:10675:1598#0/1
CACCTACAACTCCATCATGAAGTGTGATGTGGA
+HWUSI-EAS1795_0092:3:1:10675:1598#0/1
hchhhhhhhfghhhhhghhhhgghhhhhghhhg
@HWUSI-EAS1795_0092:3:1:11122:1593#0/1
GGCCATTTAAAATTTTCAGTGGGCAGGTTAGAC
+HWUSI-EAS1795_0092:3:1:11122:1593#0/1
hhhhhhhhhhhhhhhhhhggdhhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:12307:1593#0/1
TGCTATTGTTTTTGCTGCTCTATTGATGTCTTA
+HWUSI-EAS1795_0092:3:1:12307:1593#0/1
hhhhhhhhhghhghhhhhhhhfhhhhhhhghgg
@HWUSI-EAS1795_0092:3:1:12344:1594#0/1
TAAGGCTGAAACCCTGCTCAACGAGTCCGATCA
+HWUSI-EAS1795_0092:3:1:12344:1594#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12382:1599#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12382:1599#0/1
hhghhhhhhhgffgdhhhhhhghhhhhgehgcg
@HWUSI-EAS1795_0092:3:1:12485:1588#0/1
ACTGTTTTGTTGGTCCTCGGTCAGTGAGTCCGG
+HWUSI-EAS1795_0092:3:1:12485:1588#0/1
hgghhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13123:1593#0/1
TGTGCATATTCAGAAACAAAGAGTAATATTTTT
+HWUSI-EAS1795_0092:3:1:13123:1593#0/1
hhgggghhhhhhdghahhgchhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:13142:1590#0/1
GGGCAATGACCACCAGTTGGGCCTTCTTCTGCT
+HWUSI-EAS1795_0092:3:1:13142:1590#0/1
ce^cfcfcffadfdffffYfcdcccfcf^cc]c
@HWUSI-EAS1795_0092:3:1:13269:1591#0/1
GGGAGCTGGAATAAAGATCCATGGTAGTCAACG
+HWUSI-EAS1795_0092:3:1:13269:1591#0/1
hhhhhhhhhhhhhhhhghhhhghhhhghhghhh
@HWUSI-EAS1795_0092:3:1:13442:1591#0/1
TAGACTATCAAGATGGGTCGTATGCACGCTCCT
+HWUSI-EAS1795_0092:3:1:13442:1591#0/1
aaacaacZZ\Z`dda_aOUVRSW_\Z`UTOW_B
@HWUSI-EAS1795_0092:3:1:13707:1598#0/1
TATTATAATATAAAAGTGTGTCAGCTCTACTCG
+HWUSI-EAS1795_0092:3:1:13707:1598#0/1
dc_afffaffYfffcddUW^aZddWbdffdd_b
@HWUSI-EAS1795_0092:3:1:14396:1589#0/1
ATTGGATTCCTCACGGGGGACGCGGGCGGACAG
+HWUSI-EAS1795_0092:3:1:14396:1589#0/1
hhhhhhhhhhhhhhhhh_hhhhhhhfegeeehd
@HWUSI-EAS1795_0092:3:1:15328:1597#0/1
AGGCATTTTACTGCTCTGAAATTATATCAAATA
+HWUSI-EAS1795_0092:3:1:15328:1597#0/1
hhhhhhhhhhhhhhhhhghhghhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:15694:1594#0/1
ATCGTGTAATAGTGACAATGTGTGTAAATTGAA
+HWUSI-EAS1795_0092:3:1:15694:1594#0/1
hhhhhhhhhhghhhhhhhfghhhhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:15875:1590#0/1
TCAGTGTCTTGTGCATGGGCGTGAAGTGCAGAA
+HWUSI-EAS1795_0092:3:1:15875:1590#0/1
hfhhdhghhhghhhhhhhhfhhghhhhhhehgh
@HWUSI-EAS1795_0092:3:1:15900:1591#0/1
CTTGACATCATCTGCGTTCAGTTTCAGCCAGGA
+HWUSI-EAS1795_0092:3:1:15900:1591#0/1
hhhhhhhhhhhhhhhhhhhgghhehhhhhghfh
@HWUSI-EAS1795_0092:3:1:16117:1588#0/1
GGCGGTGAAGTCGGCGGCTCCCTTGGGGGGGGT
+HWUSI-EAS1795_0092:3:1:16117:1588#0/1
fffffcf_fffffc]aaRGWW[Wa]aafdccBB
@HWUSI-EAS1795_0092:3:1:16460:1589#0/1
CGAAGAGCACGTGAAAGTCGCGTTCACAGTACT
+HWUSI-EAS1795_0092:3:1:16460:1589#0/1
ggggggggggggfcfffdffffggggeggggeg
@HWUSI-EAS1795_0092:3:1:16802:1589#0/1
GCATTCCTTACTCTCATTCGGGAATTCTGTTTG
+HWUSI-EAS1795_0092:3:1:16802:1589#0/1
ffaggggfcfcffff_fcacddddcffgggggf
@HWUSI-EAS1795_0092:3:1:16832:1590#0/1
GGCGTGGCGCAGGTTCCGCCTGAGATCTGGGTA
+HWUSI-EAS1795_0092:3:1:16832:1590#0/1
ggaggggeecefgggggfcc[fcccfffff`cB
@HWUSI-EAS1795_0092:3:1:16884:1591#0/1
CTTGGCGTTAAAGAAGTTTTCACCCCACAATCG
+HWUSI-EAS1795_0092:3:1:16884:1591#0/1
]SOaaaZSVZZYYa[[[fc`ffdffc`WZ^Z^f
@HWUSI-EAS1795_0092:3:1:17827:1588#0/1
GCGCGAAGACGCCCGCATCTTGGAATCCGGTTG
+HWUSI-EAS1795_0092:3:1:17827:1588#0/1
ggggggefggefggeg[gggggeggbgggeddg
@HWUSI-EAS1795_0092:3:1:17946:1598#0/1
TCGCGTATCAAATGCTCGGGACTGCGGTTAAGG
+HWUSI-EAS1795_0092:3:1:17946:1598#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhghg
@HWUSI-EAS1795_0092:3:1:18996:1599#0/1
GCTGAAGGTGCACGGCTTCTAAGCGGTCGAACG
+HWUSI-EAS1795_0092:3:1:18996:1599#0/1
hhghhhhhffhhhghhhhhghhchhgghhhhhf
@HWUSI-EAS1795_0092:3:1:19190:1590#0/1
GCGGTATCTGATCGCCTTCGAACCTCTAACTTT
+HWUSI-EAS1795_0092:3:1:19190:1590#0/1
gfgfgeggggfggggggfggggggggggggggg
@HWUSI-EAS1795_0092:3:1:19415:1599#0/1
CAATAGTACGATACGCTTCCCAGATGAGAATTA
+HWUSI-EAS1795_0092:3:1:19415:1599#0/1
hhghhhhhhhgghhhhhhhhhhhhehhchhhfh
@HWUSI-EAS1795_0092:3:1:19679:1595#0/1
GCCGTTTGTTCTTGTTTTGTTTGGTTTGTTTGG
+HWUSI-EAS1795_0092:3:1:19679:1595#0/1
faa`]Rb^]^[^baff`cc`ccFQ[][JPOPP^
@HWUSI-EAS1795_0092:3:1:19792:1596#0/1
TTCATCTTTAACTGGTAAGTCTCCAACGGCCCA
+HWUSI-EAS1795_0092:3:1:19792:1596#0/1
gggecggdgggggggggdf]fffff[cggeggg
@HWUSI-EAS1795_0092:3:1:1394:1610#0/1
GGCCATCTCGCAGCAGTTCTCCTCACTCTGGGC
+HWUSI-EAS1795_0092:3:1:1394:1610#0/1
edgcc]gffccfgcggfdffcfcge]egdgggg
@HWUSI-EAS1795_0092:3:1:1416:1603#0/1
CCTTGAGCGGTGTGATCCTGGCACTGGGCGTAT
+HWUSI-EAS1795_0092:3:1:1416:1603#0/1
b^acadabcd`dcWfcffcfffffafacdfbc]
@HWUSI-EAS1795_0092:3:1:2022:1603#0/1
AAGCTTGGTCCCATTGCTGAATTTCGCAAGGAG
+HWUSI-EAS1795_0092:3:1:2022:1603#0/1
hhhhhdhghhghh]fhhhghhcgghhfhggafh
@HWUSI-EAS1795_0092:3:1:2130:1602#0/1
CGTGCTCGTCACATAATGATGGTCGATGCTGCC
+HWUSI-EAS1795_0092:3:1:2130:1602#0/1
ffdffffhhhhhgfhhhffhfghhghhfhhhhh
@HWUSI-EAS1795_0092:3:1:3575:1605#0/1
CAGGGATAAAGATAGACGCTTAGTTTATACAGA
+HWUSI-EAS1795_0092:3:1:3575:1605#0/1
gggggfggggef]aad\fdfff[ff_fgggafg
@HWUSI-EAS1795_0092:3:1:3615:1604#0/1
CTGCGGCACAGAGTTGGATTCCACTGCTCGGGA
+HWUSI-EAS1795_0092:3:1:3615:1604#0/1
ebaf`Wffffffgggc][badbcfc`ca`bbbg
@HWUSI-EAS1795_0092:3:1:3824:1608#0/1
CACCTTTTTCGTAAAAACCTGAGAACTGCCAAT
+HWUSI-EAS1795_0092:3:1:3824:1608#0/1
_feafdfffdfaf^fafe[SeaZaa^\efcf]c
@HWUSI-EAS1795_0092:3:1:3921:1611#0/1
GGGACATGCTGCCGTCGGACCAGCGCACGAATC
+HWUSI-EAS1795_0092:3:1:3921:1611#0/1
gggg^ggfaeffggggffc[adffcafQaaa`f
@HWUSI-EAS1795_0092:3:1:3937:1602#0/1
GTCCGGTTGTCGAGAAGTTTTCTAGAGGATTTA
+HWUSI-EAS1795_0092:3:1:3937:1602#0/1
gggggfgfffffdffffY_aa^gggegdf]ccf
@HWUSI-EAS1795_0092:3:1:5148:1600#0/1
GTCTGGAGGCTGGTTTGGCCTTCCCGACTGGTT
+HWUSI-EAS1795_0092:3:1:5148:1600#0/1
hhhdhghhhhhhhghhhfhhgfghhghhhhfff
@HWUSI-EAS1795_0092:3:1:5317:1605#0/1
AAAGGAGAGGAGCCAAAAGGAGAGGAGCGAAAA
+HWUSI-EAS1795_0092:3:1:5317:1605#0/1
fgfafff[fcffdffffedfRfcfffffQfcdb
@HWUSI-EAS1795_0092:3:1:5405:1610#0/1
CCGGATTGGATTCCTCACGGGGGACGCGGGCGG
+HWUSI-EAS1795_0092:3:1:5405:1610#0/1
eQfffffgggfggggcffgggccdfffgfgeee
@HWUSI-EAS1795_0092:3:1:5891:1609#0/1
GGAAAAGGCTAAGAAACTGGGTGACTATCTGAT
+HWUSI-EAS1795_0092:3:1:5891:1609#0/1
fadacffgffggeggfgggdggffccff]ffdg
@HWUSI-EAS1795_0092:3:1:6009:1600#0/1
GCGGAAGTTTATTTGGTCTCCCAATGGGACAAC
+HWUSI-EAS1795_0092:3:1:6009:1600#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6685:1604#0/1
CTCAGTCGCAGCAGCCGCAAACGTTGCAGGTTC
+HWUSI-EAS1795_0092:3:1:6685:1604#0/1
ggggggggggggfdfdfggggggggeggggged
@HWUSI-EAS1795_0092:3:1:7071:1600#0/1
TGAACAGTTTGTAGAATGGCGGCCTTAATCAGG
+HWUSI-EAS1795_0092:3:1:7071:1600#0/1
dgggggggggggggfgggffgggddfcfcfaaf
@HWUSI-EAS1795_0092:3:1:7409:1602#0/1
CCGCAAGTTCGCCGAGCGGGAGATGGGCACCAC
+HWUSI-EAS1795_0092:3:1:7409:1602#0/1
fffd_f_fffafa^YZcVYWR\TUZY]dbb`WZ
@HWUSI-EAS1795_0092:3:1:8334:1603#0/1
ATAACAACAACAGCAGCAGTAGCAGCAATAGCA
+HWUSI-EAS1795_0092:3:1:8334:1603#0/1
fgggggfggggdgac^gffff^fffffcgfggg
@HWUSI-EAS1795_0092:3:1:8439:1604#0/1
GGCGAACGAATAATCTTGGAATAACCAGTCCGC
+HWUSI-EAS1795_0092:3:1:8439:1604#0/1
gggggggggggggfgggggggfgggfggggggf
@HWUSI-EAS1795_0092:3:1:8669:1600#0/1
CCTTGTCGGTGGGACGGGCTGGGGGAAGGATGG
+HWUSI-EAS1795_0092:3:1:8669:1600#0/1
hhhhhhhhhghhhehhhhghhhhhhgchhdehh
@HWUSI-EAS1795_0092:3:1:9158:1608#0/1
TGCCAGTTGATCAACTACTTCAGCTCGGTGCTC
+HWUSI-EAS1795_0092:3:1:9158:1608#0/1
hhhhghhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10196:1606#0/1
CTGCTGCGGAACTTTCTTTGCGTGAGATGGACT
+HWUSI-EAS1795_0092:3:1:10196:1606#0/1
hhhhhhghhhhhhgghhhhhghhhhhfghhhgg
@HWUSI-EAS1795_0092:3:1:10340:1610#0/1
CTTGACGATGATGGCCTTGCGACCGGCGTAACG
+HWUSI-EAS1795_0092:3:1:10340:1610#0/1
hhhhhhhhhghchehhghdfghhhhfhggghcg
@HWUSI-EAS1795_0092:3:1:10718:1604#0/1
CAGGAGGAGATGACGCGCTCACTGGCCACCATG
+HWUSI-EAS1795_0092:3:1:10718:1604#0/1
gfggggggeagggggffgggggggegfggggcg
@HWUSI-EAS1795_0092:3:1:11085:1610#0/1
GTTGTACTTGTTCTTGTCCTGAAATGTTAGGCG
+HWUSI-EAS1795_0092:3:1:11085:1610#0/1
hhhhhhhhhhhhhhhfhfghhhhghfhhhhghh
@HWUSI-EAS1795_0092:3:1:11345:1604#0/1
CAGCGAGCAATTGCGAGCGGTCAAATTGGTGGC
+HWUSI-EAS1795_0092:3:1:11345:1604#0/1
hhhhfhhhhhhhhhhhhfhh_hacaffffaff`
@HWUSI-EAS1795_0092:3:1:11705:1607#0/1
CTCTGGTGTTAGAATATCGATCTTGTTGATGGC
+HWUSI-EAS1795_0092:3:1:11705:1607#0/1
hgfhghhhhhhfghhhhghahehhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:11972:1609#0/1
AATGGATTAAAAATTGCTGGAGTTACAGATGTG
+HWUSI-EAS1795_0092:3:1:11972:1609#0/1
hhhhhhhgghhhhhhghhhggehhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12323:1609#0/1
GGCAGCGACTCACGGAGCTTGTGTGGACCGGTC
+HWUSI-EAS1795_0092:3:1:12323:1609#0/1
fgggceeggcgg^ffdaggf^fggcgfaffffa
@HWUSI-EAS1795_0092:3:1:13143:1608#0/1
AAACAGTGAAATACAGCTCCTCGGCAGTGGACA
+HWUSI-EAS1795_0092:3:1:13143:1608#0/1
ghhhghhhhhhhhhhfhhhgdghhhghghhchh
@HWUSI-EAS1795_0092:3:1:13183:1605#0/1
AAAATATTGATACCGATTAAGAGTACGTCCAAA
+HWUSI-EAS1795_0092:3:1:13183:1605#0/1
cgggggggeagfdfffcffadfabefdcf[cd^
@HWUSI-EAS1795_0092:3:1:13388:1600#0/1
GCCGTTCAAATTTTAAGTCTGTTCGACTTTTAA
+HWUSI-EAS1795_0092:3:1:13388:1600#0/1
gggggggggggggggg]gggagggggggggggg
@HWUSI-EAS1795_0092:3:1:13594:1604#0/1
CTGGCATCGTTTATGGTTAGAACTAGGGCGGTA
+HWUSI-EAS1795_0092:3:1:13594:1604#0/1
hhhhhhhhhhhhhhfhhhfgghhhhgghghhhh
@HWUSI-EAS1795_0092:3:1:13926:1609#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13926:1609#0/1
gggggggggfggggggfgggggdaggggggeaf
@HWUSI-EAS1795_0092:3:1:14115:1600#0/1
GAAAAAACAAGGCAAACAGCAGGTACAAGGGTG
+HWUSI-EAS1795_0092:3:1:14115:1600#0/1
hhhhhhhhhhhhhhhhhhhhhhhfhhgffffaf
@HWUSI-EAS1795_0092:3:1:14353:1605#0/1
CGAGAACCACGACTTTACCAATACAATCAAAAT
+HWUSI-EAS1795_0092:3:1:14353:1605#0/1
hhhhhhhhhhhhhhhhhhhhhghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:14671:1606#0/1
TGTTGGCCGTGGTGGCCCAGGCCTATGGAGATT
+HWUSI-EAS1795_0092:3:1:14671:1606#0/1
hhhhhhhghhhhhhhehhfghchhf_gffacfh
@HWUSI-EAS1795_0092:3:1:14693:1603#0/1
CTGGTCACCGTCCTCGTCCACCTCGAACTCCTC
+HWUSI-EAS1795_0092:3:1:14693:1603#0/1
gffffffdffdfgggfgggeggdggggggggag
@HWUSI-EAS1795_0092:3:1:14713:1608#0/1
GTTCGCAGTACATATGCGAGTGCATACCGAAGG
+HWUSI-EAS1795_0092:3:1:14713:1608#0/1
gggggggggggggffdeffffffddaffffafa
@HWUSI-EAS1795_0092:3:1:15825:1600#0/1
TATTCCGTTAACATAGCGAGGAACTCGGTATTC
+HWUSI-EAS1795_0092:3:1:15825:1600#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16049:1610#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16049:1610#0/1
Ydff_]fddddd]XKa`aWddcaffad]Rdddf
@HWUSI-EAS1795_0092:3:1:16241:1605#0/1
CGCCCCTTCCTAGATCAGCTGTGTACAGTAGGC
+HWUSI-EAS1795_0092:3:1:16241:1605#0/1
hhhhhhhhhhhhhhhhhhhhhghghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16467:1606#0/1
CGGCGATCTGTCCGGCGGCACGGTAACTCTCAA
+HWUSI-EAS1795_0092:3:1:16467:1606#0/1
fdYcff_fafcaff]cfdebJf`\^a`ddfcc]
@HWUSI-EAS1795_0092:3:1:16524:1611#0/1
TGCAGAATGTGGGCGTGCACATTAGTATTCCCG
+HWUSI-EAS1795_0092:3:1:16524:1611#0/1
hfhhhhhfghhhhhhfhhhffghhhhghghhhg
@HWUSI-EAS1795_0092:3:1:16667:1608#0/1
AGGGGCTTCATTCACTTGGGAGCCGGTCTGGCG
+HWUSI-EAS1795_0092:3:1:16667:1608#0/1
hgghghhfhghhhhhhhfhhdhhfhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:16691:1608#0/1
GCTGAACAATGACCAGAAGCACTTGCAGGATGC
+HWUSI-EAS1795_0092:3:1:16691:1608#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16834:1611#0/1
AAGATGGCCGATCAAGTCGATGAAAATCTGAAG
+HWUSI-EAS1795_0092:3:1:16834:1611#0/1
afff]f[\^ZQMWZYSWZ\^Yafadf[ffffWd
@HWUSI-EAS1795_0092:3:1:16929:1606#0/1
GTTCGGTGCTATCCTTGGCGAATCGGTTGCTGG
+HWUSI-EAS1795_0092:3:1:16929:1606#0/1
hhghhchghhhggghhgehfgghhgfchhcgfh
@HWUSI-EAS1795_0092:3:1:17369:1601#0/1
CGAGCAAAGGTTGGATGATGAATGATGTTACAC
+HWUSI-EAS1795_0092:3:1:17369:1601#0/1
hhhhhhhhhhhhhhfhggfgfhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:17676:1601#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17676:1601#0/1
ggggcggfgggggaaggdffddd_fcfcccffg
@HWUSI-EAS1795_0092:3:1:17800:1606#0/1
CACACGGTGAGGCCCAGGACCTTTTTGAGTTTT
+HWUSI-EAS1795_0092:3:1:17800:1606#0/1
ggggdgggggegggggggggggggggfddfffg
@HWUSI-EAS1795_0092:3:1:18218:1603#0/1
TTGACCTTAAGGCGGGCCTTGATGTACTTCTCG
+HWUSI-EAS1795_0092:3:1:18218:1603#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhghhgh
@HWUSI-EAS1795_0092:3:1:18508:1610#0/1
GGAGTGCTTGGTATCAAGGTCAAGGTCATGTTG
+HWUSI-EAS1795_0092:3:1:18508:1610#0/1
f[dYeeYffcfffaf_fSa`aafY]fffdfcfc
@HWUSI-EAS1795_0092:3:1:19103:1604#0/1
GCGAGATCAAGCTGCGTCGCTTGGCCAAGAAGC
+HWUSI-EAS1795_0092:3:1:19103:1604#0/1
gcfggggcggga]ffffdaaWcdaddd]f[acf
@HWUSI-EAS1795_0092:3:1:19714:1600#0/1
GGTGACCTTGTGTGTAGGGTCGTTACGAATTGC
+HWUSI-EAS1795_0092:3:1:19714:1600#0/1
hhhhhhhhhhhhhhhhhhhghhhgfghhehggh
@HWUSI-EAS1795_0092:3:1:1177:1622#0/1
GTTGAATTTATTTAGTTGGTTGGTTGGTTGGTT
+HWUSI-EAS1795_0092:3:1:1177:1622#0/1
Xecbccdadffcccaffdeffddffdddffaff
@HWUSI-EAS1795_0092:3:1:1319:1618#0/1
GTGCTATGCCTATGTGGGTGTCGATGGGCAGCG
+HWUSI-EAS1795_0092:3:1:1319:1618#0/1
c[f]fcfcd[adc^adRZ[aY^]f_f]dcfRW`
@HWUSI-EAS1795_0092:3:1:2622:1615#0/1
GCAGACAAAGACGTCAGCGATGAGCCGCCAAAG
+HWUSI-EAS1795_0092:3:1:2622:1615#0/1
geggggggg]dgfffffgggggggggggggggg
@HWUSI-EAS1795_0092:3:1:3668:1618#0/1
AAAAATTGCGTAAAGAAAAGGAAAGGAAAGCTT
+HWUSI-EAS1795_0092:3:1:3668:1618#0/1
hhhhhhhhhhhhhhfhhhhhhghfhghhhhahg
@HWUSI-EAS1795_0092:3:1:3892:1622#0/1
CTGGAATGAATGGTTGGACGAAATATTAACTGT
+HWUSI-EAS1795_0092:3:1:3892:1622#0/1
fgggcgcgegggfffgaddffffggggfgcagg
@HWUSI-EAS1795_0092:3:1:4215:1615#0/1
CTGCGACACGCCATCAAGATTTTCAAGCTGAAG
+HWUSI-EAS1795_0092:3:1:4215:1615#0/1
d_fffffffffff_ffffffffffccffffdff
@HWUSI-EAS1795_0092:3:1:4295:1612#0/1
ACGCCAGGAGCCATCTCCACACGACGGATGTAC
+HWUSI-EAS1795_0092:3:1:4295:1612#0/1
fdddcf_fddffgcf]dcfffffgfgegffagg
@HWUSI-EAS1795_0092:3:1:4801:1617#0/1
AAGAGACAGAACTCAGTAGCAGCCTCATCAACT
+HWUSI-EAS1795_0092:3:1:4801:1617#0/1
ghhhhghhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4898:1620#0/1
GTCTTCTTGAAAATGGCCACCAACTGGCGGACG
+HWUSI-EAS1795_0092:3:1:4898:1620#0/1
affdddfcdffeffcffff\cfffffffffc_d
@HWUSI-EAS1795_0092:3:1:5235:1619#0/1
GTCCGGCGTAACCACCTGCCTCCGATTCCCCGG
+HWUSI-EAS1795_0092:3:1:5235:1619#0/1
ghhhfhchhhhhhfhhhhhhefhhgghhghghe
@HWUSI-EAS1795_0092:3:1:5349:1618#0/1
CGGAAAGGTAAATGTACCGCTGGCCGGCGAGTG
+HWUSI-EAS1795_0092:3:1:5349:1618#0/1
hhfghghhhhhhghhhhgghghhhfhf_fdfag
@HWUSI-EAS1795_0092:3:1:6316:1613#0/1
GTCGGTATACAGCGACTCATCATTTATAAGATG
+HWUSI-EAS1795_0092:3:1:6316:1613#0/1
hhhhghhhhhhhhhhhhhfehghhhhfhhhhgh
@HWUSI-EAS1795_0092:3:1:6759:1614#0/1
AGGAGATCGAGGATGATGGCGACGCCGAGGAGA
+HWUSI-EAS1795_0092:3:1:6759:1614#0/1
ghhhghhhhhhhhhhhhhfghgchhehhhgchh
@HWUSI-EAS1795_0092:3:1:6801:1617#0/1
CTGCGGATGTGTTTGCTCTGGTTTGGGAAACAC
+HWUSI-EAS1795_0092:3:1:6801:1617#0/1
hhhhhhhhghghhhhhhhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7442:1619#0/1
CTGGGACTTCCTGGCCCCCAAGAAGATCAAGGA
+HWUSI-EAS1795_0092:3:1:7442:1619#0/1
ffffffffggggcggggggcgfffffdgggdcg
@HWUSI-EAS1795_0092:3:1:7956:1618#0/1
TGCGAGCGTACATTCCAGATCTATTCCTGATTT
+HWUSI-EAS1795_0092:3:1:7956:1618#0/1
hhhghhhfhhhehhhhhhhhhgfhhhhhgfhgg
@HWUSI-EAS1795_0092:3:1:9302:1612#0/1
TGCTTATCGTCGCGCAGATCCAGTTTGGTGCCG
+HWUSI-EAS1795_0092:3:1:9302:1612#0/1
hhhhhhhhhhhghfhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10081:1621#0/1
CTGCAGTAGTTAAATCTGGGCGTGTACAAAGCA
+HWUSI-EAS1795_0092:3:1:10081:1621#0/1
hhghhhhhghhhhhhhhhhhhhhghhhghgheg
@HWUSI-EAS1795_0092:3:1:10153:1622#0/1
ATGAGCTGCGTGTGGCACCCGAGGAGCACCCCG
+HWUSI-EAS1795_0092:3:1:10153:1622#0/1
hhhhghhhhhhghhhhhhhhhhhfhffhhhhhe
@HWUSI-EAS1795_0092:3:1:10243:1622#0/1
ATCCCCAGTTGCACGACGTTAACCGGCGCACAG
+HWUSI-EAS1795_0092:3:1:10243:1622#0/1
`]\aX]XXVS]OaccaaBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:10936:1622#0/1
CTTAAAACCATTGGGTTCATAGCCCACAAAAAT
+HWUSI-EAS1795_0092:3:1:10936:1622#0/1
gggggfgggcgfgggggffggggggggggfggg
@HWUSI-EAS1795_0092:3:1:11717:1623#0/1
TGTTTGTGTTGTTGTTTTTGCGCGCGCTCTGCG
+HWUSI-EAS1795_0092:3:1:11717:1623#0/1
hhhhhhhhhhhhhghhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12024:1612#0/1
CCGGTGATTCCTCCTGCTCGAACTTCCTGTCGT
+HWUSI-EAS1795_0092:3:1:12024:1612#0/1
hhhhhdghhhhhhhhhgggahhghhhghfhhfc
@HWUSI-EAS1795_0092:3:1:12771:1612#0/1
CGACTGTTCAAGCCAAGATACCGCTATGCCTCC
+HWUSI-EAS1795_0092:3:1:12771:1612#0/1
cccccYaBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12841:1618#0/1
GTCGATGAGGTCCGTACCGGAACCTACCGTCAG
+HWUSI-EAS1795_0092:3:1:12841:1618#0/1
fffff[ffcf]fac^ccX^]NWddadcda`a^]
@HWUSI-EAS1795_0092:3:1:13296:1622#0/1
CCCTCGTTGTCCTTGCGGTCACGGTCACCGCCT
+HWUSI-EAS1795_0092:3:1:13296:1622#0/1
ffhhhfhhghhhhhefdhhhfhgheggghhghg
@HWUSI-EAS1795_0092:3:1:14056:1622#0/1
TGCATACATCCGGCTCCACTCCTTTTGAAGCCG
+HWUSI-EAS1795_0092:3:1:14056:1622#0/1
fffdfffg_gfgc_ddf`[fccffeffdaffd^
@HWUSI-EAS1795_0092:3:1:14144:1623#0/1
CCCGGTTGTCGAGAAGTTTTCTAGAGGATTTAG
+HWUSI-EAS1795_0092:3:1:14144:1623#0/1
hhhhhhhghhhfhhhhhhhhghgfhhfghhhfh
@HWUSI-EAS1795_0092:3:1:14219:1619#0/1
CGCCAACATGGGTTTCGCTACTCTCTGGTACTC
+HWUSI-EAS1795_0092:3:1:14219:1619#0/1
f_ffdf]dda_Radddadad]ad^d^^ZZa]VZ
@HWUSI-EAS1795_0092:3:1:15165:1612#0/1
CTTCTACGAGAAGCGTATGGGACAGGTTGTGGA
+HWUSI-EAS1795_0092:3:1:15165:1612#0/1
hhhhhhhhhdhhhhhhdhghhghhhfhhhghce
@HWUSI-EAS1795_0092:3:1:15723:1619#0/1
AACGAAATACAAACAACGCAGTTTGTGTAAACA
+HWUSI-EAS1795_0092:3:1:15723:1619#0/1
hhhhhhhhhghhhhhhhhhhfhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15938:1612#0/1
CTCGATGCGAGCATAGGCGATCTGTACTGTGAT
+HWUSI-EAS1795_0092:3:1:15938:1612#0/1
hhfhhhhhhhhhhhhhhhhhgfhhggdhdghhh
@HWUSI-EAS1795_0092:3:1:16122:1622#0/1
AATCCATCCTTGCCCACATGGGCGGTTGCCGGC
+HWUSI-EAS1795_0092:3:1:16122:1622#0/1
ggfgggggggfegggffgegggX`]X\O^\Y\^
@HWUSI-EAS1795_0092:3:1:16616:1611#0/1
CGAAGATCGGAATTAACGGATTTGGCCGCATCG
+HWUSI-EAS1795_0092:3:1:16616:1611#0/1
hhfgghhhfgghhhhhehhfhhhghhhfhhgfh
@HWUSI-EAS1795_0092:3:1:16971:1613#0/1
GCGACGATCACGCGGGAATTATGCGCAAAAACC
+HWUSI-EAS1795_0092:3:1:16971:1613#0/1
gffafdfgggcgcggcgggggcfdfdeeafWfd
@HWUSI-EAS1795_0092:3:1:17041:1620#0/1
AAAAATTCGAAACCAGCACCTGCAACAGCCAGT
+HWUSI-EAS1795_0092:3:1:17041:1620#0/1
fdffdffdgggggfggfggdgaffaaafaa]b`
@HWUSI-EAS1795_0092:3:1:17456:1613#0/1
GAGCTCCATTGGACAGCGTGATCTGGACCGTAT
+HWUSI-EAS1795_0092:3:1:17456:1613#0/1
dhhhhhhhhhhghhhhgghcahf_fafghgghh
@HWUSI-EAS1795_0092:3:1:17474:1620#0/1
ATTTTCTCATCTCTCTCGTGCAAACAAAAAGCG
+HWUSI-EAS1795_0092:3:1:17474:1620#0/1
hhhhhhhhhhhhhghhhghhhhhhhhhhfhghh
@HWUSI-EAS1795_0092:3:1:17550:1620#0/1
ATCCTCGTCGTCATCATCATCTGATCCCAAATG
+HWUSI-EAS1795_0092:3:1:17550:1620#0/1
]bSPP]]Waa\WTPOPRSW\S\c[I]]_BBBBB
@HWUSI-EAS1795_0092:3:1:17663:1623#0/1
GTACGAACCAAGACGGTGAAGAAGGCCGCTAAG
+HWUSI-EAS1795_0092:3:1:17663:1623#0/1
ggggggggggggggggggfgggggggggggggf
@HWUSI-EAS1795_0092:3:1:17735:1621#0/1
CGCGTTCCTGATTCTTTTTGAGGATGTACTCGC
+HWUSI-EAS1795_0092:3:1:17735:1621#0/1
hhhhhhhhhghghghhhhhghhhhgfhhhhhgh
@HWUSI-EAS1795_0092:3:1:17841:1620#0/1
CTGGAGCAGCGGCGGCGGCAGCAGGGGCAGCAC
+HWUSI-EAS1795_0092:3:1:17841:1620#0/1
ggggggggggfggggc]fa]cW[aadaQRWRR]
@HWUSI-EAS1795_0092:3:1:17869:1618#0/1
GCGGCATCGTAGTGCTATCGATACAGAGTTCTA
+HWUSI-EAS1795_0092:3:1:17869:1618#0/1
ghhghhhhhhhhhhhhghhhhahhghehhhhgg
@HWUSI-EAS1795_0092:3:1:18639:1620#0/1
GGGGACTTGGGGGGGAAATGGGAAGGGGCAACT
+HWUSI-EAS1795_0092:3:1:18639:1620#0/1
ffdf]cffdcfcdccX[bbba[ffccc^]b]]d
@HWUSI-EAS1795_0092:3:1:18798:1613#0/1
TGGCCACCGTTACAAAAGAAAACCGCGAAGTGA
+HWUSI-EAS1795_0092:3:1:18798:1613#0/1
cgggggggggggggcggcggggggfggfffeff
@HWUSI-EAS1795_0092:3:1:19302:1623#0/1
TGGGTATTTGAGTTTCCGGGGAAACACTGAATT
+HWUSI-EAS1795_0092:3:1:19302:1623#0/1
aggagggfg]gggggfggcegcggggggc_]WZ
@HWUSI-EAS1795_0092:3:1:19564:1613#0/1
CACCACCGGACAGCCGGGAAGCACAGCGCCCAG
+HWUSI-EAS1795_0092:3:1:19564:1613#0/1
hhhhhhhgehgfdffffehhdhfffbfbfffe]
@HWUSI-EAS1795_0092:3:1:1348:1634#0/1
GTTTGGCGGCTGTTCCAAGGCCAATAACTATGG
+HWUSI-EAS1795_0092:3:1:1348:1634#0/1
fgfgffa_cdebffaaYdffadfffff`cddda
@HWUSI-EAS1795_0092:3:1:1982:1633#0/1
TACTGCCGCACGGAACAAAGTCTAAACAGGAAA
+HWUSI-EAS1795_0092:3:1:1982:1633#0/1
hhhhhhhghhhhhhhhhghehhhgfhhggehfh
@HWUSI-EAS1795_0092:3:1:2112:1635#0/1
GAGGATAGCAGAAAGAAGTCGTTAACGCGAGGA
+HWUSI-EAS1795_0092:3:1:2112:1635#0/1
c\accSY\_Y_]ccYc`Vc\c[aa`a]cc__cB
@HWUSI-EAS1795_0092:3:1:3091:1634#0/1
TGTTCGGCGAGGACGGCAACAGCACCATCTCCG
+HWUSI-EAS1795_0092:3:1:3091:1634#0/1
gggdggcgggggeggggggagd_ffffcgcggg
@HWUSI-EAS1795_0092:3:1:3542:1630#0/1
AATGGAATCGCTGAACAGCTGCTACCAGGATCA
+HWUSI-EAS1795_0092:3:1:3542:1630#0/1
hhhhgfhhhhhhdffffghhghhhhghhedhch
@HWUSI-EAS1795_0092:3:1:3997:1629#0/1
CGATGCTGAATGAATTTGGTCGATCAATAAATT
+HWUSI-EAS1795_0092:3:1:3997:1629#0/1
hhgghhhhghhhhhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4509:1634#0/1
CTATGGCAGTCGTATATAGTTAATTGCAGTATT
+HWUSI-EAS1795_0092:3:1:4509:1634#0/1
gggggggggfggfcffacdffffffffgegdgg
@HWUSI-EAS1795_0092:3:1:5069:1631#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5069:1631#0/1
b^ccffcacdadcfdacff\fffafaaffffad
@HWUSI-EAS1795_0092:3:1:5152:1627#0/1
TGGGCCTTCTTTTGGCGCTGCTTGATCAAGCGG
+HWUSI-EAS1795_0092:3:1:5152:1627#0/1
]afffafca]ac\Zcca\ZQT_ddaddcdaadf
@HWUSI-EAS1795_0092:3:1:6201:1626#0/1
GGCAAAAAAAAACAAAAGAATTAAAAGAATCAG
+HWUSI-EAS1795_0092:3:1:6201:1626#0/1
hhhhhhhfhhhggghhhfefghhhhgahhhhhh
@HWUSI-EAS1795_0092:3:1:6283:1627#0/1
GGAAAGACCGATTACTATGCCAGGAAACGCCTA
+HWUSI-EAS1795_0092:3:1:6283:1627#0/1
hghhhhhhhhhfchghhhhdhhffhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6499:1626#0/1
TGGGCATCACCGAGTCGTTCGCCGTTAAGCGCC
+HWUSI-EAS1795_0092:3:1:6499:1626#0/1
geccfffggggggfggggggdgggf_gggfcgg
@HWUSI-EAS1795_0092:3:1:6944:1630#0/1
GGCTTGGTAAAATCAATGACGTGTTGGATGATA
+HWUSI-EAS1795_0092:3:1:6944:1630#0/1
ggggggggggggfWfffffffffgggggffgeg
@HWUSI-EAS1795_0092:3:1:7572:1630#0/1
CAGAGCAGTAAAAGCAGTGCAGCCGTTGATTTC
+HWUSI-EAS1795_0092:3:1:7572:1630#0/1
fff[f]ffcffffffdf`f^fff_ffccffdaf
@HWUSI-EAS1795_0092:3:1:8536:1635#0/1
CGACGAACGTGCGAAAGCGCAAGATTATGAACT
+HWUSI-EAS1795_0092:3:1:8536:1635#0/1
hhhhhhhhhhhhhhhhhfchhgdhhfhfgfhhh
@HWUSI-EAS1795_0092:3:1:8630:1626#0/1
CACACATTCGCGGCATGACAAGGACATCAAGAT
+HWUSI-EAS1795_0092:3:1:8630:1626#0/1
hhhhhhhhhhhhQeedehhghhhhghhghhhhg
@HWUSI-EAS1795_0092:3:1:8972:1630#0/1
CTGATATTGCCAACCGTGTGCCGGGATTCCCCA
+HWUSI-EAS1795_0092:3:1:8972:1630#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9388:1625#0/1
CAGATCTTGATCTTGTTAACCAAGTACTTGACC
+HWUSI-EAS1795_0092:3:1:9388:1625#0/1
hhhhhhhhhhhhhhhhhfhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9612:1628#0/1
ACTAGTTCCAGACAACGATTGAGCATCTTTTCG
+HWUSI-EAS1795_0092:3:1:9612:1628#0/1
hhhhhfhhhhhhghhdfghhahhghhhhhhhhf
@HWUSI-EAS1795_0092:3:1:10176:1627#0/1
TCCCGTTCGATCTCACGCTCTCGCCTAGACTCA
+HWUSI-EAS1795_0092:3:1:10176:1627#0/1
hhhhhhhhhhhhhhhhhhhhhhhhgfhfhgghg
@HWUSI-EAS1795_0092:3:1:10487:1626#0/1
TCTTTAAGCGATTTGTCGCAAAGCAATGCTATA
+HWUSI-EAS1795_0092:3:1:10487:1626#0/1
hhhhhhhghhhhhhhhhhghhhhhhhhhgeghh
@HWUSI-EAS1795_0092:3:1:10534:1635#0/1
TGCCCACCTGGTTGCCCTTGAAGTGGCCGCGGA
+HWUSI-EAS1795_0092:3:1:10534:1635#0/1
gggcgggggggeggfggfgaeg_afffffaffg
@HWUSI-EAS1795_0092:3:1:11303:1633#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11303:1633#0/1
ggcgfgafffefa__fdffffacdffcf[cffa
@HWUSI-EAS1795_0092:3:1:11936:1627#0/1
AACTCAAAGGGCTATCGTCGCGGCACACGGGAC
+HWUSI-EAS1795_0092:3:1:11936:1627#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhgegh
@HWUSI-EAS1795_0092:3:1:11968:1634#0/1
TCCGTTTGTCCTTGTCCACAACGCAGTTTCGCG
+HWUSI-EAS1795_0092:3:1:11968:1634#0/1
gghhhhhghhhghghhhfhhhhfffgghhhhhh
@HWUSI-EAS1795_0092:3:1:12099:1632#0/1
TCTGCCTGTACTCATCCTCCCGATCGGCAATCG
+HWUSI-EAS1795_0092:3:1:12099:1632#0/1
hhhhghhhhhhhhghhhhhhhgghhhghhhhgg
@HWUSI-EAS1795_0092:3:1:13275:1624#0/1
GTGGGATAAATAACGCTTGGAGATTGCTCTTAT
+HWUSI-EAS1795_0092:3:1:13275:1624#0/1
hgfhhghhfhhhhhhhhhhhfhghhhghhhhgh
@HWUSI-EAS1795_0092:3:1:13597:1633#0/1
CAAGCCCGAAGCTAAGACCGTCCAGGATCTGAA
+HWUSI-EAS1795_0092:3:1:13597:1633#0/1
dgeggagdcf^f^ee[eYeedeffc]`dabd]Z
@HWUSI-EAS1795_0092:3:1:13924:1626#0/1
CGACTACGAGCGATTCATTAAACGCTGTCAGGC
+HWUSI-EAS1795_0092:3:1:13924:1626#0/1
ggggggggfgfggggggfffffgdggggggdea
@HWUSI-EAS1795_0092:3:1:14009:1624#0/1
GGGTATTGGGAGGAGTGCAGGGCAAACATGTTC
+HWUSI-EAS1795_0092:3:1:14009:1624#0/1
gfgegggffcffgggdggggggggggfgffggg
@HWUSI-EAS1795_0092:3:1:14083:1632#0/1
CAATCCATCAGTTCTCCAGTAATAGCCACCTCA
+HWUSI-EAS1795_0092:3:1:14083:1632#0/1
ggggcggegfgdgggggggggdff_ffgggcgf
@HWUSI-EAS1795_0092:3:1:14752:1629#0/1
GGTTTAGTGGTGTCCCTGGGCCTCGGCCTCCAG
+HWUSI-EAS1795_0092:3:1:14752:1629#0/1
chfhhhh_hhhhhhhhcffhhh[fcffhghhhh
@HWUSI-EAS1795_0092:3:1:14825:1627#0/1
CAGCTGGATGAAACGCTCCCGAACGAAGTCTTC
+HWUSI-EAS1795_0092:3:1:14825:1627#0/1
gdggggggggagggcggdffffgfegafefaag
@HWUSI-EAS1795_0092:3:1:15085:1630#0/1
GCGCCGCCGTTCTGCCTCCATTCGCGAGTCCAA
+HWUSI-EAS1795_0092:3:1:15085:1630#0/1
a^^c^Yaa\ccWdddddScS^ddaWaRI]__\\
@HWUSI-EAS1795_0092:3:1:15244:1624#0/1
ATAACAAACTGCACGAGCGATACACAGAGCTGT
+HWUSI-EAS1795_0092:3:1:15244:1624#0/1
gggggggegggggggggcggggagggfggggcg
@HWUSI-EAS1795_0092:3:1:16580:1629#0/1
CTGGATAACGATGTGACCATTGTAGATCAGCCG
+HWUSI-EAS1795_0092:3:1:16580:1629#0/1
hhghhhhhfhghhhghghghhhhhhhhhhhehh
@HWUSI-EAS1795_0092:3:1:16833:1631#0/1
GTCAAGTTCCGAAGGCGTCGCGAAGGAAAGACC
+HWUSI-EAS1795_0092:3:1:16833:1631#0/1
hhhfhhhhhhhhhhhfghhfhhhghghhcgghh
@HWUSI-EAS1795_0092:3:1:16987:1630#0/1
TACGACTACGATGTGACTGAGGCCCGTAAGATC
+HWUSI-EAS1795_0092:3:1:16987:1630#0/1
gfgfgcgggc]gff_fddfcffgggeff]fdfc
@HWUSI-EAS1795_0092:3:1:17146:1624#0/1
CGCCGATCTGGAAGCGCAGACCACCATCGAGGT
+HWUSI-EAS1795_0092:3:1:17146:1624#0/1
fffffccba`beagegagdggg]fafWfc`caS
@HWUSI-EAS1795_0092:3:1:17262:1628#0/1
GCCGTGCCTGCTCTAACCGCCACGGTCTGATCC
+HWUSI-EAS1795_0092:3:1:17262:1628#0/1
fggggfggacgfgggggffgg_fffefggedgg
@HWUSI-EAS1795_0092:3:1:18058:1623#0/1
GCGGAAGTGGGGATCAGAGTCCGGATCCGAGTC
+HWUSI-EAS1795_0092:3:1:18058:1623#0/1
ggggg]ga_cfcOTXZWf[cffdacbf[c]aa`
@HWUSI-EAS1795_0092:3:1:18348:1627#0/1
AAGGTGGACTCGATCCCTGCCGCCAAGACCCGC
+HWUSI-EAS1795_0092:3:1:18348:1627#0/1
hhhhhhhhhhhhfhhhhhhhhhhhhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:18575:1633#0/1
ATGATGAGGAGTACACCAGCTTCCTACCCGATT
+HWUSI-EAS1795_0092:3:1:18575:1633#0/1
gghfghgehffhhhghhhhhhfghhchhfghfh
@HWUSI-EAS1795_0092:3:1:18780:1628#0/1
GCCATCTGTGGCCCGGACGATTCCTTAGAACTG
+HWUSI-EAS1795_0092:3:1:18780:1628#0/1
gegcfcgfdfcdfcd]faadY`fff_dcfdd[[
@HWUSI-EAS1795_0092:3:1:18830:1625#0/1
CGTGTCGCGATCTACGAGTACCTCTTCAAGGAG
+HWUSI-EAS1795_0092:3:1:18830:1625#0/1
_gggggffffaf_Wfdfgefgg_fffcgggbac
@HWUSI-EAS1795_0092:3:1:18986:1633#0/1
CTCTGCCTCCGCCACGACCTCCCCCTCCATGGC
+HWUSI-EAS1795_0092:3:1:18986:1633#0/1
hhhhghhhhhhhhghhhhhfhhhhgcheheeeh
@HWUSI-EAS1795_0092:3:1:19514:1634#0/1
TAGCCCTTTGAGTTGCCCTTTTCATCGGTGGCT
+HWUSI-EAS1795_0092:3:1:19514:1634#0/1
hhhhhhhhhfhhhhchhhghhhhhfghcgggga
@HWUSI-EAS1795_0092:3:1:1614:1638#0/1
CGGAATGGTCCACCAGGCATTGTGGTACAGGTT
+HWUSI-EAS1795_0092:3:1:1614:1638#0/1
b]V`df\egaggfffY_Yffc\fadfdffdfcf
@HWUSI-EAS1795_0092:3:1:3166:1646#0/1
CAAGGATATGCTGCAGCAGATCAAGGAGCAGAA
+HWUSI-EAS1795_0092:3:1:3166:1646#0/1
gggggggggdfgfgggeggfgegfgggggggfg
@HWUSI-EAS1795_0092:3:1:3887:1643#0/1
CCTGGAGCTGCGTCTGTGGGAGCGGAGGGAGCA
+HWUSI-EAS1795_0092:3:1:3887:1643#0/1
hhghhhhhhhhhhhhhghhhhhhgh_cggbaf]
@HWUSI-EAS1795_0092:3:1:4606:1642#0/1
CATCAGCAAAAAAAACCAACAACCAGCTAGAAG
+HWUSI-EAS1795_0092:3:1:4606:1642#0/1
ffcffc__dddfggcegfffdff_ffff^ffcc
@HWUSI-EAS1795_0092:3:1:4953:1642#0/1
GCAACGGTGTCCACCCCTCGCACTTCTGCCGCG
+HWUSI-EAS1795_0092:3:1:4953:1642#0/1
fdfffffdfdffgggggggeggggggggggggg
@HWUSI-EAS1795_0092:3:1:4992:1646#0/1
CGGATTTGAACTTGTCATAATTCCAGCCAGCAG
+HWUSI-EAS1795_0092:3:1:4992:1646#0/1
gggcggggggggggg_ggggggggegggggfgg
@HWUSI-EAS1795_0092:3:1:5700:1636#0/1
ATTTTTTGCGCCGCGTAAAGGAAAATGAGCGAT
+HWUSI-EAS1795_0092:3:1:5700:1636#0/1
hhhhhhhhhhhhhfehfgghfghghhhhhhhgh
@HWUSI-EAS1795_0092:3:1:5730:1637#0/1
GTGCAGCCCAAGCGCGATCTGTCCCGTTTCGTT
+HWUSI-EAS1795_0092:3:1:5730:1637#0/1
hhhhhhhhhhRhfffffhghhghffhhhghhhh
@HWUSI-EAS1795_0092:3:1:5759:1640#0/1
CGCCAACCCCGAGGTCAAGCAGGTGATCGACCA
+HWUSI-EAS1795_0092:3:1:5759:1640#0/1
hhhhhhhhhhhhhhgghhhghfhgghhdcfffh
@HWUSI-EAS1795_0092:3:1:5953:1639#0/1
TGAGACACCGTCACGCGGTGGCGGCAGTAAGTC
+HWUSI-EAS1795_0092:3:1:5953:1639#0/1
ffdgggggfgggggg_gfdff]]dddbgggggf
@HWUSI-EAS1795_0092:3:1:7094:1635#0/1
GCATATTCTGCCATTCCACACACACACCAACAA
+HWUSI-EAS1795_0092:3:1:7094:1635#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8650:1636#0/1
TCTTGATGTTGTTGTTGAGTGGTTGTTGTTCAG
+HWUSI-EAS1795_0092:3:1:8650:1636#0/1
hhhhhhhhhhhhgfhhgffhhhhhghhehhhhh
@HWUSI-EAS1795_0092:3:1:8749:1638#0/1
CCCGAGGGCAAGTTCTTCGCCAAGTACTTGCAG
+HWUSI-EAS1795_0092:3:1:8749:1638#0/1
hhhhhghhhhhhgghhhhghhhhhhhhghhhgh
@HWUSI-EAS1795_0092:3:1:8779:1638#0/1
CAACAACAAGCATATAACCAACATCATAATGCA
+HWUSI-EAS1795_0092:3:1:8779:1638#0/1
gfgggggggcgggdgggggggcfgfgggecggg
@HWUSI-EAS1795_0092:3:1:8937:1638#0/1
GTTCTGTCGTACTGCACCAGAATGTCCTTGATC
+HWUSI-EAS1795_0092:3:1:8937:1638#0/1
hhhhhhhhhhfhhhhhhhgcgggfhhhhhdfhh
@HWUSI-EAS1795_0092:3:1:9176:1643#0/1
CCCAGGTCCATGGCCCGTGAGTTGAAGGGAACC
+HWUSI-EAS1795_0092:3:1:9176:1643#0/1
hhhhhhghhhhhghhhhhhhhhhghhghghhhh
@HWUSI-EAS1795_0092:3:1:9317:1636#0/1
GGTGCCGCTGGCGCTGCCGGAGCCGGCGGTGCT
+HWUSI-EAS1795_0092:3:1:9317:1636#0/1
ffcgfggffffffcdcfcffcada^bb^aBBBB
@HWUSI-EAS1795_0092:3:1:9439:1646#0/1
TTTGGTTTTGTTCTAGTATGAATTTATAATTTA
+HWUSI-EAS1795_0092:3:1:9439:1646#0/1
hhhhghhhhghhhhhhhhhchgdhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9602:1646#0/1
CAGTGATTAGCCACAGCACTTCGACATGTCCAC
+HWUSI-EAS1795_0092:3:1:9602:1646#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhgghhhghh
@HWUSI-EAS1795_0092:3:1:9652:1637#0/1
ACAATGGACGGCAGGGTGACATCGGTCCTCGTG
+HWUSI-EAS1795_0092:3:1:9652:1637#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9756:1642#0/1
CAGGACGGGTCCCTTAAGCTGGGTAGCCAGCTT
+HWUSI-EAS1795_0092:3:1:9756:1642#0/1
fhhfhhhhhghhhhhhhhhhhhgggfhhfhheg
@HWUSI-EAS1795_0092:3:1:10764:1639#0/1
CCGGAGATGAATTTGGGACTCTTTTGTGTGTCG
+HWUSI-EAS1795_0092:3:1:10764:1639#0/1
gcgfggaggggggdggggfgggggegecdfdfg
@HWUSI-EAS1795_0092:3:1:10900:1639#0/1
AGCATAAGTTTAATTTCTTCCATCGAAAGGAGT
+HWUSI-EAS1795_0092:3:1:10900:1639#0/1
hhhhhhhfhhhhghhhhhhhhffhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:11575:1640#0/1
CGCTGGAGTGGCCAACACCACGGTGGAGTCGGT
+HWUSI-EAS1795_0092:3:1:11575:1640#0/1
gggggggfgggggggggggfgggfgggedggcd
@HWUSI-EAS1795_0092:3:1:12120:1645#0/1
TCCACCACAAGGGCAACAGGAAACTGTTCTCGT
+HWUSI-EAS1795_0092:3:1:12120:1645#0/1
fafffdffaffc[ffffgggdeffffeafdfaf
@HWUSI-EAS1795_0092:3:1:12392:1638#0/1
ATACATTTTATGCAAATGCAAATGCAAATGGAA
+HWUSI-EAS1795_0092:3:1:12392:1638#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:12433:1638#0/1
ATGCAATAGTACGATACGCTTCCCAGATGAGAA
+HWUSI-EAS1795_0092:3:1:12433:1638#0/1
dgggggffcgfggggcgggcfgggggfffffff
@HWUSI-EAS1795_0092:3:1:12544:1640#0/1
ATTTGATTAATTTCGCATATTAAAAGTTCTAGG
+HWUSI-EAS1795_0092:3:1:12544:1640#0/1
gggggfgggggggggggeggggggggggggggd
@HWUSI-EAS1795_0092:3:1:13320:1640#0/1
CGGATCAGTTCAAAGGCTTCTGCTACGTCGAAT
+HWUSI-EAS1795_0092:3:1:13320:1640#0/1
ffd^eecffddfgfggfggggggc^ffffffff
@HWUSI-EAS1795_0092:3:1:13727:1644#0/1
GGGGTCTTGAAGTAATCAACCAGAAGCATTGAG
+HWUSI-EAS1795_0092:3:1:13727:1644#0/1
ggff]fffffffcafdffaffaafcdaffaf_f
@HWUSI-EAS1795_0092:3:1:13843:1638#0/1
CGTCGCGGCATCCGTGTTGGGTACGTTCAAGTA
+HWUSI-EAS1795_0092:3:1:13843:1638#0/1
hhhhhhhhhhhhhhhghhghhehhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:14286:1642#0/1
GCAGCAATGCGGATTGTCGCTCGAATGCTGGCG
+HWUSI-EAS1795_0092:3:1:14286:1642#0/1
ghfhhhhhhfhhgehdhhfhhhghhfdchffeh
@HWUSI-EAS1795_0092:3:1:15263:1641#0/1
GTAGCCCGGAGTTCGATAACTACGTTACTCTAT
+HWUSI-EAS1795_0092:3:1:15263:1641#0/1
agggggggfggggg\dacffcdfcaefcffffg
@HWUSI-EAS1795_0092:3:1:15691:1641#0/1
GTGCTTTTGGGTTTGAGAGCAGCATCAAATCAT
+HWUSI-EAS1795_0092:3:1:15691:1641#0/1
hhhhhghhhhhhhhggghhhhhghhhhhhhffh
@HWUSI-EAS1795_0092:3:1:15765:1643#0/1
CAACAACGTCGACTTCATGGATGCCGAGGCTCT
+HWUSI-EAS1795_0092:3:1:15765:1643#0/1
hhhhhhhhhhhfhhhhdhhhhhhhfghhdhgfh
@HWUSI-EAS1795_0092:3:1:16726:1638#0/1
AACGAATCGAGCAATCAGCAAACCCAGAACTAA
+HWUSI-EAS1795_0092:3:1:16726:1638#0/1
hhhhhhghhhhhhhhhfghhhhggghhhghhhh
@HWUSI-EAS1795_0092:3:1:16907:1641#0/1
TGCTGGTAATGTTGAGTTGCAACGCGGATTAAG
+HWUSI-EAS1795_0092:3:1:16907:1641#0/1
gcffffffffffggagcfcffffgggcgggggg
@HWUSI-EAS1795_0092:3:1:17074:1635#0/1
GCCTCGGTGGTCAGTGGGTACTTGATGATGTTG
+HWUSI-EAS1795_0092:3:1:17074:1635#0/1
hhhfhhfgfehhhhhhhhghghhhhghghghhh
@HWUSI-EAS1795_0092:3:1:17746:1636#0/1
GCCAGCACGCCAGTATCGCACCAAAAGGTCTCC
+HWUSI-EAS1795_0092:3:1:17746:1636#0/1
g_gggggaffffcafffccfffgggfc_eaafg
@HWUSI-EAS1795_0092:3:1:18237:1644#0/1
GCATGTGCCAACAGTTGCTCCAGTCGAGCCTCA
+HWUSI-EAS1795_0092:3:1:18237:1644#0/1
gdfffffdfffffggdgggggfcdf]fafffd]
@HWUSI-EAS1795_0092:3:1:18382:1646#0/1
CCAATACGTTCATACGCACCATGGCTGGATTTG
+HWUSI-EAS1795_0092:3:1:18382:1646#0/1
hhhhhhhhhhhhghhhhgghhhffh_hcghhfc
@HWUSI-EAS1795_0092:3:1:18868:1640#0/1
CGCTGCTCGTGTTGCGCAAGATGGCCGAGGCCA
+HWUSI-EAS1795_0092:3:1:18868:1640#0/1
hhhhhhhhhhhhhhhghhgchgghhhghhhhfd
@HWUSI-EAS1795_0092:3:1:18893:1641#0/1
GCCCTCCTTATCCTGGATCTTAGCCTTGACATT
+HWUSI-EAS1795_0092:3:1:18893:1641#0/1
hghhhhhhhghhhghhhhhhghhhhhghhhdhg
@HWUSI-EAS1795_0092:3:1:19189:1636#0/1
CACTACCTGGGCGAGTTCGCCCTGACCTACAAG
+HWUSI-EAS1795_0092:3:1:19189:1636#0/1
hhhhhhhhhhghghfhhhghhhfhhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:19340:1638#0/1
CGTCCTTCCACGTTATCATTGCAAGGACACTGA
+HWUSI-EAS1795_0092:3:1:19340:1638#0/1
ebdffffgggggggggggggdgffggggggggg
@HWUSI-EAS1795_0092:3:1:1971:1648#0/1
GTGCACTATCAGCTGGTGTTCTCTTTTTATCGT
+HWUSI-EAS1795_0092:3:1:1971:1648#0/1
c[fffff^ac[ddffdfddd]\N\\\U_V__cc
@HWUSI-EAS1795_0092:3:1:3009:1658#0/1
GTCGAACCAGAGCAGCGGATCTCAAAACGCCGC
+HWUSI-EAS1795_0092:3:1:3009:1658#0/1
gggggggggdgfgaggggggdaggggggfggga
@HWUSI-EAS1795_0092:3:1:3653:1653#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:3653:1653#0/1
hhgdfhghhghhhfghfggghheghhhhhhhgh
@HWUSI-EAS1795_0092:3:1:6208:1649#0/1
CTGGTATCCAAATCGCTGGCCGTCACCGATGCC
+HWUSI-EAS1795_0092:3:1:6208:1649#0/1
\]baVYac\aacd^ccWdacdaYQa^BBBBBBB
@HWUSI-EAS1795_0092:3:1:7086:1654#0/1
TGGCGTTGGGGCCGCGACGACGGCCGAAGCCCT
+HWUSI-EAS1795_0092:3:1:7086:1654#0/1
gdggggggdgcggffdga]ffacafaac`cfcd
@HWUSI-EAS1795_0092:3:1:7301:1648#0/1
GTGCTCTTCATTTCTGCCCGTAACAATGTTGAT
+HWUSI-EAS1795_0092:3:1:7301:1648#0/1
ffffffffffffffffWff_aW_VW_BBBBBBB
@HWUSI-EAS1795_0092:3:1:7479:1647#0/1
TCGCTCAGATAGTCGACAACCTCTTCGTTTATC
+HWUSI-EAS1795_0092:3:1:7479:1647#0/1
ggggggggggggggggggggggggdgdgggggg
@HWUSI-EAS1795_0092:3:1:7736:1651#0/1
AAGGTTGTCAAGGTCGCCAACGTCTCCCTGTTG
+HWUSI-EAS1795_0092:3:1:7736:1651#0/1
hhhhhhhhhhhghhhghhhhhhhhchhghghfh
@HWUSI-EAS1795_0092:3:1:7880:1657#0/1
AGCAGATCCTGACTCCCACCGAAGTTGAGCAAC
+HWUSI-EAS1795_0092:3:1:7880:1657#0/1
hhhhhghhhhhhhghhhfhhhghhhfhhhhhhg
@HWUSI-EAS1795_0092:3:1:8682:1653#0/1
CCTGGCTGGCGCATTTGCATCCGCTTCCGCATG
+HWUSI-EAS1795_0092:3:1:8682:1653#0/1
hhhfhhhhhhhggghhfhhhghhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:8717:1649#0/1
GTTCGGAAAACCACTTACTCCATTGCCTTAGAA
+HWUSI-EAS1795_0092:3:1:8717:1649#0/1
hhhhhhhhhhhghhhhhhghhhhhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:9719:1654#0/1
GGTCGCTGCCATCTTCATTCTTCTCATCGCGAC
+HWUSI-EAS1795_0092:3:1:9719:1654#0/1
gggggggfggggdcfffffgfdggggddggggg
@HWUSI-EAS1795_0092:3:1:10232:1648#0/1
CTGGTTGTTCTGGTTGCGGTTGTAGCCACGGTC
+HWUSI-EAS1795_0092:3:1:10232:1648#0/1
ggggggfgggggggfgcfdfffgdgggggdggg
@HWUSI-EAS1795_0092:3:1:10336:1651#0/1
ACGGTATCTTTGAGGTCAAGTCCACGGCCGGAG
+HWUSI-EAS1795_0092:3:1:10336:1651#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:10358:1652#0/1
ACAAGCTGGACTCGGAGCTGGAGCTGCTGCGCC
+HWUSI-EAS1795_0092:3:1:10358:1652#0/1
hghhhhhhghhhhhhhghhgh^hhhafhhhhhh
@HWUSI-EAS1795_0092:3:1:10811:1652#0/1
TGCGAACTTGGTTTCTCTAGAAGAAGAAGCCGA
+HWUSI-EAS1795_0092:3:1:10811:1652#0/1
hhhhhhhhhhhghhhhhghhfhgghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:11017:1655#0/1
CTACGTTCGACGATCAAAGATGGTGAAACTAAT
+HWUSI-EAS1795_0092:3:1:11017:1655#0/1
ffccdffcddddf[_caY\VS\a]ba`d_adaf
@HWUSI-EAS1795_0092:3:1:11613:1655#0/1
CCAAGAAGCACTTATGACTCGTGGCACAAGCCA
+HWUSI-EAS1795_0092:3:1:11613:1655#0/1
hhhhghhhhhhhhhhdhhfhgdaffc`ffdffc
@HWUSI-EAS1795_0092:3:1:11948:1652#0/1
CCGCTCCTTGGCTTCGCGCTGCTGGGCAGCCTG
+HWUSI-EAS1795_0092:3:1:11948:1652#0/1
gggggggggggggggggaf_ffggeggggggcg
@HWUSI-EAS1795_0092:3:1:12446:1654#0/1
GCGAGCATAGGCGATCTGTACTGTGATGTCCTT
+HWUSI-EAS1795_0092:3:1:12446:1654#0/1
ghhhhhhhghghhhhffhhghhfhaegfhhchg
@HWUSI-EAS1795_0092:3:1:12812:1647#0/1
CAAAGGCGAAGGCGAAGGCAACGGCAAAACGAA
+HWUSI-EAS1795_0092:3:1:12812:1647#0/1
ggfggcgggcdgegggfaacccggggfgccfgc
@HWUSI-EAS1795_0092:3:1:12888:1655#0/1
GAAAACCGCAAGAATATGAGAGTCAAGTTTTTG
+HWUSI-EAS1795_0092:3:1:12888:1655#0/1
hhhhhhhhghhhhhhhhhhgghhhhhhhhfhgg
@HWUSI-EAS1795_0092:3:1:13202:1649#0/1
GCCTCATCGACGTATTTCTGGTAGAAGGCAACG
+HWUSI-EAS1795_0092:3:1:13202:1649#0/1
hhhhhhhhhhhhhhhhhhhhgghhhhhehhhgh
@HWUSI-EAS1795_0092:3:1:13478:1655#0/1
GCCTCCGACATTTTCGAGAGCATTTTCAAGGGC
+HWUSI-EAS1795_0092:3:1:13478:1655#0/1
hhhhhhhghgghhhghhhhfgfhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:13702:1656#0/1
GGGAAAAGTCAGGGACAAGCTGAACAACCAGGT
+HWUSI-EAS1795_0092:3:1:13702:1656#0/1
cc^SYabWX\\\\U_\_a\b\^aaZaa_BBBBB
@HWUSI-EAS1795_0092:3:1:13879:1652#0/1
GAACGACATCAGGCACATCCTATTCCAGCTCGA
+HWUSI-EAS1795_0092:3:1:13879:1652#0/1
fffgggggggeggggggggggfgggaggfgggg
@HWUSI-EAS1795_0092:3:1:14061:1655#0/1
AAGGGAGCGGCCATTATGTCCGTGCTCGAGAGC
+HWUSI-EAS1795_0092:3:1:14061:1655#0/1
fRfffffhhhhhgghghhghhhahg_hgegggd
@HWUSI-EAS1795_0092:3:1:14475:1647#0/1
ATTTGTTGCAACAAGTACTTGGTGAAGTACTGC
+HWUSI-EAS1795_0092:3:1:14475:1647#0/1
ghhhhhhhhhhhhghhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15016:1650#0/1
CAGGCGACGGGCTCTTCCCCCACGCCCTGGAGT
+HWUSI-EAS1795_0092:3:1:15016:1650#0/1
ggggggggggg_dedffggggcccfeeWac[a_
@HWUSI-EAS1795_0092:3:1:15605:1654#0/1
GCAACTGTGGCACTGGAGGATTGCGCATGTTTG
+HWUSI-EAS1795_0092:3:1:15605:1654#0/1
gdgggggfcfda^cdc^ff_ffafffacffffW
@HWUSI-EAS1795_0092:3:1:15714:1653#0/1
CGAGAAGCGTGGCAAGCGGCAGGTGCTGCTGCG
+HWUSI-EAS1795_0092:3:1:15714:1653#0/1
cac[ddcS\^\\fafac]dRb`BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:15737:1647#0/1
TGTGCTTGTTGGGCGACTTGGACAGACACATCT
+HWUSI-EAS1795_0092:3:1:15737:1647#0/1
hhegghhhhehhhghhhhhhhchhhhhhhhghf
@HWUSI-EAS1795_0092:3:1:15990:1651#0/1
CGCCGCCAAAGTACAGCTCGATATCGGAGCGGG
+HWUSI-EAS1795_0092:3:1:15990:1651#0/1
hhghffhhhhghhhhghchhhhchhhc_fhghf
@HWUSI-EAS1795_0092:3:1:16340:1658#0/1
CTCCGTCCAGTCTTCCTCGTTGAAGCTGCACAT
+HWUSI-EAS1795_0092:3:1:16340:1658#0/1
gggggggggggggggfggdgggagggggggggg
@HWUSI-EAS1795_0092:3:1:16392:1655#0/1
TTGCCATTGGTAGCGTCCGCGATGCTCACGCAG
+HWUSI-EAS1795_0092:3:1:16392:1655#0/1
hhhhahhhhhhhhhfffhgfhf[hhhh_hfdff
@HWUSI-EAS1795_0092:3:1:16703:1648#0/1
TCGGCATTCAGGACCAGCACAAAGACATCGGCG
+HWUSI-EAS1795_0092:3:1:16703:1648#0/1
hhhhhhhhhhhhhhhhghhhfhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:16848:1651#0/1
TACGCCATCAAGAAGAAGGATGAGTTGGAGCGT
+HWUSI-EAS1795_0092:3:1:16848:1651#0/1
hghhhhhhhhhhhfhgghehhhhhhhhfghhgf
@HWUSI-EAS1795_0092:3:1:16988:1654#0/1
TGCTGTTTCACTTTCCCTACTCTCATTCGGGTT
+HWUSI-EAS1795_0092:3:1:16988:1654#0/1
afcdf]fdb[ddffdffc[fdfff[fffffafa
@HWUSI-EAS1795_0092:3:1:17155:1650#0/1
GGACGACATTAAGCGAGCGATTGAAGCCGTGTG
+HWUSI-EAS1795_0092:3:1:17155:1650#0/1
hhhhhhhhhhhhhgghfhhhhhffchhhhhhhg
@HWUSI-EAS1795_0092:3:1:17225:1651#0/1
GCCTGCTGCCTTCCTTAGATGTGGTAGCCGTTT
+HWUSI-EAS1795_0092:3:1:17225:1651#0/1
hhhhhhhhhhhhhhhhgfhhfhehhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18040:1648#0/1
GTGCTGGAATCAGCAGACCTTCATTGAGAGTTG
+HWUSI-EAS1795_0092:3:1:18040:1648#0/1
gfgggggggggggggggggggggggggafggeg
@HWUSI-EAS1795_0092:3:1:19152:1648#0/1
TTCACGGATGCCCAGCTGCAGTCCAACCAGATC
+HWUSI-EAS1795_0092:3:1:19152:1648#0/1
hhhhhhffhhhhhhaghfhhhehhhhhfhchfh
@HWUSI-EAS1795_0092:3:1:2459:1663#0/1
CGGTAAGCTTGTACCTCAGCGACTCAGCCTGGG
+HWUSI-EAS1795_0092:3:1:2459:1663#0/1
gffdfdfcfdfdcfcfcfcfffgeggcgggffg
@HWUSI-EAS1795_0092:3:1:2699:1670#0/1
CGGTGTTGCGCTGCACGAGAGACAGGCGGGACT
+HWUSI-EAS1795_0092:3:1:2699:1670#0/1
d__XWZ```ab^dc^fbfc^ffcSfffffc]RR
@HWUSI-EAS1795_0092:3:1:2897:1665#0/1
GCCTTCTTCTGGGCACGAGCCACGTACAGGGAC
+HWUSI-EAS1795_0092:3:1:2897:1665#0/1
c_ccc^ccccYL]W__Zcccc_YZa^a_cP_c^
@HWUSI-EAS1795_0092:3:1:3507:1668#0/1
CTGCTCTCGGCCAGCTGCATGAAGGTCAGCAGA
+HWUSI-EAS1795_0092:3:1:3507:1668#0/1
ggggggggddfgfggcggggfggggfgcfcggg
@HWUSI-EAS1795_0092:3:1:3549:1665#0/1
CCAGGGTCTTCTTGTGCACGATGCCGCTGTAGC
+HWUSI-EAS1795_0092:3:1:3549:1665#0/1
acfddfcffffffcffaffff]cfff_]`\d`d
@HWUSI-EAS1795_0092:3:1:3609:1659#0/1
AACACAACACCAACACTCGCCACAGCAGCAACA
+HWUSI-EAS1795_0092:3:1:3609:1659#0/1
_hhhhhfhghhhhefghhghhaffcffefeahh
@HWUSI-EAS1795_0092:3:1:4030:1660#0/1
GTGAGCCCGGACTTGATGGGTTCCAGGGCGAGG
+HWUSI-EAS1795_0092:3:1:4030:1660#0/1
gcggggdggggggggggggfggffffffaf_fd
@HWUSI-EAS1795_0092:3:1:4973:1659#0/1
GGGCAATGACATCGCGACCCCTCACACAGGGAA
+HWUSI-EAS1795_0092:3:1:4973:1659#0/1
hhhghhhff\fffdeffhhhhdhhhhhchhhfg
@HWUSI-EAS1795_0092:3:1:5450:1665#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5450:1665#0/1
fhdhhhhgghghghcehhhhhhgghfhhhahhf
@HWUSI-EAS1795_0092:3:1:6494:1660#0/1
TGAAGATTAAGACGATCAAAATACCACGCAGCG
+HWUSI-EAS1795_0092:3:1:6494:1660#0/1
hhhhhhhhhhghhhhhhhhhhhghhhhhghfhh
@HWUSI-EAS1795_0092:3:1:7707:1659#0/1
GGCGTGGCTAACTGGATAACCGCCATTGCTGTG
+HWUSI-EAS1795_0092:3:1:7707:1659#0/1
hhhhhhhhhhhhhhhhehhhhghhhhdhhghgh
@HWUSI-EAS1795_0092:3:1:7778:1667#0/1
CCCTCGCAGCCCTTTCCCAGCACCTCATTTGTG
+HWUSI-EAS1795_0092:3:1:7778:1667#0/1
fhhhhhdhhghghhhhhhhghhhheghhhhegf
@HWUSI-EAS1795_0092:3:1:7861:1660#0/1
TTCGGAAAATTTTTATTTTTACTTTCCTTACTA
+HWUSI-EAS1795_0092:3:1:7861:1660#0/1
accee[a`\aabced__cc`cfdfcfdfffcfc
@HWUSI-EAS1795_0092:3:1:7929:1670#0/1
GTCCAAGTATTATTAATTTTATGAGCATTTAAC
+HWUSI-EAS1795_0092:3:1:7929:1670#0/1
ffffffd^fefdfffffggfacfffffgggggg
@HWUSI-EAS1795_0092:3:1:8061:1661#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8061:1661#0/1
hhhghhhhhfhhhfhhhhhhhhhchhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8471:1663#0/1
GTCGCGGTACTTCTTCAACAGGCGGCGCAGAAC
+HWUSI-EAS1795_0092:3:1:8471:1663#0/1
hhghhhhhhhghghhhhhhhhghhhgghcghhc
@HWUSI-EAS1795_0092:3:1:8653:1664#0/1
CGAATCCCTACAGCCTGGCATGGCAATCCAAGG
+HWUSI-EAS1795_0092:3:1:8653:1664#0/1
hhghfh[hhhfgfhhhhhegaghfhhghfhehh
@HWUSI-EAS1795_0092:3:1:8726:1670#0/1
CAACTACAAGATGAAAAGAGCGGAACCACCTGC
+HWUSI-EAS1795_0092:3:1:8726:1670#0/1
gggggggggggggggggffeffggggggggegf
@HWUSI-EAS1795_0092:3:1:9335:1659#0/1
GGAACACCAGCCTTCGAAAGGTTCAAGCTCTTG
+HWUSI-EAS1795_0092:3:1:9335:1659#0/1
hhhhghhhhhghhhhhhhhhhghhhgghhhhhh
@HWUSI-EAS1795_0092:3:1:9486:1669#0/1
GCGGGACCGACCGACCGCCCGCCTTGTTGGTGG
+HWUSI-EAS1795_0092:3:1:9486:1669#0/1
hhhhhhhhhhhhghhghhhgghhhgfhcfKafa
@HWUSI-EAS1795_0092:3:1:9823:1660#0/1
GTTTGCCGAAGCCTCCTTGCTGGGCGACTTCTT
+HWUSI-EAS1795_0092:3:1:9823:1660#0/1
ggggdggggggggfggggfffgggggggggggg
@HWUSI-EAS1795_0092:3:1:9870:1662#0/1
CCCCACACGTACATACACCTAGCATATGAAAGT
+HWUSI-EAS1795_0092:3:1:9870:1662#0/1
hhhhhhhhhhhhhgffghhghhhhfhhghhhhh
@HWUSI-EAS1795_0092:3:1:9959:1668#0/1
ACCTCATCCACCCATTTGATGCCCTTGACCATC
+HWUSI-EAS1795_0092:3:1:9959:1668#0/1
hhhhhhhhhhhhhhhhhhhchhhhhhehhhfhh
@HWUSI-EAS1795_0092:3:1:10061:1668#0/1
CGGAGGAGTCCATCTTGTTCACACCAACGATCA
+HWUSI-EAS1795_0092:3:1:10061:1668#0/1
hhhhhhhhhhhhhhhhghhhhhghghhhchhgh
@HWUSI-EAS1795_0092:3:1:10590:1661#0/1
GTGGGCCGGTACTATTACTTTGAACAAATTAGA
+HWUSI-EAS1795_0092:3:1:10590:1661#0/1
fffffffgggdggaegggggggegggggcfagg
@HWUSI-EAS1795_0092:3:1:11115:1669#0/1
CAACAACAACATCACCACCACCAACAACAACAC
+HWUSI-EAS1795_0092:3:1:11115:1669#0/1
ggggfggcffffgfeggggggfgggggfegggg
@HWUSI-EAS1795_0092:3:1:11730:1661#0/1
CTAGAAGAGCATGACATATACTGTTGTGTCGAT
+HWUSI-EAS1795_0092:3:1:11730:1661#0/1
hhhhhhgghhhhhghhghghchahhhhghhgfh
@HWUSI-EAS1795_0092:3:1:12170:1661#0/1
GCAGCACATTGGTTATGATGACTCCTCCAAGGG
+HWUSI-EAS1795_0092:3:1:12170:1661#0/1
fgf]fcdff]fabe[db^^WcaU^^\abdb`bg
@HWUSI-EAS1795_0092:3:1:12218:1662#0/1
CGATGAGTGCCTGCGCAAGTACGGATCGACGGC
+HWUSI-EAS1795_0092:3:1:12218:1662#0/1
MMSSSPW[cacBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14654:1669#0/1
CCTACCACGAGCAGCTGTCGGTGGCTGAGATCA
+HWUSI-EAS1795_0092:3:1:14654:1669#0/1
ffffffffffdfa`d``]`^`\cfffa`]d`bf
@HWUSI-EAS1795_0092:3:1:15048:1659#0/1
CGCCGGGCTGCTGCTGCACCACGCGCGACTTCT
+HWUSI-EAS1795_0092:3:1:15048:1659#0/1
ffgggffggggggggggfgfagfff_cdgggad
@HWUSI-EAS1795_0092:3:1:15433:1669#0/1
GCTCGACACGTTGCGTGGAATTGCAGAATATGA
+HWUSI-EAS1795_0092:3:1:15433:1669#0/1
hhhhhhhhhhhhhhhhhhgghghhghhhhghhh
@HWUSI-EAS1795_0092:3:1:17277:1669#0/1
GCCGGCCTGGTGCTGGAATGCCATTTTCGCCAT
+HWUSI-EAS1795_0092:3:1:17277:1669#0/1
fdfffafZ`ZYb_a^^a[d`cddffcac]cdd]
@HWUSI-EAS1795_0092:3:1:17572:1664#0/1
GTTTGGATGTTCTTCAAGCGCGATCCGCGCAGA
+HWUSI-EAS1795_0092:3:1:17572:1664#0/1
fhhhhhhdhhhhhhhhggfccg_hhhhhhhghg
@HWUSI-EAS1795_0092:3:1:18051:1662#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:18051:1662#0/1
ggfcfefc]c]db[cdd`bb`b[cfffdbafeg
@HWUSI-EAS1795_0092:3:1:18117:1663#0/1
AGATATATCCATCGATTTGAGAACTTCAGCAAG
+HWUSI-EAS1795_0092:3:1:18117:1663#0/1
_df_fffffcfdffffffggcffgggcggggeg
@HWUSI-EAS1795_0092:3:1:18272:1660#0/1
GAAATATTTGTGTATTTTTGTTGGTCTGCGTTG
+HWUSI-EAS1795_0092:3:1:18272:1660#0/1
c_ffcffggggggggggggeggccgggggggfg
@HWUSI-EAS1795_0092:3:1:18466:1661#0/1
CCTTGCCGTACTTCTGGCGCTCCAGGTACTTCT
+HWUSI-EAS1795_0092:3:1:18466:1661#0/1
f_a^Oaa`^aa`dc_^dZP]KY_\XVXda^^dc
@HWUSI-EAS1795_0092:3:1:18526:1668#0/1
CAGAAGGGCAAGCCCGTTGTCCGTTTGACCGGC
+HWUSI-EAS1795_0092:3:1:18526:1668#0/1
hhhhhhggghhghhhhhhhhhhhhhgghhhaeh
@HWUSI-EAS1795_0092:3:1:18550:1670#0/1
AAGTCAAGTTCCGAAGGCGTCGCGAAGGAAAGA
+HWUSI-EAS1795_0092:3:1:18550:1670#0/1
hhhhhhhhgfhhhhhhhhhghddhhhhchchgh
@HWUSI-EAS1795_0092:3:1:18932:1664#0/1
CTGCGGTTGCCCGTTGCAGTGGCTCAGGCTAAG
+HWUSI-EAS1795_0092:3:1:18932:1664#0/1
hhghhhhhhhhhgghhhhghhhhghfhghfhhf
@HWUSI-EAS1795_0092:3:1:18983:1659#0/1
GGGAAAATGCAAATAGTTGTTTGTTTTGTTGTA
+HWUSI-EAS1795_0092:3:1:18983:1659#0/1
hehghhhhhhhhhehhhffhhcfhhfhhhhhhc
@HWUSI-EAS1795_0092:3:1:19550:1669#0/1
TCTTGATCTTGAATTTCTATAATTTTATTATCT
+HWUSI-EAS1795_0092:3:1:19550:1669#0/1
hhhhhfhfhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19775:1662#0/1
GGCAAAAATAATATTCGCCTGTTTAACAAAAAC
+HWUSI-EAS1795_0092:3:1:19775:1662#0/1
hhhhhhhhhhhhhhghhhhhghhhhghhhgheg
@HWUSI-EAS1795_0092:3:1:3157:1670#0/1
CTCGTCACCTTCGCCTTCGCCCTCGCCCTCAGC
+HWUSI-EAS1795_0092:3:1:3157:1670#0/1
gggggggggggggfgggf_fffdf_ffggefag
@HWUSI-EAS1795_0092:3:1:3427:1671#0/1
CGCCCCGCCGCCAACACCAAGCTTGGCTCCGGC
+HWUSI-EAS1795_0092:3:1:3427:1671#0/1
gegegecge`ffggee]fad`aR^`^dbdd]bd
@HWUSI-EAS1795_0092:3:1:3637:1673#0/1
GAGAGTGCTACCTCTTTCGAGCACAACATGGCC
+HWUSI-EAS1795_0092:3:1:3637:1673#0/1
hhhhhghhhhhhgghhhhghhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:3701:1678#0/1
CCGAACTTTCGTTAGGTTTCTCCAGCTCAGTCT
+HWUSI-EAS1795_0092:3:1:3701:1678#0/1
hhhghhhhhhhhhhghhhhhghhhhhfhhdfhd
@HWUSI-EAS1795_0092:3:1:3770:1671#0/1
GTTTATTATAATATAAAAGTGTGTCAGCTCTAC
+HWUSI-EAS1795_0092:3:1:3770:1671#0/1
ggggggggggggggegggcggdcffffgfgggg
@HWUSI-EAS1795_0092:3:1:4389:1679#0/1
GCTTCAACATCTACGATGTGACACTTCACGCTG
+HWUSI-EAS1795_0092:3:1:4389:1679#0/1
b[ddfdf]f]fcbaa`bffff]a`bbacfccWc
@HWUSI-EAS1795_0092:3:1:4719:1672#0/1
CCGCCTTGATCAGATCGTCACGGAAGTAATCCT
+HWUSI-EAS1795_0092:3:1:4719:1672#0/1
gggggggdffffgggg]gggggggggefcfffg
@HWUSI-EAS1795_0092:3:1:4824:1676#0/1
TTGTCGATGTTCATGTGTCCTGCAGTTCACACG
+HWUSI-EAS1795_0092:3:1:4824:1676#0/1
ggggggfg_gggggegggggggggggdgggggg
@HWUSI-EAS1795_0092:3:1:4861:1675#0/1
CGCAGACGTGAAATGTCAATGACAACGCTAGCC
+HWUSI-EAS1795_0092:3:1:4861:1675#0/1
ggggggfggggggcgggggdgggggeeaffff_
@HWUSI-EAS1795_0092:3:1:4921:1676#0/1
TAGACCTCGGTTTGGTATCGTCAATGAAATACC
+HWUSI-EAS1795_0092:3:1:4921:1676#0/1
hhhhhhhghhhhhfhhhhhhhhhghhhghhhhf
@HWUSI-EAS1795_0092:3:1:4980:1676#0/1
TCAGCGTGCCAAGTCGATGAAATTCGTCGATGG
+HWUSI-EAS1795_0092:3:1:4980:1676#0/1
ggfaacffdffffcfffdffdcd`eb`]db]d`
@HWUSI-EAS1795_0092:3:1:5519:1675#0/1
TCCGCCTCGAATGGGATGCCGGTGACCAAGTTG
+HWUSI-EAS1795_0092:3:1:5519:1675#0/1
_caaaacBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5572:1678#0/1
CTGGTGTTGTAGCCATTGTGGGAGTGAGGCGTG
+HWUSI-EAS1795_0092:3:1:5572:1678#0/1
ggggafggggffggdgggdgfg_fcfadf]fdf
@HWUSI-EAS1795_0092:3:1:6440:1677#0/1
GAAGAAACCGCGCTTCGATGTCTCAAAGCTTCT
+HWUSI-EAS1795_0092:3:1:6440:1677#0/1
hhhhhhhhhfhfhhhhhhhhghfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6780:1681#0/1
GTAAATTTATTCCAAACTTTGCAGACATAGCCA
+HWUSI-EAS1795_0092:3:1:6780:1681#0/1
hhhhghhhhhhhhhhhhhhhhhhhhhhhghhfh
@HWUSI-EAS1795_0092:3:1:7227:1671#0/1
GCCTCCTTCTGATGGATCATCATGATATTTAGA
+HWUSI-EAS1795_0092:3:1:7227:1671#0/1
hghdfehgfhhhhghhhhghhhhheghghghhd
@HWUSI-EAS1795_0092:3:1:7283:1671#0/1
GGGCGATCGGAGAGCCAGTTGATCGAAGGTCAG
+HWUSI-EAS1795_0092:3:1:7283:1671#0/1
hhhghhhhhhhgghhhhghhhghghhfhhchcf
@HWUSI-EAS1795_0092:3:1:7304:1679#0/1
CCGGGGCACTTCACGTCCATGAAGTACGAGTTG
+HWUSI-EAS1795_0092:3:1:7304:1679#0/1
hhhhghhhhhhhhhhghhhhhhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8285:1679#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8285:1679#0/1
hhhhhdhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8709:1676#0/1
GGGATTCCTCAAGTAGGATGAGGGCGAACGATT
+HWUSI-EAS1795_0092:3:1:8709:1676#0/1
ffdcddfacaaaa^acc`dbWcdddda__c]_d
@HWUSI-EAS1795_0092:3:1:8831:1673#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8831:1673#0/1
hhhhhfhhhhfhhhghhhhghhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9197:1671#0/1
CGGGTGCTCATCGCGGAACAGTCCGTAGTCGCG
+HWUSI-EAS1795_0092:3:1:9197:1671#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:9386:1671#0/1
AGCTCAACAGCATGGGCAGTCAGTTGGTAATCG
+HWUSI-EAS1795_0092:3:1:9386:1671#0/1
hhhhhhhhhhhhhhghhfhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11132:1671#0/1
GTCAAGTTCCGAAGGCGTCGCGAAGGAAAGACC
+HWUSI-EAS1795_0092:3:1:11132:1671#0/1
ggggccg_gfgfgfdgfcfaffcffdff]fdfg
@HWUSI-EAS1795_0092:3:1:11199:1677#0/1
CGGGAACATAGTGTACAGCGTCGAGTAACCGAC
+HWUSI-EAS1795_0092:3:1:11199:1677#0/1
gfgggggggggeffffffffdffffefgggggg
@HWUSI-EAS1795_0092:3:1:11306:1679#0/1
CGAAGATTAGCTGAAGCACCAGTGAGGCGAAGA
+HWUSI-EAS1795_0092:3:1:11306:1679#0/1
hhhhghhghhhhhgghghhhhhfhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:11369:1675#0/1
GTTTTATTCAGACGATAAACAGTACTATCAATA
+HWUSI-EAS1795_0092:3:1:11369:1675#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:11414:1680#0/1
GCCAGCTGCCGACAAGAAGGGCTTCACCGCCGT
+HWUSI-EAS1795_0092:3:1:11414:1680#0/1
fffdfd]dfdfdfffcaced]c^aaddffffa^
@HWUSI-EAS1795_0092:3:1:11551:1680#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11551:1680#0/1
ab[c_]ffadfffffff]aadW[a^^ab^^dbf
@HWUSI-EAS1795_0092:3:1:12762:1680#0/1
CTTAAAGAAGGTTATAGTCTTCGGGGTGCAACG
+HWUSI-EAS1795_0092:3:1:12762:1680#0/1
cccca\caSPWQNZYYY\a\\accccS[Z]Yaa
@HWUSI-EAS1795_0092:3:1:12900:1677#0/1
GTTGTGGCAAAAGAGCCCAAGACTGGAAGGGAT
+HWUSI-EAS1795_0092:3:1:12900:1677#0/1
hhhgghhhhhhhhhhhhghdghgghhhdfffdd
@HWUSI-EAS1795_0092:3:1:13161:1672#0/1
GCTGGCCTCCATCACCTGCCACGCATGGAACAA
+HWUSI-EAS1795_0092:3:1:13161:1672#0/1
hhhhdhhhhhhhhhhhfghhfhghhhhehhghg
@HWUSI-EAS1795_0092:3:1:13256:1672#0/1
GTATCGTATTCCATGTTGTATGTACAAGGTTTC
+HWUSI-EAS1795_0092:3:1:13256:1672#0/1
ffaaffc\\^\[^acacdbdd]^cc_Wdd\aaf
@HWUSI-EAS1795_0092:3:1:14071:1671#0/1
CCACATTCCCAATCTCCGATCGAAGGATCGCCA
+HWUSI-EAS1795_0092:3:1:14071:1671#0/1
hhhhhhhhhhhhhhhhhhgghhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:14454:1678#0/1
GCCGAATGCAGCAGTACCAGTGGAGCGATATGA
+HWUSI-EAS1795_0092:3:1:14454:1678#0/1
hhhhhhhhhhhhghhghhhggghhhhhehhghh
@HWUSI-EAS1795_0092:3:1:15010:1679#0/1
TTCAGGGTGTAAATCCACCAGGTGTGGATAATA
+HWUSI-EAS1795_0092:3:1:15010:1679#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15230:1671#0/1
GGAACCAAGAAGGAGTTGGCCGCCGTCCGTACC
+HWUSI-EAS1795_0092:3:1:15230:1671#0/1
hghhdhhhgdffggdghghhhfhhhhhghgchg
@HWUSI-EAS1795_0092:3:1:15407:1670#0/1
CCTTCACTTCGCTTTCGATGTGGAGTGCCACCG
+HWUSI-EAS1795_0092:3:1:15407:1670#0/1
ggdfa]]dc[ca[eaed]adde^^]Z^cffffg
@HWUSI-EAS1795_0092:3:1:15967:1672#0/1
AAGAAGTTCAACCGCATCATCCTGAAGCGTTTG
+HWUSI-EAS1795_0092:3:1:15967:1672#0/1
hhfhhghhhhhhhhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16198:1672#0/1
TCCTGTCTTAGTTGCAGGCTTCGTCCTCCAAGA
+HWUSI-EAS1795_0092:3:1:16198:1672#0/1
ggggggggggdggfggfgdgggggggggggggc
@HWUSI-EAS1795_0092:3:1:16405:1674#0/1
CGCCGTCTGCGCACCCGTTTGTGGCCTGTAATT
+HWUSI-EAS1795_0092:3:1:16405:1674#0/1
hhhhhghghhhghhhhgfhhfehhhhgfgg]hh
@HWUSI-EAS1795_0092:3:1:16513:1673#0/1
CCAGCTTCTTAATCTGCTCCTTGACATCATCTG
+HWUSI-EAS1795_0092:3:1:16513:1673#0/1
hhhhhhhhhhhhhghhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16751:1672#0/1
GCGCTTCTCATAGGGAGCGTGGCCAACGACCTC
+HWUSI-EAS1795_0092:3:1:16751:1672#0/1
gdc^ffdfcfffacYfdcf_fffff_dY``b`g
@HWUSI-EAS1795_0092:3:1:17540:1678#0/1
TTTCCATGCATGTAGGATGCAGTCTTGCGCAGA
+HWUSI-EAS1795_0092:3:1:17540:1678#0/1
cfddf]fffff]cffc`ff]c]bddb`_^[^ae
@HWUSI-EAS1795_0092:3:1:17871:1675#0/1
GGATGTTCTTGTTTGCTATCAATCAATCAATCA
+HWUSI-EAS1795_0092:3:1:17871:1675#0/1
hhhhhhhhhhhhhhhghhhhhechhhhghgghh
@HWUSI-EAS1795_0092:3:1:18086:1672#0/1
GGGAATTCTAAACAGCGACAACAGGTGTGAGAG
+HWUSI-EAS1795_0092:3:1:18086:1672#0/1
hhhhhfhhhhhhhhhhhhhhfhcffbfbfcddf
@HWUSI-EAS1795_0092:3:1:18353:1670#0/1
GTCAAGAACAAGCAGTACTTTAAGAGGTACCAA
+HWUSI-EAS1795_0092:3:1:18353:1670#0/1
f`fcffffdfffcfdbfggfegggdgfcfffff
@HWUSI-EAS1795_0092:3:1:18405:1681#0/1
CGTCACCGCAACATGAGCGTCCACTGCTCCCCT
+HWUSI-EAS1795_0092:3:1:18405:1681#0/1
fffffffgggggfgffgcf`ffcfddfgggggb
@HWUSI-EAS1795_0092:3:1:19128:1678#0/1
CCATTTCGAAAAATGGGTTAATGGTTGTCAAAA
+HWUSI-EAS1795_0092:3:1:19128:1678#0/1
hhhhhhhhhhhhhghhhhhhhhgfhhhhghhgh
@HWUSI-EAS1795_0092:3:1:1764:1693#0/1
GGCGCGTCAGCTTCTGAAGAATGTACGCCATGC
+HWUSI-EAS1795_0092:3:1:1764:1693#0/1
ca``]_W_ecbbdfffdf[ffdcc_a`caWafW
@HWUSI-EAS1795_0092:3:1:2236:1686#0/1
GCGCTTACTTGGACCTTGCACGCATCTTTCTGC
+HWUSI-EAS1795_0092:3:1:2236:1686#0/1
ffhhhhhhghhghghhhahfhehhhfhhhhfgh
@HWUSI-EAS1795_0092:3:1:2262:1692#0/1
GCAGCCTTCTTCTACATTCACAATGATCTCGCC
+HWUSI-EAS1795_0092:3:1:2262:1692#0/1
ffggfggggggaadf[fggggdfQd[ffffffg
@HWUSI-EAS1795_0092:3:1:2320:1689#0/1
GTTCGCTGCTGCTGTTGCTGGTATTATTGAGTG
+HWUSI-EAS1795_0092:3:1:2320:1689#0/1
LRP\O\^Y^[[c_cc__BBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3277:1682#0/1
AACAGCAACACCACAAGATGCCAACAGTTACCA
+HWUSI-EAS1795_0092:3:1:3277:1682#0/1
cc_ffffggcgfggeggdddffc_fdfgggggg
@HWUSI-EAS1795_0092:3:1:3519:1688#0/1
TGATGTTGTTGTTGTTGTGGTGGTGTCTGTGGT
+HWUSI-EAS1795_0092:3:1:3519:1688#0/1
Z\SQTT_BBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3845:1686#0/1
AACTGCTGCGATACAGACCGCCGAGTTCGGTCA
+HWUSI-EAS1795_0092:3:1:3845:1686#0/1
cc\eeedd\fcdcceeafffa_caa^[fffafc
@HWUSI-EAS1795_0092:3:1:4215:1687#0/1
GTCGCCAACGTCTCCCTGTTGGCCCTCTACAAG
+HWUSI-EAS1795_0092:3:1:4215:1687#0/1
ghhghghhghhhhhhgg_hhhcfhcggh_gfda
@HWUSI-EAS1795_0092:3:1:4479:1683#0/1
ACCTGGTCACCGGCAGCCTGTCCAATGGCCTGC
+HWUSI-EAS1795_0092:3:1:4479:1683#0/1
caffa]f_dccffWfcafcc_deed``^[^^^e
@HWUSI-EAS1795_0092:3:1:4496:1692#0/1
GGATATTGTGAAAGCCTACAGTAATAATGAAAA
+HWUSI-EAS1795_0092:3:1:4496:1692#0/1
agggaggefgfgfffffggfgggfgefgfgdgg
@HWUSI-EAS1795_0092:3:1:4765:1688#0/1
GGGCAAACTTCTCCTTCACCGAGATGTAATCCT
+HWUSI-EAS1795_0092:3:1:4765:1688#0/1
hhehhhhhhhhhhhhhhhhhhhhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:4843:1690#0/1
GTCGCGTCTGCTCAAGTCTGAGGAGATCCGCAA
+HWUSI-EAS1795_0092:3:1:4843:1690#0/1
gggeggggffdcgggcgfafffgdgcggcfdge
@HWUSI-EAS1795_0092:3:1:4897:1686#0/1
AAGGGAGTGGGTGAGCCGCCCTGTTGCATGTGA
+HWUSI-EAS1795_0092:3:1:4897:1686#0/1
hhhghhhhhhhhhfhghhhghg_gghhgagccg
@HWUSI-EAS1795_0092:3:1:5038:1688#0/1
TAAATATGTATATGTGTGTAGAAGGTATGCATG
+HWUSI-EAS1795_0092:3:1:5038:1688#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghghgghh
@HWUSI-EAS1795_0092:3:1:5595:1686#0/1
AACAAGCACAATCGCGGCCATGTGAAGCCCGTG
+HWUSI-EAS1795_0092:3:1:5595:1686#0/1
ffegggggcgggggagggdgggdfffdafffeg
@HWUSI-EAS1795_0092:3:1:6089:1690#0/1
GAGGAGTAAGAACAAATAACAGCAAATATGTGA
+HWUSI-EAS1795_0092:3:1:6089:1690#0/1
Yadccedfacacffd`Ic\\^cdcd]]cac^de
@HWUSI-EAS1795_0092:3:1:6928:1689#0/1
TCGTCATCCGCAACATCGTGGAGGCTGCCGCGG
+HWUSI-EAS1795_0092:3:1:6928:1689#0/1
gggggfgggggggggfggegffeggefff]_fa
@HWUSI-EAS1795_0092:3:1:7249:1689#0/1
GGCGGAGTTATCATCGCTGTGGGACCCGTTCCT
+HWUSI-EAS1795_0092:3:1:7249:1689#0/1
gggggggggggggfgeggcgggggggggggggg
@HWUSI-EAS1795_0092:3:1:7824:1692#0/1
ATCGGGTTTTTCTGGGTTTTCCCCGTATCCTCG
+HWUSI-EAS1795_0092:3:1:7824:1692#0/1
hhhhghhhhhhhhchhghhehhhghhghhhghf
@HWUSI-EAS1795_0092:3:1:7924:1689#0/1
CGTGCATGTCCGTGAGTGTATTGTATTTGGAAC
+HWUSI-EAS1795_0092:3:1:7924:1689#0/1
hhhfhhhhhhhhhhgfhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8946:1691#0/1
ATTCAGGAGAAGTGCCAGACCCTCCTGACGCAG
+HWUSI-EAS1795_0092:3:1:8946:1691#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9290:1684#0/1
TGGGGCTGAACGGGATCCTCGTAGATGGAAACG
+HWUSI-EAS1795_0092:3:1:9290:1684#0/1
hhhhhhhhhhhhhhhhhhhhhhhhehhehhhhh
@HWUSI-EAS1795_0092:3:1:9417:1692#0/1
CATAAGTGTGTAAGACAGATTGATAGCTCTTTC
+HWUSI-EAS1795_0092:3:1:9417:1692#0/1
hhhhhhhhhhhhghhhhhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9696:1689#0/1
TCCTCGTCGTCCTCGTCCACCCAACATATCGAT
+HWUSI-EAS1795_0092:3:1:9696:1689#0/1
ggggggggggggaefffgfcgggf_gaggggg[
@HWUSI-EAS1795_0092:3:1:9719:1689#0/1
GCCTTCTTGTTGAAGAAGCGCGATGTGAAGAAG
+HWUSI-EAS1795_0092:3:1:9719:1689#0/1
_cfccfffaffaffa^c^c__caa[_Wfffffc
@HWUSI-EAS1795_0092:3:1:9746:1691#0/1
GTGGTTAAGCTTGATCCTCTCGACCTTGTCGCC
+HWUSI-EAS1795_0092:3:1:9746:1691#0/1
hhhhhhghhhhhhhchhhhchhhffgha`bRaf
@HWUSI-EAS1795_0092:3:1:9863:1684#0/1
ATTTCGATCTGGTGGAAACCCTTTGCCAAGTCT
+HWUSI-EAS1795_0092:3:1:9863:1684#0/1
hfhhhhfhhhhgghhfhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10095:1689#0/1
GCGAAATTGCAGTCGCAGCAGCAATCGCAGCCG
+HWUSI-EAS1795_0092:3:1:10095:1689#0/1
gggcgggcfafafdfff_dfaffafffc]aaff
@HWUSI-EAS1795_0092:3:1:10149:1691#0/1
GCTTCAGCTCCGGCGTACACTCGCTGTGCTCCG
+HWUSI-EAS1795_0092:3:1:10149:1691#0/1
ff_caffaffcffdg_dfffdfab[b`cfcfff
@HWUSI-EAS1795_0092:3:1:11019:1688#0/1
AAGCACGTCCTCCACAGGCTCCACCTCCAATAG
+HWUSI-EAS1795_0092:3:1:11019:1688#0/1
hhhhhghhhhhhhhhhhhhfhhghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11856:1690#0/1
GCCAAATAGTCAATGAAGGTGAGCTCCGGACCC
+HWUSI-EAS1795_0092:3:1:11856:1690#0/1
gggggggggggfgfggggg_gcdfdfffggggg
@HWUSI-EAS1795_0092:3:1:12018:1683#0/1
GAAATACGATGGTATCATCTTGAACACCAAGAA
+HWUSI-EAS1795_0092:3:1:12018:1683#0/1
gffggggggdgcgggggggggdcgggggggfgg
@HWUSI-EAS1795_0092:3:1:12114:1693#0/1
CCCAGAATGCACACCACCCACATTTGATAGTTA
+HWUSI-EAS1795_0092:3:1:12114:1693#0/1
hhhhhhhhhhhhhhhghhhghfhhhhgheghhh
@HWUSI-EAS1795_0092:3:1:12131:1691#0/1
GTCCGCGCGTCAAGGCGATCTCCCCGTTGGCCA
+HWUSI-EAS1795_0092:3:1:12131:1691#0/1
gggdggacfccce\\dWQVZVYbd]``dddbdg
@HWUSI-EAS1795_0092:3:1:12263:1689#0/1
CAGGGATTGGGAATGTAAGAAAAGCTGAATGTA
+HWUSI-EAS1795_0092:3:1:12263:1689#0/1
ghhhhhhhghhdhehhhhhhhhhhfhfhcghgh
@HWUSI-EAS1795_0092:3:1:12572:1689#0/1
TGGAGCGCCAGAAGTACGGCAAGGTCGAGCAGG
+HWUSI-EAS1795_0092:3:1:12572:1689#0/1
hhhhhhghhhhhhhfhhhhhegffbffehhhgg
@HWUSI-EAS1795_0092:3:1:12872:1691#0/1
CTCGGGTAGAAAACAGCTCCGCATAGTCCCAAT
+HWUSI-EAS1795_0092:3:1:12872:1691#0/1
XaYcYac\]a_aN[[[a\\WY\_WZ^\a\aaZT
@HWUSI-EAS1795_0092:3:1:13380:1686#0/1
AGATCGTACTAGACGTACAAGAGCAAGAAAGCA
+HWUSI-EAS1795_0092:3:1:13380:1686#0/1
ggggfggggfgggggggggggggggggggegfg
@HWUSI-EAS1795_0092:3:1:13491:1692#0/1
TTGTGCTTGATCTCGTCGTAGACATGCTCCTCT
+HWUSI-EAS1795_0092:3:1:13491:1692#0/1
egggggggggggfggggggf_ffggggggggfg
@HWUSI-EAS1795_0092:3:1:13572:1689#0/1
CCGAGGAGGAGGACACGGCCAAGCCAATGTCGT
+HWUSI-EAS1795_0092:3:1:13572:1689#0/1
hhhhhhhhhhhghdhahhcgfhehhhhggdggd
@HWUSI-EAS1795_0092:3:1:13937:1693#0/1
GTGGGATGAGAAAAATAAGGATAATAAGGGCGG
+HWUSI-EAS1795_0092:3:1:13937:1693#0/1
[\aaa^bffaffcc`c`W]```dadcdcccaa_
@HWUSI-EAS1795_0092:3:1:15681:1690#0/1
GACCATGGAGCTGATTGAGGAGCTCACCGAGGA
+HWUSI-EAS1795_0092:3:1:15681:1690#0/1
hhhhghhhhhhhhhgggghh_hhgahhhghheh
@HWUSI-EAS1795_0092:3:1:15914:1691#0/1
TGGTGATCCCAGGCAGTCTTGAGCTTCTCATCG
+HWUSI-EAS1795_0092:3:1:15914:1691#0/1
hghhhhhhhhhghhhhhhhhghhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:15938:1688#0/1
TCTTGGTCGGGTAGGAGGCCTTGCTCTTCTTCA
+HWUSI-EAS1795_0092:3:1:15938:1688#0/1
hhhhhhhhhhfffhhghhhhhfhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:16374:1685#0/1
CACGGGGCAATGCCAATGCAAGCCAGGATTTGG
+HWUSI-EAS1795_0092:3:1:16374:1685#0/1
ggdgggggggggfffffggggcggggegcgggg
@HWUSI-EAS1795_0092:3:1:16819:1683#0/1
TTTCGGAGTACAAGAACAGTCTATCTACGGCGG
+HWUSI-EAS1795_0092:3:1:16819:1683#0/1
hhhhhhhhhhhhghfhghhhhhhhhhhhgghhg
@HWUSI-EAS1795_0092:3:1:17005:1683#0/1
GACGGGTTTGAAACATATTCGGAGCTTTGACAT
+HWUSI-EAS1795_0092:3:1:17005:1683#0/1
hhhhhhhhhhghhhghhhhghhdhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17101:1684#0/1
GGGACATGGTGCTGTACAGAAGGGTTTGCCCTA
+HWUSI-EAS1795_0092:3:1:17101:1684#0/1
hghfhhfhhhhchhghfhhehhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17772:1693#0/1
AGCAACTACAATCGTATCTGGGATGCATATCTT
+HWUSI-EAS1795_0092:3:1:17772:1693#0/1
hhhhhhhhhhhhhhghfhhhhhhhhhghghhhg
@HWUSI-EAS1795_0092:3:1:18124:1685#0/1
GTCGCACTTTCGTTTCGGGGGTCACACGAAATT
+HWUSI-EAS1795_0092:3:1:18124:1685#0/1
ddfdfddcaacfffdc[_Z\\SYS^\[fffRf`
@HWUSI-EAS1795_0092:3:1:18651:1683#0/1
TGACGGAAGGGCACCACCAGGAGTGGAGCCCGC
+HWUSI-EAS1795_0092:3:1:18651:1683#0/1
c_cc_[YP]LWRccc^c^VaBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18897:1684#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:18897:1684#0/1
ZZQ]WY_cacYY\_cac^addd\cccafWff_d
@HWUSI-EAS1795_0092:3:1:19247:1687#0/1
CATTTACATCGTATTTTCCTGGTTTATTACAGT
+HWUSI-EAS1795_0092:3:1:19247:1687#0/1
hghfhhhfhhhehchfhfhfffghdfhcfff]c
@HWUSI-EAS1795_0092:3:1:2368:1703#0/1
CATAGCCAATGTCACCGCGTTCGCCCTTGGCGC
+HWUSI-EAS1795_0092:3:1:2368:1703#0/1
ffhhhhffffddffffdfcccfWddb_`\\eZ`
@HWUSI-EAS1795_0092:3:1:3329:1702#0/1
AAATGAGCGAAAATGCATATTCTGCCATTCCAC
+HWUSI-EAS1795_0092:3:1:3329:1702#0/1
hhhhhhhhhhhhhhhhhgfhhghhhhhhehhfh
@HWUSI-EAS1795_0092:3:1:3826:1696#0/1
CTTCCATGGACATCAATACGCAGGGTGGACACA
+HWUSI-EAS1795_0092:3:1:3826:1696#0/1
hhhhhhhggfhhhhhghhhhfchhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:3970:1704#0/1
CAGGCACGCCGTCAAGGAGTCGCCGTGGATACC
+HWUSI-EAS1795_0092:3:1:3970:1704#0/1
cccc_cc^_aW]]`bZbZT^ZVMHOSRc[cc_]
@HWUSI-EAS1795_0092:3:1:4100:1695#0/1
GGCTACGTTGCCGGTGACTCCAAGGCTAACCCC
+HWUSI-EAS1795_0092:3:1:4100:1695#0/1
gggggggggafggg[ggfffffgggcggcgggg
@HWUSI-EAS1795_0092:3:1:4956:1700#0/1
AACAAACCCAGAATGGCACCCAGGAAGGCTAAA
+HWUSI-EAS1795_0092:3:1:4956:1700#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:5365:1702#0/1
GGAACCTGCCCGGTCATGCCATGGGCCACCGCA
+HWUSI-EAS1795_0092:3:1:5365:1702#0/1
d\cdddcffffca]ab`Wddd[addddfffaff
@HWUSI-EAS1795_0092:3:1:5425:1702#0/1
CGCTGCCACCACTTGTGGTAGTGCTGATTCGGA
+HWUSI-EAS1795_0092:3:1:5425:1702#0/1
ggggcgggdfgagggggggggdffffagggefg
@HWUSI-EAS1795_0092:3:1:5564:1695#0/1
TTGCGATCCATCATGCCCCGCATGTACTCGTCA
+HWUSI-EAS1795_0092:3:1:5564:1695#0/1
fggegfafffd_gggggggeg`fccfdffdfdf
@HWUSI-EAS1795_0092:3:1:5614:1705#0/1
CGTCCTTTGCCTTGGCCCCCGCCAGCGAAGAGG
+HWUSI-EAS1795_0092:3:1:5614:1705#0/1
acacca]c_cccc_cccI]]WU^Pbaaaaaacc
@HWUSI-EAS1795_0092:3:1:6497:1702#0/1
ATTCGACATCTCGGCATCGGAAGGCAACCTGGA
+HWUSI-EAS1795_0092:3:1:6497:1702#0/1
fhhhhhhhhhhghhhhhhhhghhhghghhhhhg
@HWUSI-EAS1795_0092:3:1:6538:1696#0/1
GCCGGTGGGAACCAACTATACTCGGGTCATTCC
+HWUSI-EAS1795_0092:3:1:6538:1696#0/1
hhhhhghhhhhghfhhhhhhhghhhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:6794:1694#0/1
GGCCAGCGAACGAAACGGGACAGATCGCGCTTG
+HWUSI-EAS1795_0092:3:1:6794:1694#0/1
ggffgggfcfdffcfQf``c`f`b]]]`b^``c
@HWUSI-EAS1795_0092:3:1:6812:1704#0/1
GTTTACTAGGCTAGGGTCTCTACAGGCAGCGGG
+HWUSI-EAS1795_0092:3:1:6812:1704#0/1
hhhhhhhhhhhhhhhhhhghghhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:7317:1700#0/1
AAGGAAACAAAGCCTGTGCTGCTGGACATCTAA
+HWUSI-EAS1795_0092:3:1:7317:1700#0/1
ecggggggegggggcgefffdcdgggggggfge
@HWUSI-EAS1795_0092:3:1:8063:1697#0/1
GCGCTTGGCATAACGCAGCTTGAAGCGGTCAAA
+HWUSI-EAS1795_0092:3:1:8063:1697#0/1
hhhhfhghhhhhhhhhhhhhhfehhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8468:1701#0/1
CTACCATGGAAGTCTTTCGCAGAGAGATATGGT
+HWUSI-EAS1795_0092:3:1:8468:1701#0/1
hhhhhhghhhhhhhhhhhhhhfdfdfehhfhhg
@HWUSI-EAS1795_0092:3:1:8525:1701#0/1
CTTTGTGAAAACGAAACAAAAACCACACCTCAA
+HWUSI-EAS1795_0092:3:1:8525:1701#0/1
hhhhghffhhhhhhhhhghhhhhehhghffhhh
@HWUSI-EAS1795_0092:3:1:8788:1702#0/1
AGGAAGAGTCGTTGGCCAGGAATATACCAGGAA
+HWUSI-EAS1795_0092:3:1:8788:1702#0/1
hhhhghhhhhhhhhhhhhhhhgfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8904:1699#0/1
ACCATCACCCTCGAGGTAGAGCCATCGGACACC
+HWUSI-EAS1795_0092:3:1:8904:1699#0/1
hhhhhhhhhhhghhhhdhghghhghhhghhhhh
@HWUSI-EAS1795_0092:3:1:9028:1698#0/1
CCCAGCTTGAACACCTGCGTCTGCAGACGACGC
+HWUSI-EAS1795_0092:3:1:9028:1698#0/1
ffccffdffdfffff[]ad__bc]f`ffddafc
@HWUSI-EAS1795_0092:3:1:9223:1703#0/1
AAAAAATGAAAAACCAAGAACAAGCGATCAAGA
+HWUSI-EAS1795_0092:3:1:9223:1703#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:10230:1704#0/1
CGAAAAATTGATTCATCCACACGTTAAACGCCC
+HWUSI-EAS1795_0092:3:1:10230:1704#0/1
gegfcggfgcggggfgdcfgdgffggggggggc
@HWUSI-EAS1795_0092:3:1:11533:1694#0/1
CCGCGGAGTATGACTTGAAGAAGATAGTCCGCT
+HWUSI-EAS1795_0092:3:1:11533:1694#0/1
hhhhhhhhhhghghhhehhghhdhghfhhhhhh
@HWUSI-EAS1795_0092:3:1:11815:1697#0/1
CATGAACTTGGAATTCCCAGTAAGTGTGAGTCA
+HWUSI-EAS1795_0092:3:1:11815:1697#0/1
gggggggffggfgggfgegggcffffffafffa
@HWUSI-EAS1795_0092:3:1:11929:1694#0/1
TGCGGATAGCGCGGGTCTTCTTCTTGCGCAGAT
+HWUSI-EAS1795_0092:3:1:11929:1694#0/1
hhhhhhfhhggfhhhehhhghhfghgghhghhh
@HWUSI-EAS1795_0092:3:1:12032:1704#0/1
TGTGGCCATTCATATCAAATATAAAGTAGTGTT
+HWUSI-EAS1795_0092:3:1:12032:1704#0/1
`bfcadffcaad_^fffaed^efffffcff_fd
@HWUSI-EAS1795_0092:3:1:12433:1700#0/1
ATTTGTAGTAACAACATTACACTTGAGCACAAT
+HWUSI-EAS1795_0092:3:1:12433:1700#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:12933:1703#0/1
AATTACTTTAGGGCCACCATTTTAGGGCTACCC
+HWUSI-EAS1795_0092:3:1:12933:1703#0/1
gdgggeggggggfgggggcggggggfdggeggg
@HWUSI-EAS1795_0092:3:1:13066:1702#0/1
TCTGAGGCTTAGTCTTTAATCTCTCACTTCTTC
+HWUSI-EAS1795_0092:3:1:13066:1702#0/1
\\a[^a[^addcZYYYV_Z\Z_dccddccccdc
@HWUSI-EAS1795_0092:3:1:13110:1700#0/1
GCTGCTCCCTCGGCTGCCAAGCCAGCTGCCGCT
+HWUSI-EAS1795_0092:3:1:13110:1700#0/1
hhcghghghhhghhhgafffdffh_hedafdea
@HWUSI-EAS1795_0092:3:1:13137:1704#0/1
CAAACTTGCTGGTATCACCGATGCTAAATGTGT
+HWUSI-EAS1795_0092:3:1:13137:1704#0/1
hhhghhhghhhhhhhfhhhhhchhhhhhfhhhg
@HWUSI-EAS1795_0092:3:1:13200:1699#0/1
GCAAGGACGAGGCGAGTAGTGCTGGAAACGGTC
+HWUSI-EAS1795_0092:3:1:13200:1699#0/1
gegcgc]dd[ddcd[]ffcff]Wdbbdbcda`]
@HWUSI-EAS1795_0092:3:1:13650:1695#0/1
AGAGGCGGCCGAGTTCAATGTGTGGACCCGCGA
+HWUSI-EAS1795_0092:3:1:13650:1695#0/1
ffffffffdccR^S[YYaW^W^JXYSXcfQaaB
@HWUSI-EAS1795_0092:3:1:13837:1700#0/1
ACCCACTCCTTGGAGTCCTCCTTTCCACGTCCA
+HWUSI-EAS1795_0092:3:1:13837:1700#0/1
hggggghhhhgghgghhhhfhfghghhafeffh
@HWUSI-EAS1795_0092:3:1:14189:1695#0/1
TGATGATATCCTTGTAGATCTTCATGGTGATTG
+HWUSI-EAS1795_0092:3:1:14189:1695#0/1
hhhhfhghhhhhhfhhgahhhhhhhhhdhchgh
@HWUSI-EAS1795_0092:3:1:14391:1703#0/1
ACGGCTACAAGCTGCTCTATCTGTCAGCCCGTG
+HWUSI-EAS1795_0092:3:1:14391:1703#0/1
hhfffghfhhffdfhdhehgheehghghhhacd
@HWUSI-EAS1795_0092:3:1:15450:1701#0/1
GGGCTCGGCCATCACTGGACCGGTGGCCAAGGA
+HWUSI-EAS1795_0092:3:1:15450:1701#0/1
ggggggfgfggggadgggfggcffffdafdf_f
@HWUSI-EAS1795_0092:3:1:15773:1701#0/1
ATGAGAGTAAGAAAAGAAAGCGAGATGATCACC
+HWUSI-EAS1795_0092:3:1:15773:1701#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:16019:1698#0/1
GCCAGTGATCCGCCCAAGCCACTGCCCGGCTTG
+HWUSI-EAS1795_0092:3:1:16019:1698#0/1
gagffgfffffff_c`aacf_W__`]_X\TN\c
@HWUSI-EAS1795_0092:3:1:16046:1697#0/1
TTTTCAGATTTCGCCGAAACTTCCTTCTTTTCC
+HWUSI-EAS1795_0092:3:1:16046:1697#0/1
hhhhhhhhhhhhhhhhgb__eehhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16425:1701#0/1
CCGGGTCGCTTGTTGTGGTACAGCTTCGCGTAC
+HWUSI-EAS1795_0092:3:1:16425:1701#0/1
hhhhhhhhhhhhhhfhghhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:16629:1705#0/1
CGCTTGGTAAGATCGACATCGGCCTTCTTCAGC
+HWUSI-EAS1795_0092:3:1:16629:1705#0/1
fcccd^e]eeedffffccfff_fffffgggfgg
@HWUSI-EAS1795_0092:3:1:17067:1696#0/1
CCGGCGTCGACATCCGCGTGCGCGTTAGCGGTG
+HWUSI-EAS1795_0092:3:1:17067:1696#0/1
ggggggggggggggggegdagffdeeeggggdg
@HWUSI-EAS1795_0092:3:1:17280:1696#0/1
CATGTTTGTTGTTTGCTTTGCTGCTGCACGTTG
+HWUSI-EAS1795_0092:3:1:17280:1696#0/1
hghfhghffhhhhhhhehhefhffhghhgdhhh
@HWUSI-EAS1795_0092:3:1:17397:1697#0/1
ATGAGAATGGTTGTTTTCGCGGTGTGTTTTGTT
+HWUSI-EAS1795_0092:3:1:17397:1697#0/1
hghhhhhhhhhhhhhhhhhhhhehhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17455:1700#0/1
GGAGAAGAAGTAAACGGCGACTACACGCATTCA
+HWUSI-EAS1795_0092:3:1:17455:1700#0/1
hhhhhhhhhggghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17534:1705#0/1
TCCTCTTCTGTCATGGACACGAGAATCTGTTCA
+HWUSI-EAS1795_0092:3:1:17534:1705#0/1
gffcgggggcfgggcgggggegeggcgcggeeg
@HWUSI-EAS1795_0092:3:1:18026:1705#0/1
GAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAG
+HWUSI-EAS1795_0092:3:1:18026:1705#0/1
ffccffc[aa]^fe[affca[_Xbb``^\^^K`
@HWUSI-EAS1795_0092:3:1:18342:1700#0/1
CTGAGACACTCGATGCTGAGCAGTTAATTGGTT
+HWUSI-EAS1795_0092:3:1:18342:1700#0/1
hhghhghhhhhhhahggcfehdhhghhhhddhh
@HWUSI-EAS1795_0092:3:1:18419:1696#0/1
CACCAAACTACAGGAGGACAAGAACATTCCCGT
+HWUSI-EAS1795_0092:3:1:18419:1696#0/1
fa_fdYfbbcc[]^ZZVSaa^Vdb]b]]bddR^
@HWUSI-EAS1795_0092:3:1:18878:1694#0/1
CCGGGACGCAGTTCCAAAGCTGGCTGCAGGAGC
+HWUSI-EAS1795_0092:3:1:18878:1694#0/1
hhchhhhfhhdghhhhhhehgcefddfhhfefg
@HWUSI-EAS1795_0092:3:1:19315:1704#0/1
CGCAGCTGGACATCAAGAGCTTCATTACGAGCA
+HWUSI-EAS1795_0092:3:1:19315:1704#0/1
hhhhhhhhhhhghhhhhhhhhhhhhefghggeh
@HWUSI-EAS1795_0092:3:1:19512:1697#0/1
CACGGATGCAGGTATTCCTTGATGTACAAGTCA
+HWUSI-EAS1795_0092:3:1:19512:1697#0/1
facffcf[W`dddacfdfffffeddaffc_afb
@HWUSI-EAS1795_0092:3:1:19530:1697#0/1
ATCGGCCCCAAGAAGCCGCTGCCCGACAATGTG
+HWUSI-EAS1795_0092:3:1:19530:1697#0/1
c_ccccccccLc^b]baY_]cacaSaaBBBBBB
@HWUSI-EAS1795_0092:3:1:1154:1709#0/1
CAAATCGGCTTCACAGTGAAAAGTGCAAGCAAA
+HWUSI-EAS1795_0092:3:1:1154:1709#0/1
f_ddfceafffafScdReaabbe^dfcdcebc`
@HWUSI-EAS1795_0092:3:1:2064:1708#0/1
CCGGGTTGGGATCGTATATTGATTTTTCCGCTG
+HWUSI-EAS1795_0092:3:1:2064:1708#0/1
ccccc][_a\ZScaaccXcc_]ccacccccc_c
@HWUSI-EAS1795_0092:3:1:2882:1709#0/1
ATGTGACTGAGGCCCGTAAGATCTGGTGCTTCG
+HWUSI-EAS1795_0092:3:1:2882:1709#0/1
f_a^deeeceddfcffffffd]fff_cffcff]
@HWUSI-EAS1795_0092:3:1:3395:1713#0/1
CAAATTTTAAAATGGGTTTCGTTAAGGTAGTCA
+HWUSI-EAS1795_0092:3:1:3395:1713#0/1
hhhghhhhhhhhgfcehhhhhhhhdhhdfffff
@HWUSI-EAS1795_0092:3:1:3991:1707#0/1
TCGGTATATTTAAAATGCTTTTGGTTAGTTAAG
+HWUSI-EAS1795_0092:3:1:3991:1707#0/1
fhhheghhhhgcghehhghhhgghfhfhhhhfg
@HWUSI-EAS1795_0092:3:1:4529:1715#0/1
CTAAAATATCACAATTTTTTAAAGATAGAAACC
+HWUSI-EAS1795_0092:3:1:4529:1715#0/1
hhhhhhhhhhhhhhhhhhhhghghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:4714:1708#0/1
CGGGGGTCTGGAAGCGACCGTGACCCATCTTGG
+HWUSI-EAS1795_0092:3:1:4714:1708#0/1
faggfcggcgggfe[fcd[ebdggggacffdfg
@HWUSI-EAS1795_0092:3:1:4901:1709#0/1
CGGTCGGGTAGGAGGCCTTGCTCTTCTTCAGGA
+HWUSI-EAS1795_0092:3:1:4901:1709#0/1
hhhhhhhhghhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5744:1709#0/1
CGAGCTGCCACCGCTGCCAGCCTCCGTGTACGA
+HWUSI-EAS1795_0092:3:1:5744:1709#0/1
]\`cccc\\\SSb]b^aca\Xc\^bBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5787:1713#0/1
AACGATGATGATAATGATGATGGCGTGCAGGTG
+HWUSI-EAS1795_0092:3:1:5787:1713#0/1
hhhhfhhghhhghhghfghhhghghhhhehhhh
@HWUSI-EAS1795_0092:3:1:5993:1715#0/1
GTCGTCTTGCAGCAAACCCAATTTGTCTCGTAA
+HWUSI-EAS1795_0092:3:1:5993:1715#0/1
ffccffe_f^ffgggfgcdcd[\\YXWfacaff
@HWUSI-EAS1795_0092:3:1:6105:1706#0/1
TGCCAGTTGATTCTCTGAATTTTTGACAACCAT
+HWUSI-EAS1795_0092:3:1:6105:1706#0/1
hhghhhhhghhhhhhhghfhhhhhhfhhhhhgh
@HWUSI-EAS1795_0092:3:1:6235:1709#0/1
CAAGCCACCGTCAGGCGGCGAATAACAGCAGTA
+HWUSI-EAS1795_0092:3:1:6235:1709#0/1
hhhhhhhhhhhhhhhhhgghchghhfhghghfh
@HWUSI-EAS1795_0092:3:1:6418:1710#0/1
TTTTGAGTTATTTTCGCGAGTGCAGTGGGAATT
+HWUSI-EAS1795_0092:3:1:6418:1710#0/1
hhhhhgfhhhhhhhhgghhcheffhchghhghh
@HWUSI-EAS1795_0092:3:1:6533:1716#0/1
AGAAGAAGAAGTGGTCCAAGGGAAAAGTCAGGG
+HWUSI-EAS1795_0092:3:1:6533:1716#0/1
gfdafdfgfgfgggggfggggfgggffaffffc
@HWUSI-EAS1795_0092:3:1:7598:1712#0/1
TGAGCGTCTCCTGATCGTGCGGCCCACCAATCT
+HWUSI-EAS1795_0092:3:1:7598:1712#0/1
ddYfcff\cccc\W[cc^[WISa\^^WUUZSTV
@HWUSI-EAS1795_0092:3:1:7811:1717#0/1
TGTCAATGTTACATAGGCCTTTCTGACGGACAA
+HWUSI-EAS1795_0092:3:1:7811:1717#0/1
eccffffggfggffggadgfggdgecfgggggg
@HWUSI-EAS1795_0092:3:1:8928:1714#0/1
TCAAGATGTTCCAAGCGGACCGCCGAGATTTGC
+HWUSI-EAS1795_0092:3:1:8928:1714#0/1
^aeadceeda]fedcaeadbeecffcfdff[dc
@HWUSI-EAS1795_0092:3:1:9451:1707#0/1
TGCTGGCGGACCAGATGATCTCCCGCATCGATT
+HWUSI-EAS1795_0092:3:1:9451:1707#0/1
hhhhghhhhhhhhhhchhhhghhhchghhhehh
@HWUSI-EAS1795_0092:3:1:9938:1712#0/1
TGGGGTTCTTCTTGACGCCAATGATGGGCAGAT
+HWUSI-EAS1795_0092:3:1:9938:1712#0/1
ggggeggggggggggggggggggfgggfgggeg
@HWUSI-EAS1795_0092:3:1:10516:1710#0/1
GAGAAATTCCTAGATTTGTGCACCTGCTCAGAC
+HWUSI-EAS1795_0092:3:1:10516:1710#0/1
hghhhhhhhhhhhhhhhegfhghhhhhhfchhh
@HWUSI-EAS1795_0092:3:1:10825:1712#0/1
CTCGCATTGATTACGTCCCTGCCCTTTGTACAC
+HWUSI-EAS1795_0092:3:1:10825:1712#0/1
hhhhhhhhhhhhhhfhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10998:1706#0/1
TAAAAGTGTGTCAGCTCTACTCGGGGGAAAGTA
+HWUSI-EAS1795_0092:3:1:10998:1706#0/1
hghh_hhhhhhhhghhghhhhhhhhhhfhghhh
@HWUSI-EAS1795_0092:3:1:12289:1709#0/1
GCGTGGGCGAACGATCGATGACCGAGTGCACGG
+HWUSI-EAS1795_0092:3:1:12289:1709#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhhghhghhh
@HWUSI-EAS1795_0092:3:1:12955:1716#0/1
CGGCTACCTCCACATCTGGGACCTACGTCAGTT
+HWUSI-EAS1795_0092:3:1:12955:1716#0/1
ccccc_caBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13405:1712#0/1
CAAAAAAGCGTACTCGCACTTACGGGCGCGGTG
+HWUSI-EAS1795_0092:3:1:13405:1712#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhfh
@HWUSI-EAS1795_0092:3:1:14117:1707#0/1
CCAGCCCATCATGGAGGCCAGCTACGTGAACAT
+HWUSI-EAS1795_0092:3:1:14117:1707#0/1
hhhhhghhhhhhhhhhhhhhhhfhhhgghhhhg
@HWUSI-EAS1795_0092:3:1:14277:1710#0/1
ATTAAAACAGCGTGTTGTGTTGTTGTCTGCTTG
+HWUSI-EAS1795_0092:3:1:14277:1710#0/1
hhhhhhhhhhhhhhhhghghhhhhghfhhhhhg
@HWUSI-EAS1795_0092:3:1:14456:1711#0/1
GTGGTCTCGTGGATGCCGCAAGCCTCCATTCCC
+HWUSI-EAS1795_0092:3:1:14456:1711#0/1
hghhhhhhhhhgghhffhhhh_hehhghhfhhh
@HWUSI-EAS1795_0092:3:1:15054:1711#0/1
TTGTGATGCACCAGAAGCAGAAGGAGAATCTGC
+HWUSI-EAS1795_0092:3:1:15054:1711#0/1
gggggggggggggfggg^ffffgfgggefd]gc
@HWUSI-EAS1795_0092:3:1:15296:1713#0/1
GTATGGAGAGAACGCGATGCGCAGACGATCGTC
+HWUSI-EAS1795_0092:3:1:15296:1713#0/1
hhhhhhhhhghhhhhhhfhchhhfghggghhhh
@HWUSI-EAS1795_0092:3:1:16316:1714#0/1
TTTATCATTGCAGTCCAGCACGGATACGACCTT
+HWUSI-EAS1795_0092:3:1:16316:1714#0/1
gggggggggdgf^fffffggggggcdggggggg
@HWUSI-EAS1795_0092:3:1:16827:1716#0/1
CCCACGTCGCCTGGGACCCAAGCGTGCTAGCAA
+HWUSI-EAS1795_0092:3:1:16827:1716#0/1
f\dffffggggggggcgggdgcff_ffWdbdbd
@HWUSI-EAS1795_0092:3:1:17573:1714#0/1
GGATATAGTGTGGGAAATGGAGTTTCTTCTATT
+HWUSI-EAS1795_0092:3:1:17573:1714#0/1
hhghhhhhhhhhhhhhghhhehhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:18077:1709#0/1
AAGTACGATCCCTCCATCGGTATCTATGGTCTG
+HWUSI-EAS1795_0092:3:1:18077:1709#0/1
hghhhhghhhhhgfhghfffaffhhhfhgWfdf
@HWUSI-EAS1795_0092:3:1:18649:1714#0/1
CACGCATTTACACACATAAAACTTGCATACAAA
+HWUSI-EAS1795_0092:3:1:18649:1714#0/1
V\`bVJbcWaa^`VbXadaaZ_f[ffaffccfW
@HWUSI-EAS1795_0092:3:1:19117:1711#0/1
GGCGTTCGCTGTGCAGTGAAAAGTGAGACTTTC
+HWUSI-EAS1795_0092:3:1:19117:1711#0/1
hhghhhhhhhhcfffffhfhhddahhfhhhhhh
@HWUSI-EAS1795_0092:3:1:19766:1709#0/1
AAAACCCGATGCGACGCCGGTTGAGTACTACAT
+HWUSI-EAS1795_0092:3:1:19766:1709#0/1
gggggggggeggg]gegcffcceffefggcgee
@HWUSI-EAS1795_0092:3:1:1497:1729#0/1
GCTCTAGTCACCTCCGCCATTTCTCGCTCGATT
+HWUSI-EAS1795_0092:3:1:1497:1729#0/1
bfhhhhhhghhfahe]chgfgfefhchhgfhfh
@HWUSI-EAS1795_0092:3:1:2340:1728#0/1
CGACAAGGCCACCTAAGAGAAGCTGTACAAGGA
+HWUSI-EAS1795_0092:3:1:2340:1728#0/1
aa\]^]^][a]^__^BBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2507:1719#0/1
GGCGGATCCTGCTGGCGCTTGCGACTGGGTGCC
+HWUSI-EAS1795_0092:3:1:2507:1719#0/1
gegfggggggfgcggecffffdfcdffff_fff
@HWUSI-EAS1795_0092:3:1:2738:1721#0/1
TAAAGATCGACGGGGAAGTGGATGAGGAGTGGA
+HWUSI-EAS1795_0092:3:1:2738:1721#0/1
ffffcdffcafcfcf[fIN]]QH[RWO^a]]af
@HWUSI-EAS1795_0092:3:1:3533:1727#0/1
AGCCGTACTACCATGGAAGTCTTTCGCAGAGAG
+HWUSI-EAS1795_0092:3:1:3533:1727#0/1
hhhhhhhhhhhghhhghhhhhhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:3598:1729#0/1
AGGAAGTCGAGGAAATTCTTCCAGAAGTTGGCA
+HWUSI-EAS1795_0092:3:1:3598:1729#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghdhg
@HWUSI-EAS1795_0092:3:1:3628:1721#0/1
CCGAGATACAGATAGCCGGTCGGACGGACAGGG
+HWUSI-EAS1795_0092:3:1:3628:1721#0/1
__aacacaaadaacaacccacc\X\\T`b^baW
@HWUSI-EAS1795_0092:3:1:3964:1724#0/1
AGTCGATGAAAATCTGAAGAAGAAGCGTACCTT
+HWUSI-EAS1795_0092:3:1:3964:1724#0/1
ffggggggggggfggfggdegfggffegfgega
@HWUSI-EAS1795_0092:3:1:4310:1720#0/1
GCGGTTTCGGTAGCCGGGATTCCATCGCCAACT
+HWUSI-EAS1795_0092:3:1:4310:1720#0/1
ffcddffeff]cZ_`\Zfcdcaaa`defdff]Y
@HWUSI-EAS1795_0092:3:1:5390:1726#0/1
CTTTCCTGTGACAATCCAGTACTATTATACCCA
+HWUSI-EAS1795_0092:3:1:5390:1726#0/1
hhhhhhhhhhhhhhhghhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5708:1727#0/1
ATGAAGGGCTACATCGGAGATACGAAGTCCACG
+HWUSI-EAS1795_0092:3:1:5708:1727#0/1
ghhghhhhhhhhghhhhfdfdfhfhfhghhhhh
@HWUSI-EAS1795_0092:3:1:5833:1726#0/1
GCGTTCTCCTCCTCGGCCGGGAAATTAATGTTC
+HWUSI-EAS1795_0092:3:1:5833:1726#0/1
hhhghhhhhhhhhhhghhfhhgghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6073:1724#0/1
TGTTTGGCGTAAGCCTGCATGGAGCTGCCATTG
+HWUSI-EAS1795_0092:3:1:6073:1724#0/1
ddgegggagggggggfgggdggacaffgggggg
@HWUSI-EAS1795_0092:3:1:6513:1719#0/1
TTAATTCATTCAGGAGACTGGTGATCTCCTTCT
+HWUSI-EAS1795_0092:3:1:6513:1719#0/1
hhhhhhhhhhhhhhfghhhhhgghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6623:1721#0/1
AGGGCGGCATCGATAGTGGAATGATGCTGCAGC
+HWUSI-EAS1795_0092:3:1:6623:1721#0/1
ggfggfg`ffecggcggggfcgegcggggegcg
@HWUSI-EAS1795_0092:3:1:6912:1719#0/1
CGCCGGTGGGGGTGTTTAGCTTGAAGGGCCACA
+HWUSI-EAS1795_0092:3:1:6912:1719#0/1
ggggggffffffcfcffgggggfgcgggggggg
@HWUSI-EAS1795_0092:3:1:7352:1724#0/1
CCGGCTAATCGGCAATTGGTGGTGGTGTTGCTG
+HWUSI-EAS1795_0092:3:1:7352:1724#0/1
hhhhhhhhghhghhfhhffcff`fd`bffffch
@HWUSI-EAS1795_0092:3:1:7670:1718#0/1
GTGCCTGGCATCCGTCGCGTGTGTCCACCACCG
+HWUSI-EAS1795_0092:3:1:7670:1718#0/1
ggggggggggggggggcffgfggggggfggggg
@HWUSI-EAS1795_0092:3:1:7747:1718#0/1
CAGGATTCCATTGGCGTCCAAGTCGAAGGTTAC
+HWUSI-EAS1795_0092:3:1:7747:1718#0/1
hhhhghhhhhhhhhhhhhhhhhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:7986:1717#0/1
GGAGAAGCTGGAGATCGAGCTTGCGCGCTGGAG
+HWUSI-EAS1795_0092:3:1:7986:1717#0/1
hhhhhhhhhhhfhhghhhfhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:8218:1724#0/1
CAAGCGTGCCCTGTCTGGTTCCCACCAGGTGCG
+HWUSI-EAS1795_0092:3:1:8218:1724#0/1
ffcdcWdff]fcffff[d[ddeafd]`]R\V`P
@HWUSI-EAS1795_0092:3:1:8326:1724#0/1
GGGCGCTGGGCATACTTGCCCTTCTTCAGCACG
+HWUSI-EAS1795_0092:3:1:8326:1724#0/1
ghehhhhhhhhhhhhhhfhhghhhhhhhhfehh
@HWUSI-EAS1795_0092:3:1:8370:1727#0/1
CACGAACCAAAAGCCAATTGCGCACGGAACGTA
+HWUSI-EAS1795_0092:3:1:8370:1727#0/1
ecggcgggggggaaggggggggggggfafdfdc
@HWUSI-EAS1795_0092:3:1:8610:1721#0/1
TCCAGTTCAGGTTCCTGCTCATTGAGCAAGCCA
+HWUSI-EAS1795_0092:3:1:8610:1721#0/1
hhhhhhhhhhhhhhhgchghhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:9099:1719#0/1
GCACCAGTTCCTTGCCAACCACTTGCCGAAGGC
+HWUSI-EAS1795_0092:3:1:9099:1719#0/1
hhhhhgghhhhhhWhhhhhhhhhhhhhhhghhf
@HWUSI-EAS1795_0092:3:1:9183:1717#0/1
CACCCATGTCAAAGCAAAAGGCTGAGAATAAAA
+HWUSI-EAS1795_0092:3:1:9183:1717#0/1
ggffcffdfcfffadffggggefggggfgggfg
@HWUSI-EAS1795_0092:3:1:9379:1717#0/1
CATTTTGTTATAGAAACAGAAGATACTGAGATC
+HWUSI-EAS1795_0092:3:1:9379:1717#0/1
hhhhhhghhhhhfhhhhhghhehhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9422:1725#0/1
GGAGGCCAGCTACGTGAACATCCCCGTGATTGC
+HWUSI-EAS1795_0092:3:1:9422:1725#0/1
hhhhhhhhghhhhhfhhhhhhhhhhhh]dfffh
@HWUSI-EAS1795_0092:3:1:9872:1720#0/1
CCGGTTTGAACTCAGATCATGTAAGAATTTAAA
+HWUSI-EAS1795_0092:3:1:9872:1720#0/1
hhhhhghhhgghhhdhdhfhghhhcgfhhhhhe
@HWUSI-EAS1795_0092:3:1:9962:1723#0/1
TCGGATGTTTGGTCGTATGGAGTAGTTCTATGG
+HWUSI-EAS1795_0092:3:1:9962:1723#0/1
ffffdffgggfggggggfffffggggfgcgggg
@HWUSI-EAS1795_0092:3:1:10048:1721#0/1
CCGGAACTAAAACTATTAAACTCCCTAATCACG
+HWUSI-EAS1795_0092:3:1:10048:1721#0/1
badcdedggffdgddgfgfggcggcggegggeg
@HWUSI-EAS1795_0092:3:1:10885:1720#0/1
CGGGAAACCAGTTTCGGAGGCGGCGGTTGGTCT
+HWUSI-EAS1795_0092:3:1:10885:1720#0/1
hhhhhhhhcghhhghhgghhdhd`ddT\Z^[[^
@HWUSI-EAS1795_0092:3:1:11126:1728#0/1
TGGTGATCGAGTCGTCCAGCATCTGGATGCGAA
+HWUSI-EAS1795_0092:3:1:11126:1728#0/1
dgfffffggggggggggfgggefggdaggfggg
@HWUSI-EAS1795_0092:3:1:11727:1727#0/1
GTTCAGCCCCAGCAGGCCGCTTCCGTGGTAGAG
+HWUSI-EAS1795_0092:3:1:11727:1727#0/1
fcaff_dfc]fffafafcdW`]fafcffdcfWa
@HWUSI-EAS1795_0092:3:1:12234:1728#0/1
GTTGGTATAAATATAAATATATGTGGCGTGTAG
+HWUSI-EAS1795_0092:3:1:12234:1728#0/1
hhhhhhhhhhhhhhhhhhhghhghhhhhhghhh
@HWUSI-EAS1795_0092:3:1:12453:1727#0/1
CACGCCGACTCGCCCATATCCGGCTCGAATCCG
+HWUSI-EAS1795_0092:3:1:12453:1727#0/1
hghhhhhhhehghhhhfhhhhhfhfhhgfhhhh
@HWUSI-EAS1795_0092:3:1:12786:1719#0/1
GAATTCGGTATGGAATCGGCGGCTGTGCTATCC
+HWUSI-EAS1795_0092:3:1:12786:1719#0/1
hhhhhhhhhhhhhhhhhhhhhhUUXUUGOSQO_
@HWUSI-EAS1795_0092:3:1:13190:1718#0/1
GCATAATTTGTCTGTTTACTAGCGATACGTTCG
+HWUSI-EAS1795_0092:3:1:13190:1718#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhgfhhhg
@HWUSI-EAS1795_0092:3:1:13291:1720#0/1
AAGACCTCGAAGATCAGGAATGTGAAGTACACC
+HWUSI-EAS1795_0092:3:1:13291:1720#0/1
gffggfggggfgfffffgggaggggaggggggg
@HWUSI-EAS1795_0092:3:1:14039:1720#0/1
GTTACCTTCGAATTCCCCGACAACTACCTGAAT
+HWUSI-EAS1795_0092:3:1:14039:1720#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhghhgeh
@HWUSI-EAS1795_0092:3:1:14098:1722#0/1
GACAGGCAGAGCACCTTCTTCATCTGGAACTTG
+HWUSI-EAS1795_0092:3:1:14098:1722#0/1
ghhhhhhhhchhhhhhhhhhhhhhhhghhfhhh
@HWUSI-EAS1795_0092:3:1:14166:1720#0/1
GTCAAAAGCACCGAGAACCTGCTGCACCGCCTG
+HWUSI-EAS1795_0092:3:1:14166:1720#0/1
ggggfgggfggggfdgfggaaggcggggagggc
@HWUSI-EAS1795_0092:3:1:14555:1723#0/1
CCCTTCTTCACGGTGGCCACGAACATGTCGCCG
+HWUSI-EAS1795_0092:3:1:14555:1723#0/1
hhhhhhhhhghhhghhhhhfhghfhhhgehhhg
@HWUSI-EAS1795_0092:3:1:14676:1719#0/1
GAAGCTGCGCGCCAAAACGCCGCTGGGCAAGCT
+HWUSI-EAS1795_0092:3:1:14676:1719#0/1
dffcffcfc\fcfffcd^^a``aWdc_ZX_XWQ
@HWUSI-EAS1795_0092:3:1:14783:1729#0/1
GCTGCACAAGGTGACGCAGTACAAGAAGTCCAA
+HWUSI-EAS1795_0092:3:1:14783:1729#0/1
fefgggggggfbfffffdgcggggggggfggge
@HWUSI-EAS1795_0092:3:1:14807:1729#0/1
CTTGAGGATATCTATAAAAAAGCCCACCAGGCA
+HWUSI-EAS1795_0092:3:1:14807:1729#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhehghh
@HWUSI-EAS1795_0092:3:1:15568:1719#0/1
TTTCTGAATGAGAGTAAGAAAAGAAAGCGAGAT
+HWUSI-EAS1795_0092:3:1:15568:1719#0/1
ggggggggggggfgggggfgggggfggfeaggg
@HWUSI-EAS1795_0092:3:1:15972:1719#0/1
GCGAGGTCTGGTAGGCGCTGGATATGTTCTTTT
+HWUSI-EAS1795_0092:3:1:15972:1719#0/1
hhhhhhghhhhghhghhghhhfghgghhhhhhh
@HWUSI-EAS1795_0092:3:1:16060:1721#0/1
TGGTCATGTACTTGGAGGCGCCCAATGAATTGC
+HWUSI-EAS1795_0092:3:1:16060:1721#0/1
fc^W^c^dddaa_`^^Zddd^d_aa`^f[[fc_
@HWUSI-EAS1795_0092:3:1:17029:1727#0/1
CAATTTCGCCTAATTTGAGTTTGTACAGAATTG
+HWUSI-EAS1795_0092:3:1:17029:1727#0/1
hfhhhhhhhhhghhhhhfhhhhfhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:17336:1722#0/1
TCCACATCCTTGCCCTTGGCCTTAGCCTCGGCG
+HWUSI-EAS1795_0092:3:1:17336:1722#0/1
gggcgfgfgdgRfffdffcaffcffffgfefgg
@HWUSI-EAS1795_0092:3:1:18230:1718#0/1
CACGGACATGTTGGCGTCCACGATGCATCCACG
+HWUSI-EAS1795_0092:3:1:18230:1718#0/1
ggggggggdgfgaffedggegaeaeffadfad]
@HWUSI-EAS1795_0092:3:1:18405:1722#0/1
CGGAGCCGCTGAACAAGTATCTCTATCTGAGCG
+HWUSI-EAS1795_0092:3:1:18405:1722#0/1
ffdf_fa_``a`dff__^ddd[^^\\Ydaaadd
@HWUSI-EAS1795_0092:3:1:19749:1728#0/1
GAGCACTGTAAGCGGCAGACGCAAATAAAGCAT
+HWUSI-EAS1795_0092:3:1:19749:1728#0/1
ggggggggggggggeegf[ggeagggggggggg
@HWUSI-EAS1795_0092:3:1:1707:1736#0/1
GTTGATGATGGCGCTGACCAGGATCTGCAGAGG
+HWUSI-EAS1795_0092:3:1:1707:1736#0/1
hhhhghhhhhhhfhhhhhhfhchfhecffffff
@HWUSI-EAS1795_0092:3:1:1756:1731#0/1
TTCTTTAGTTGGTAAGCTTATCGCTCCTGTTTC
+HWUSI-EAS1795_0092:3:1:1756:1731#0/1
hhhhhghhhhhheghgghhghhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:2870:1731#0/1
TTTATGTTTTCACTAACCAGACCCAGCCTCTTC
+HWUSI-EAS1795_0092:3:1:2870:1731#0/1
hfhghfhhhhechhfhhhhhhfhhhhhhhgfhh
@HWUSI-EAS1795_0092:3:1:3004:1736#0/1
TGGAGAAGCAGGGTTCCGATCTGGCCGGCGTTA
+HWUSI-EAS1795_0092:3:1:3004:1736#0/1
fLcfQffefWfde\Rde_a[a^[^ddbgdgcga
@HWUSI-EAS1795_0092:3:1:3039:1739#0/1
CATTTTAGGGCTACCCAGTCGGCGTTTTTCGTT
+HWUSI-EAS1795_0092:3:1:3039:1739#0/1
fcdffffddceK^\_\_]fffBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4357:1736#0/1
GTTCGGATACATTTTGTTGCTCTGGGATTTATC
+HWUSI-EAS1795_0092:3:1:4357:1736#0/1
ggggfgeggggggfgagg`gggggggegggggg
@HWUSI-EAS1795_0092:3:1:4840:1732#0/1
CCGAGATAAAATAGTGAAAAACTAGTTACCAAA
+HWUSI-EAS1795_0092:3:1:4840:1732#0/1
hfhehhfhhhgchhhhhhhhhhhhhfghhfhhg
@HWUSI-EAS1795_0092:3:1:5765:1731#0/1
GGAGTTTGTCAACTCGCAAGGATTGAACCATGA
+HWUSI-EAS1795_0092:3:1:5765:1731#0/1
edcffffghhhhfcfhhghhehh^ahhgdhgha
@HWUSI-EAS1795_0092:3:1:6204:1738#0/1
TGGGCGTCAAGGCGCTGGAGCCAGCATTGGACT
+HWUSI-EAS1795_0092:3:1:6204:1738#0/1
hhhhhhhhhhghhhhhghhfhhhhhhhhfhghh
@HWUSI-EAS1795_0092:3:1:6378:1730#0/1
CGAGGCTCCGATCACGCGGAAAGATATGATCAT
+HWUSI-EAS1795_0092:3:1:6378:1730#0/1
hhhhhhhhhhhhhghhhhghhgghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:6630:1738#0/1
GCAGCAGGCGGTACGCCAAGTCGCCGCTGGCCA
+HWUSI-EAS1795_0092:3:1:6630:1738#0/1
hhhhhhhhfhhghghhhghcehdhfdhfhegcc
@HWUSI-EAS1795_0092:3:1:6713:1734#0/1
TGGACTCCCTATATGCAGGATGCACTGAAGTGA
+HWUSI-EAS1795_0092:3:1:6713:1734#0/1
hhhhhghhhhhghhghhhhgchfhfhhhahefg
@HWUSI-EAS1795_0092:3:1:6873:1731#0/1
GGCGTCGGTTGCCCGGGGACTAATGTGCTTAAC
+HWUSI-EAS1795_0092:3:1:6873:1731#0/1
ggggggggggfgggfgggggdggeggggggggg
@HWUSI-EAS1795_0092:3:1:7382:1729#0/1
TGACCATCATTGATGCCCCCGGACACAGGGATT
+HWUSI-EAS1795_0092:3:1:7382:1729#0/1
hhhhhhhhhhhhhhhhhhhhhhchghhhhhehh
@HWUSI-EAS1795_0092:3:1:7449:1738#0/1
CAGGGAGCTGCGGGTCGTGCGGAGGAGGAGAAT
+HWUSI-EAS1795_0092:3:1:7449:1738#0/1
hghhhghhhhhhhhghhhhhhhehhghfefeed
@HWUSI-EAS1795_0092:3:1:7938:1738#0/1
AGCACCACGACCTACTCACAGCAAAAAACGTAC
+HWUSI-EAS1795_0092:3:1:7938:1738#0/1
hhfhhhhhhghhhhhhghhhhhhhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:8816:1737#0/1
CTCGGGAATCTTTTGTTGTTGCGTCTGCCTGCG
+HWUSI-EAS1795_0092:3:1:8816:1737#0/1
hhhhhhhhhhhhhhhhhfhhhehhhghhghggh
@HWUSI-EAS1795_0092:3:1:9977:1738#0/1
CTCGAAGATCAGGAATGTGAAGTACACCGGCGA
+HWUSI-EAS1795_0092:3:1:9977:1738#0/1
hhhhgggcgehhhfhdhgfghgfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10352:1730#0/1
GTGTGCTACTCTCCAAGAACAGTAAGTGTGCTA
+HWUSI-EAS1795_0092:3:1:10352:1730#0/1
hhhhhhhhhhhhhhhhdhhhhhhhhhhhghhfh
@HWUSI-EAS1795_0092:3:1:10438:1735#0/1
GTACCATCGAGAAGTTCGAGAAGGAGGCCCAGG
+HWUSI-EAS1795_0092:3:1:10438:1735#0/1
ggggeggff_ffggggff]fffgg[gcfc_cff
@HWUSI-EAS1795_0092:3:1:10568:1737#0/1
GATGCAGCGCCTCTACTCCAGATCTTTTTTGGG
+HWUSI-EAS1795_0092:3:1:10568:1737#0/1
hghhhhhhgdhhhhhhhhhhgghhhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:10735:1739#0/1
GAAAGATGTATTTCCGATGATCTGGGCCAGCAT
+HWUSI-EAS1795_0092:3:1:10735:1739#0/1
ggaggggggfgfgggfffa\ffgggcgfggfca
@HWUSI-EAS1795_0092:3:1:10907:1729#0/1
CACAATGTGATTTCTGCCCAGTGCTCTGAATGT
+HWUSI-EAS1795_0092:3:1:10907:1729#0/1
]ddc[dYacccca\aWafcffffcff[IYXYZ`
@HWUSI-EAS1795_0092:3:1:11848:1730#0/1
GTGGGATGGTGGTGTCGGTGAGACCGGGAATGT
+HWUSI-EAS1795_0092:3:1:11848:1730#0/1
hhhhhghhhghhhhhhhfeffccdddeghhdhg
@HWUSI-EAS1795_0092:3:1:13311:1731#0/1
TATGCTAGTTACTTGCATATGCTATCAACAGAA
+HWUSI-EAS1795_0092:3:1:13311:1731#0/1
hhhahhhghhhhhhhhhhghhhhhfhhhhhhhf
@HWUSI-EAS1795_0092:3:1:13364:1732#0/1
AATCGGTGTGAATTAAATTATTCGCTGTGATGT
+HWUSI-EAS1795_0092:3:1:13364:1732#0/1
\c]\^``W^SIaab\Rbcc^ccRNY\TY_BBBB
@HWUSI-EAS1795_0092:3:1:13656:1731#0/1
CACGCTTCTCGGCGTTGTTTATGCACTTCAAGG
+HWUSI-EAS1795_0092:3:1:13656:1731#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:13798:1740#0/1
ACCCAGTGTATTTTTAACAAACAGCCATAAAAA
+HWUSI-EAS1795_0092:3:1:13798:1740#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13923:1737#0/1
CCTGCTTCTGGGCAAGCTCGCGTGCCTTGGCGC
+HWUSI-EAS1795_0092:3:1:13923:1737#0/1
gggggggggggggggbgdffffedggggggggg
@HWUSI-EAS1795_0092:3:1:13970:1730#0/1
TTCCGGCTTCATGTTACGCTTGGCCAGAATCTC
+HWUSI-EAS1795_0092:3:1:13970:1730#0/1
gegdgggfgggggfgfgggcggggggggeeggg
@HWUSI-EAS1795_0092:3:1:14124:1733#0/1
GTTCCAGTCCTCCACTCCGCCAACGGTCTCGGC
+HWUSI-EAS1795_0092:3:1:14124:1733#0/1
ggggggcggggggggegggggggggcgg[gfcg
@HWUSI-EAS1795_0092:3:1:14184:1738#0/1
GCCACAACAGCTACACGTCCTCCACCTCATCGT
+HWUSI-EAS1795_0092:3:1:14184:1738#0/1
hfhhhhhhhhhhhghhhhhhfhhfhhahhhhhh
@HWUSI-EAS1795_0092:3:1:14271:1735#0/1
GGCAGATGGTCGCTGGTATCAGGCTGTTGTGGA
+HWUSI-EAS1795_0092:3:1:14271:1735#0/1
fhhhhhhhhhhhhehhhghhhghhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:16564:1738#0/1
ATGGAAGTCTTTCGCAGAGAGATATGGTAGATG
+HWUSI-EAS1795_0092:3:1:16564:1738#0/1
gggggggggggggggggcffffgggggfdfaff
@HWUSI-EAS1795_0092:3:1:16594:1740#0/1
ATAAGAACCGCGAAAAGTACCGCTTCGGACATT
+HWUSI-EAS1795_0092:3:1:16594:1740#0/1
hhhhhfcfffffhghhhahhfffhhfhhhghhh
@HWUSI-EAS1795_0092:3:1:16608:1729#0/1
TCTCCTCATCCTCGCTGCCACTGCCGGCAGCCG
+HWUSI-EAS1795_0092:3:1:16608:1729#0/1
faggcccfccfcfefafffff]]daae\c^a^c
@HWUSI-EAS1795_0092:3:1:16900:1739#0/1
GGCATCTGACGGCGATATCAAACACGTGCCGCA
+HWUSI-EAS1795_0092:3:1:16900:1739#0/1
hhhhhhhhhhhhhhhfhhhghhhfhhhhhhhef
@HWUSI-EAS1795_0092:3:1:17120:1730#0/1
TTCGATAACTACGTTACTCTATTCAAGATCCTT
+HWUSI-EAS1795_0092:3:1:17120:1730#0/1
ggfegggggfgfgggcfgcgggggccg[ffffg
@HWUSI-EAS1795_0092:3:1:17677:1730#0/1
TTGACTTTTAGCTTAGTAGTTGTTGTGTTTTTG
+HWUSI-EAS1795_0092:3:1:17677:1730#0/1
\addddd\dddddcaYdYaaZZdc^dSZaa[[`
@HWUSI-EAS1795_0092:3:1:17764:1733#0/1
CTTAAATAGATTTTATCTTCCTGCATCTCTATC
+HWUSI-EAS1795_0092:3:1:17764:1733#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17786:1732#0/1
TGGGGATGACGCGGTGGAAAATGGAGCCCTTGT
+HWUSI-EAS1795_0092:3:1:17786:1732#0/1
fWff[ffccffdfW`ff_fffffcfafcff[[^
@HWUSI-EAS1795_0092:3:1:17805:1733#0/1
CGTCGTTGGAGCTGATTCTGAAGTAGCGCAGCT
+HWUSI-EAS1795_0092:3:1:17805:1733#0/1
hhdhhhhggfhhhhhehhhhfahbhhhcffdfd
@HWUSI-EAS1795_0092:3:1:17836:1732#0/1
GCCTCCTCTACTTTATTTTTTCTTTTGCAACGA
+HWUSI-EAS1795_0092:3:1:17836:1732#0/1
daacdd[cc\caXYY\U_____`cccccccdca
@HWUSI-EAS1795_0092:3:1:18040:1732#0/1
ATCCGACAGCGCATGTACCACGTGGAGGAGGAG
+HWUSI-EAS1795_0092:3:1:18040:1732#0/1
hhhhghhhhhhchhhdahhhhhhhhhhfdffdh
@HWUSI-EAS1795_0092:3:1:18554:1739#0/1
GCCAGTTGGTATGTCTTCACCATTCCGCCGTAG
+HWUSI-EAS1795_0092:3:1:18554:1739#0/1
hhfghhhhhhfhghhhhdhhhfghhhghhhhhg
@HWUSI-EAS1795_0092:3:1:18778:1740#0/1
TGCCACCGGACAGCACGGTGTTGGCATACAGAT
+HWUSI-EAS1795_0092:3:1:18778:1740#0/1
cggggggcfebdggcggfdaffgcgcgadbdbc
@HWUSI-EAS1795_0092:3:1:19013:1740#0/1
CGCTGGTGTCATTAGAACTGTTTATTTATTTTT
+HWUSI-EAS1795_0092:3:1:19013:1740#0/1
hhhhhhghhhhghhehhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:1290:1743#0/1
CTGACACCGCGTGGTGTTTTTGCTTTCGATTCC
+HWUSI-EAS1795_0092:3:1:1290:1743#0/1
gfggggaffaa]fffcfcffcffffffYYdcc[
@HWUSI-EAS1795_0092:3:1:1467:1742#0/1
CGCCGATCGAATCTAGCTCCGCGTCCTTATTCG
+HWUSI-EAS1795_0092:3:1:1467:1742#0/1
aV_bYcfaTadcdabW`fafc^Z^a^[adddae
@HWUSI-EAS1795_0092:3:1:1570:1752#0/1
AGTCAGCTGTCTAGCGATCCCATGTGCCTTTAA
+HWUSI-EAS1795_0092:3:1:1570:1752#0/1
gggggdfebdfedffc[fdfdfdf`dd_dfbed
@HWUSI-EAS1795_0092:3:1:2349:1748#0/1
ATTGATTCGTCCGGTTGTTCGTGAAAGAAGGCG
+HWUSI-EAS1795_0092:3:1:2349:1748#0/1
addadaafc]cfad^adffcfacccca`````f
@HWUSI-EAS1795_0092:3:1:2639:1747#0/1
GGTGGCTTCTGTTCCCATTTCCACGGAGGACAC
+HWUSI-EAS1795_0092:3:1:2639:1747#0/1
ffdffffgggggggggfgggggggggggggggg
@HWUSI-EAS1795_0092:3:1:2709:1748#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:2709:1748#0/1
ggfffffgggggcbdfdeffffg[gegf_fffg
@HWUSI-EAS1795_0092:3:1:3293:1750#0/1
GGGAACCACCGTTCGATAGCTTCGCTCATCGAA
+HWUSI-EAS1795_0092:3:1:3293:1750#0/1
gggegggffadd`d`]`fdfafeeccc`ccfcg
@HWUSI-EAS1795_0092:3:1:3310:1742#0/1
CGGCGACAAGTCGCAGGAGGTGCAGGATCTGCT
+HWUSI-EAS1795_0092:3:1:3310:1742#0/1
fffff_fffafcdcddcfaWfW^VY[Zbdbbdc
@HWUSI-EAS1795_0092:3:1:3407:1744#0/1
GCTGCCTTCCTTAGATGTGGTAGCCGTTTCTCA
+HWUSI-EAS1795_0092:3:1:3407:1744#0/1
aacdadafffdd^d^ccadccdddcdadaaRdP
@HWUSI-EAS1795_0092:3:1:4418:1748#0/1
CAGTCAGCCACTGCAAGCAAAATATATATCGAT
+HWUSI-EAS1795_0092:3:1:4418:1748#0/1
gggggggfggggggggggggggcggggggggfg
@HWUSI-EAS1795_0092:3:1:4509:1748#0/1
CTTGGGGTTTATTTAACGAATTGGTTTTTATCG
+HWUSI-EAS1795_0092:3:1:4509:1748#0/1
hhhhhfhhhhhhhhhhhhchhhhhghhhhchgh
@HWUSI-EAS1795_0092:3:1:4552:1750#0/1
GCGGGAAAGGTTTCCCTTGCGTGCGTAGCGCTG
+HWUSI-EAS1795_0092:3:1:4552:1750#0/1
fffffffgggdfgfggggagafa[a^`]bbWbg
@HWUSI-EAS1795_0092:3:1:4766:1750#0/1
GGAGGACCCAAAGAAGCCGGAGCTGGCAGCGGC
+HWUSI-EAS1795_0092:3:1:4766:1750#0/1
hhhhhhhhhhhhghhghhhhhghhhhhhghhhg
@HWUSI-EAS1795_0092:3:1:4844:1752#0/1
TGGCTCGCGTTTCGGCAAAGATGACAATGTTCT
+HWUSI-EAS1795_0092:3:1:4844:1752#0/1
gggggggggefg][fcffccf]ffcff]ccfcg
@HWUSI-EAS1795_0092:3:1:4931:1744#0/1
AAATTACTAGATTTTCGCCAAAAACACAAACAT
+HWUSI-EAS1795_0092:3:1:4931:1744#0/1
gccffffff[fffggfgdgggggggecggdfgg
@HWUSI-EAS1795_0092:3:1:5475:1742#0/1
GCACCATGGACAGGAGCCCAGGTTGGATTGGTG
+HWUSI-EAS1795_0092:3:1:5475:1742#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhgfh
@HWUSI-EAS1795_0092:3:1:5527:1750#0/1
TACGAGCACATCTTGTCCTTTTTCAAGAAAAAC
+HWUSI-EAS1795_0092:3:1:5527:1750#0/1
hhhghhhhhhhhhhghhfghhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:6165:1751#0/1
CGCTTCCGCATGGGCAAGGCATCTTGATTGAGT
+HWUSI-EAS1795_0092:3:1:6165:1751#0/1
hhhhhghhhfhhhhhhhhhhgghhhhehhhhhg
@HWUSI-EAS1795_0092:3:1:6402:1742#0/1
GCTAATTACTCCGCGCTCCGAGAGACCAGAGGG
+HWUSI-EAS1795_0092:3:1:6402:1742#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:7707:1749#0/1
GTTTAATTTCTTCCATCGAAAGGAGTTTCGACG
+HWUSI-EAS1795_0092:3:1:7707:1749#0/1
`b\Z^^acaad_XaY\^Y[aZaa^[^d^`PY][
@HWUSI-EAS1795_0092:3:1:7902:1750#0/1
TGCAAAACCACAGAGGATGTGCTAACCATTTCC
+HWUSI-EAS1795_0092:3:1:7902:1750#0/1
ggffggfggfdfdffff_dcffccfcdgggcgg
@HWUSI-EAS1795_0092:3:1:8365:1745#0/1
TCTGGTTTAATGGCTACTTGAGTGTTATTTTCA
+HWUSI-EAS1795_0092:3:1:8365:1745#0/1
gggggggggggfggggecf^c_aaeecffffcd
@HWUSI-EAS1795_0092:3:1:8405:1750#0/1
GTTTATGGTTAGAACTAGGGCGGTATCTGATCG
+HWUSI-EAS1795_0092:3:1:8405:1750#0/1
hhhhhhhhhhhhghhhhhhhhhhghhhhhghhh
@HWUSI-EAS1795_0092:3:1:8638:1749#0/1
GCCTGACGCTGAGAGTCGTTGAAGTAGGCCGGC
+HWUSI-EAS1795_0092:3:1:8638:1749#0/1
hhhhhhhhhhhgghhhhhhhfgghfhhhhghhf
@HWUSI-EAS1795_0092:3:1:9043:1751#0/1
GGTCCTTCGCAGATGGGTCTGGAGGACATTGCC
+HWUSI-EAS1795_0092:3:1:9043:1751#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhghhh
@HWUSI-EAS1795_0092:3:1:9318:1751#0/1
GGGGAAGTCTGCCCAGTAGTTGATGTTATGGAT
+HWUSI-EAS1795_0092:3:1:9318:1751#0/1
hhhhhhhhhhhhhhhhhhhhhhdhhhhhhhfgg
@HWUSI-EAS1795_0092:3:1:9567:1747#0/1
ATAGTTGGCATATACAAAATTCACAAAATTCCT
+HWUSI-EAS1795_0092:3:1:9567:1747#0/1
hhghhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10004:1745#0/1
AAGAAAGCGAGATGATCACCTGAATGAAAGTAA
+HWUSI-EAS1795_0092:3:1:10004:1745#0/1
hhhhehehghghehdhhhhhgdggfhfffdafc
@HWUSI-EAS1795_0092:3:1:10189:1751#0/1
GGAGTCAATTTTGTAGACGAGTGTATGGCGTTG
+HWUSI-EAS1795_0092:3:1:10189:1751#0/1
hhhhhhhhhhhhghcfhhhghhcffffhgfhhg
@HWUSI-EAS1795_0092:3:1:11195:1744#0/1
TCCTCGTGTTCGCCCTGTTCGCCTTGGCTCTGT
+HWUSI-EAS1795_0092:3:1:11195:1744#0/1
hhhfhhhghhhhhhhhghhhhhhhhfhhhhghg
@HWUSI-EAS1795_0092:3:1:11325:1752#0/1
AGTTGGTCCACCTTGCGACGGGTGTTGCAGAAG
+HWUSI-EAS1795_0092:3:1:11325:1752#0/1
hhhdhhghghhghhfhhhhhhh]ffffffcfcf
@HWUSI-EAS1795_0092:3:1:11737:1747#0/1
ATCTGTTTGGAGATAACATCACCGACAGCCAGG
+HWUSI-EAS1795_0092:3:1:11737:1747#0/1
fcd_fffcffefgeegcdffffggdgdcf]ffg
@HWUSI-EAS1795_0092:3:1:11867:1746#0/1
GGAGCCGAAGTCGGTGATCATCTGGTCCAGCCA
+HWUSI-EAS1795_0092:3:1:11867:1746#0/1
hhhhhhehghhhfh_dchfhhfhhhfhhgahha
@HWUSI-EAS1795_0092:3:1:11915:1752#0/1
GTTGTACGTTGCTTTGGCCCAAAGGAAGGAGGA
+HWUSI-EAS1795_0092:3:1:11915:1752#0/1
fhhhhhghhhgghgheghhhhhhhhhhhgfhhg
@HWUSI-EAS1795_0092:3:1:11945:1745#0/1
CGGCGATCGGACCAGGAAGTACATGATGTTTAT
+HWUSI-EAS1795_0092:3:1:11945:1745#0/1
cab]a\`\__Z\]Z__ZSVHU^caccY\\^\^^
@HWUSI-EAS1795_0092:3:1:11987:1748#0/1
CCGGTGTTAGCATCAATCAAGAGTTCCATTTAG
+HWUSI-EAS1795_0092:3:1:11987:1748#0/1
hhhhhghhghhhhhhhfhfhghhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12253:1751#0/1
GTAATGATAATTGCACGACGATCGGCCTCAAAA
+HWUSI-EAS1795_0092:3:1:12253:1751#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12826:1741#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12826:1741#0/1
hhhghhhhhhhhghghhhhhhhghhhhhhhggg
@HWUSI-EAS1795_0092:3:1:12965:1748#0/1
GTGGCCAAGGTGAACGTGCTCATCCGGCCCGAT
+HWUSI-EAS1795_0092:3:1:12965:1748#0/1
hhghahhhhgahhhhhhhhfhhhhhhchhhghg
@HWUSI-EAS1795_0092:3:1:13033:1748#0/1
CTGGAACCAGCATAACACACATGGGTCTTTGAA
+HWUSI-EAS1795_0092:3:1:13033:1748#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhggg
@HWUSI-EAS1795_0092:3:1:13361:1749#0/1
GCGGATTATTTATTCGATTTTGTCATTTGCTAA
+HWUSI-EAS1795_0092:3:1:13361:1749#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13414:1747#0/1
TCGAGTTTTTATCTTTCTGTCTTCGCTCGGTAC
+HWUSI-EAS1795_0092:3:1:13414:1747#0/1
hhhhhhhhhhhhhhhhhhdhhhhhhgfhhhhhh
@HWUSI-EAS1795_0092:3:1:14298:1752#0/1
AAAAAAGAAACCAAACCCCACGGGTTGTCAATG
+HWUSI-EAS1795_0092:3:1:14298:1752#0/1
cfgffggggggggggggggf`cffdfafffdff
@HWUSI-EAS1795_0092:3:1:14347:1742#0/1
GTGATTCTTGAGGCGGCAGCTGCCTAAACGCGA
+HWUSI-EAS1795_0092:3:1:14347:1742#0/1
ggggggggggdggggggfgecgfggggggfggg
@HWUSI-EAS1795_0092:3:1:14545:1744#0/1
CAGCGACTCACGGAGCTTGTGTGGACCGGTCGA
+HWUSI-EAS1795_0092:3:1:14545:1744#0/1
gdfcfffffdfadafcddddebZ^]b`gggggg
@HWUSI-EAS1795_0092:3:1:14823:1749#0/1
TGAAGCCCGGTACCGTTGTGGTCTTCGCCCCTG
+HWUSI-EAS1795_0092:3:1:14823:1749#0/1
hhhghhhhhhhghhhchhfghgghghhhhhhha
@HWUSI-EAS1795_0092:3:1:14951:1746#0/1
AGACAAATTGGGTTTGCTGCAAGACGACCAATC
+HWUSI-EAS1795_0092:3:1:14951:1746#0/1
hhhhghghhhhhhhhhhhhhhhfffhghghhhh
@HWUSI-EAS1795_0092:3:1:14995:1744#0/1
AGCAGCCATTATTTAGCAATTTCCCTGGTCGAG
+HWUSI-EAS1795_0092:3:1:14995:1744#0/1
gggggggggggggggcgggfgggggggfgggfg
@HWUSI-EAS1795_0092:3:1:15099:1741#0/1
GGCCGAAGTAGCAAATAACAATTCAAAATTGAC
+HWUSI-EAS1795_0092:3:1:15099:1741#0/1
hhhhhhhhhhhhhhhdhhhhhhhhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:15370:1746#0/1
AAACAATCCAATAATGGTTAAGGGCAAGAAGCC
+HWUSI-EAS1795_0092:3:1:15370:1746#0/1
gggfgggggfgggcgggggceggggggfgggge
@HWUSI-EAS1795_0092:3:1:15471:1745#0/1
CTCATAGATGCGACCGCCCTTTTCCCGGCGCCA
+HWUSI-EAS1795_0092:3:1:15471:1745#0/1
hhhhhhhhhhhgghhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15989:1746#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:15989:1746#0/1
ffdfffffffcfaa]ffgggggafd_fdaff_d
@HWUSI-EAS1795_0092:3:1:16008:1752#0/1
TTTAGAGTGAGTTCGTCTCCCGGAACACTGCAG
+HWUSI-EAS1795_0092:3:1:16008:1752#0/1
ggfffffgggggfffffgggggfgggggggggg
@HWUSI-EAS1795_0092:3:1:16264:1752#0/1
TAAAATTAATTTATATGAAAAGTTTAAATAAAG
+HWUSI-EAS1795_0092:3:1:16264:1752#0/1
gecgfggcffffgggffggggggggggeggeeg
@HWUSI-EAS1795_0092:3:1:16322:1742#0/1
ATTTTCACCGCCTTTATATGCACGCACTGCAGT
+HWUSI-EAS1795_0092:3:1:16322:1742#0/1
hfhhhhhhhffgfhhhhhgcghh[hgfhhhfhh
@HWUSI-EAS1795_0092:3:1:16653:1752#0/1
AAGGAATTCCTCCAGATCAGCAGCGTCTGATCT
+HWUSI-EAS1795_0092:3:1:16653:1752#0/1
hhhghhhhhhhhghhhghhhgghhghhhghhfg
@HWUSI-EAS1795_0092:3:1:16723:1750#0/1
CGACAATGTGTCCGTTGTGGAGCCCAAGGAGGA
+HWUSI-EAS1795_0092:3:1:16723:1750#0/1
ggggggggggggfggggggfdggggggff]ff_
@HWUSI-EAS1795_0092:3:1:16951:1747#0/1
CCAGGTCTGCCTGGACAGAAGGGTGAACCAGGA
+HWUSI-EAS1795_0092:3:1:16951:1747#0/1
hhhhhhhhhhhhhhghhhhhghhdhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17021:1750#0/1
CGCCGGGCAGCTCCTTAAGCAGGTCCTTGCGAA
+HWUSI-EAS1795_0092:3:1:17021:1750#0/1
gggagcdfafcfggggead\dfccfff]edead
@HWUSI-EAS1795_0092:3:1:17201:1746#0/1
CCGCTGTGGACGCAGGCCTATGAGAACATTCAG
+HWUSI-EAS1795_0092:3:1:17201:1746#0/1
hhhhhghhhhhhefhhehdhfhfhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:17452:1751#0/1
CCTTCTGCTGGTCATCACGCTCTCCCAGCTCAT
+HWUSI-EAS1795_0092:3:1:17452:1751#0/1
VSQVYJS\ZT\Xaa^_Sddddcadc[]cYccaf
@HWUSI-EAS1795_0092:3:1:17680:1748#0/1
ATCGTGTCCACGCTCTCCGGGATATCCGCGCTC
+HWUSI-EAS1795_0092:3:1:17680:1748#0/1
hhhhhfhhhhhehhghhhhhhh_hehadgadeg
@HWUSI-EAS1795_0092:3:1:17919:1741#0/1
GTCTTCTCGTCTTTTAAATAAATTTTAGCTTTT
+HWUSI-EAS1795_0092:3:1:17919:1741#0/1
ffdeeSeW__ZPc^\\aeed``c_ffffaaffd
@HWUSI-EAS1795_0092:3:1:18157:1743#0/1
TGTCTGTGTTGGGATTGGAGGTACTACGAGGAG
+HWUSI-EAS1795_0092:3:1:18157:1743#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18488:1751#0/1
GCGGTTTTATTAATGTTCCTGCTTCTGTTTCTG
+HWUSI-EAS1795_0092:3:1:18488:1751#0/1
ggggfcgggggggfgggggggfggggfgggggf
@HWUSI-EAS1795_0092:3:1:19166:1744#0/1
CACGCGGATTTCGCTGGGCGGATTTTGAAATCG
+HWUSI-EAS1795_0092:3:1:19166:1744#0/1
hghgghhhhhhhhhfhhhhhhehhhhchhhhhg
@HWUSI-EAS1795_0092:3:1:19660:1748#0/1
GTTCTTTCTTATCAACCACTTGTGATTTCCGTA
+HWUSI-EAS1795_0092:3:1:19660:1748#0/1
aacfffcc_cdacffffff]ffddfffffa]ff
@HWUSI-EAS1795_0092:3:1:2146:1758#0/1
TCCTCGGTCACGGGCAGGAACTTTGGCTCACCG
+HWUSI-EAS1795_0092:3:1:2146:1758#0/1
fffafaaYaaa\fff[ffafffb^[]bSYV^\b
@HWUSI-EAS1795_0092:3:1:2582:1755#0/1
GCGCTTTATCGAATCCGCTCGAGATTTGGTGCG
+HWUSI-EAS1795_0092:3:1:2582:1755#0/1
fhghhhehhhghhhhhhhhhhh_chhhfhcchf
@HWUSI-EAS1795_0092:3:1:2737:1762#0/1
CACAAATGTCAAGCCGCACCAGTGCAGCATATG
+HWUSI-EAS1795_0092:3:1:2737:1762#0/1
cdggggaggggggfaf[fffffgggdgfffff]
@HWUSI-EAS1795_0092:3:1:2805:1761#0/1
GAGGATGCCACCACCACCACCACCACCACAACA
+HWUSI-EAS1795_0092:3:1:2805:1761#0/1
hhhhhhhhhhhhhhhghhhhhghghhhhhehhh
@HWUSI-EAS1795_0092:3:1:2917:1757#0/1
ATCGTAATGGCATCAAGCGCCCGCTGCGCAAAC
+HWUSI-EAS1795_0092:3:1:2917:1757#0/1
agffYfdc\c^fgg\\gdccfcc\deea_ff[d
@HWUSI-EAS1795_0092:3:1:3018:1754#0/1
CTCCTCCTCCTGGCGATCGATCTCCACCTCGTT
+HWUSI-EAS1795_0092:3:1:3018:1754#0/1
gffgfggggg]gfff_efcadffffeefbaaeg
@HWUSI-EAS1795_0092:3:1:3229:1764#0/1
AAAATTTGGGATTTAGCTCTTCGTTTGTCGCAC
+HWUSI-EAS1795_0092:3:1:3229:1764#0/1
hghhhhhhhhghhahhghhhhhhghhaghfhhf
@HWUSI-EAS1795_0092:3:1:3476:1755#0/1
GATTGTGCTTATTCGTGCCCCCCATCTGAGCAA
+HWUSI-EAS1795_0092:3:1:3476:1755#0/1
g[ecc`edfc]daa``^ffdffcf]c[ebWddf
@HWUSI-EAS1795_0092:3:1:3982:1758#0/1
GCACAATCGCGGCCATGTGAAGCCCGTGCGCTG
+HWUSI-EAS1795_0092:3:1:3982:1758#0/1
_ffdcffddd_ffcaYYb^bb]\^]`bffc_]\
@HWUSI-EAS1795_0092:3:1:4492:1762#0/1
CGCCGTGCTCAGAGTTTTCGGACTCTGCAATCG
+HWUSI-EAS1795_0092:3:1:4492:1762#0/1
gggggggggfgfaffffgggcefffffcgggfg
@HWUSI-EAS1795_0092:3:1:5226:1753#0/1
GGGCACACGGAATGCCATTCCGGTGAGCTTACC
+HWUSI-EAS1795_0092:3:1:5226:1753#0/1
gaggggfgaegcgggafff]ace`]cbQ\\^^a
@HWUSI-EAS1795_0092:3:1:5772:1756#0/1
CTGGACATCACCACTGTCATGCGTTCGATTACG
+HWUSI-EAS1795_0092:3:1:5772:1756#0/1
hhhhghghhhhhhhhhhhhhhhhhhhhhhgfhh
@HWUSI-EAS1795_0092:3:1:6274:1759#0/1
CGGTGACCTTGTGTGTAGGGTCGTTACGAATTG
+HWUSI-EAS1795_0092:3:1:6274:1759#0/1
hhghehhhhhghhhghhhhhehhhhechhhhhg
@HWUSI-EAS1795_0092:3:1:7272:1764#0/1
GCTGAGGGCTGTAAAGTAGTATTATCTTTTGCT
+HWUSI-EAS1795_0092:3:1:7272:1764#0/1
hhhhhhhhhhhhghhhhhfghhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:7510:1760#0/1
GTCCGCTCTTGCCGCAGCCGTAGCAAGTCTTCG
+HWUSI-EAS1795_0092:3:1:7510:1760#0/1
hhhhhhhhhgghhhhhddfaghcacafgghgeh
@HWUSI-EAS1795_0092:3:1:7771:1756#0/1
AAAAGGTCTGCATGTACTTCACCTATAAAGTGC
+HWUSI-EAS1795_0092:3:1:7771:1756#0/1
ggggggggggggfgggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:7840:1761#0/1
AAAATAAATAAATATTAAGCACTTGCATCGCTT
+HWUSI-EAS1795_0092:3:1:7840:1761#0/1
OGESRRO][Z[[Zdddcd^ada\a^``aaaccf
@HWUSI-EAS1795_0092:3:1:8085:1760#0/1
ACGCACGAAGATGTCCTCCTTGTTCTTCTTGTA
+HWUSI-EAS1795_0092:3:1:8085:1760#0/1
gggfgggdfff[dbfdcggdgcggffgggf]gf
@HWUSI-EAS1795_0092:3:1:8599:1756#0/1
GTTGCTGCCGCTTCCGCTGCTGCTGATGTTACT
+HWUSI-EAS1795_0092:3:1:8599:1756#0/1
hhhhhhhhhhhghhhghhhhehehfghfhghhh
@HWUSI-EAS1795_0092:3:1:8817:1755#0/1
CACGGCCAGCACGGAAGCGCTGCGACTTGTACA
+HWUSI-EAS1795_0092:3:1:8817:1755#0/1
ggggggggggggggdggcgc_fegggggcgggg
@HWUSI-EAS1795_0092:3:1:9504:1763#0/1
GACTAAACGAACAGGAACGCGCCGAGAAGCTGC
+HWUSI-EAS1795_0092:3:1:9504:1763#0/1
ggggggggffgggfgfgffg[ggfgdgggg[ec
@HWUSI-EAS1795_0092:3:1:9623:1760#0/1
CTTGTTTCTTTATTCTTTCGCTGCTTTGGCTCT
+HWUSI-EAS1795_0092:3:1:9623:1760#0/1
ggggfgggfggcggcgggecfgggfdgaf_dgg
@HWUSI-EAS1795_0092:3:1:9971:1757#0/1
CCGTTATGGGATGTTGTCGCTCCTCCAGATACC
+HWUSI-EAS1795_0092:3:1:9971:1757#0/1
hhhhhhhhhhghghhdhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10215:1761#0/1
CTTTAAGATGGCCAAGTCCAAGAACCACACAAA
+HWUSI-EAS1795_0092:3:1:10215:1761#0/1
hhhhhhhhghhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11104:1756#0/1
CTCGTCCATCTCGTTCAGCTTAAAGTGAAACGA
+HWUSI-EAS1795_0092:3:1:11104:1756#0/1
ffffaf^dda^ddddSdadacdfdd_ff]f]ff
@HWUSI-EAS1795_0092:3:1:11505:1761#0/1
CGCGGATTTCGCTGGGCGGATTTTGAAATCGAT
+HWUSI-EAS1795_0092:3:1:11505:1761#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhgfhh
@HWUSI-EAS1795_0092:3:1:13812:1757#0/1
GGATCAGGGAATCCTTGGTATGTGTGAGGGTGA
+HWUSI-EAS1795_0092:3:1:13812:1757#0/1
ghhhhhhhhhhhhhhhghhfghfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13923:1761#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATTCCG
+HWUSI-EAS1795_0092:3:1:13923:1761#0/1
accaf]fffafcfffffccfceccfffa_efea
@HWUSI-EAS1795_0092:3:1:15228:1764#0/1
GCTGCATCTGGATCATTGGCCTGGATTGCCTTG
+HWUSI-EAS1795_0092:3:1:15228:1764#0/1
fehhhhhghhhhhfhhhhfhhhfhahhhhhhgh
@HWUSI-EAS1795_0092:3:1:15593:1755#0/1
AACCAGGCCAACGCCGATCGGAAGAAGCTTAAC
+HWUSI-EAS1795_0092:3:1:15593:1755#0/1
fhhhghhhhhhhfhhhghhhhcfhfdehhchhh
@HWUSI-EAS1795_0092:3:1:16632:1757#0/1
TAAAAATGACCAACTCAAAGGGCTATCGTCGCG
+HWUSI-EAS1795_0092:3:1:16632:1757#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhgghghh
@HWUSI-EAS1795_0092:3:1:16806:1758#0/1
GCCAAATTCAGAGCGGGCAGCGCCGAAATCGAC
+HWUSI-EAS1795_0092:3:1:16806:1758#0/1
hhhhhfhhfhhhhghghhhhahcdfcfhgdhae
@HWUSI-EAS1795_0092:3:1:17492:1753#0/1
CTGATGTAGTGCCATCTGTGGCCCGGACGATTC
+HWUSI-EAS1795_0092:3:1:17492:1753#0/1
gaggcefafffffadffafd]ffcb]`]b]`Zf
@HWUSI-EAS1795_0092:3:1:17928:1758#0/1
GTCTTCTCGTCTTTTAAATAAATTTTAGCTTTT
+HWUSI-EAS1795_0092:3:1:17928:1758#0/1
hhhhhhhhhhhhhhfhggfghehhhdhggghhh
@HWUSI-EAS1795_0092:3:1:18101:1760#0/1
TCCTCCTCCGGGCACTCCGGAATGCACACGCAT
+HWUSI-EAS1795_0092:3:1:18101:1760#0/1
hhhchhhhfdhdghhhfhhcghcehfhhhhghg
@HWUSI-EAS1795_0092:3:1:19277:1760#0/1
CCCGAGTACACCATGCCGATGTGGTTGTAGATC
+HWUSI-EAS1795_0092:3:1:19277:1760#0/1
hhhhhhhhhhhhhhhhhheafbhheefdcefgg
@HWUSI-EAS1795_0092:3:1:19464:1753#0/1
GTTTTTTGGCCTGTTGCTTGGCCTGCTTCTTGG
+HWUSI-EAS1795_0092:3:1:19464:1753#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhgf
@HWUSI-EAS1795_0092:3:1:1287:1773#0/1
TGGTCGTCCTCGGAAGCCAGCCACACCTGCGTC
+HWUSI-EAS1795_0092:3:1:1287:1773#0/1
ZU^cYR^ffff]add^SYcc^_a^d[adaSadf
@HWUSI-EAS1795_0092:3:1:2175:1764#0/1
GCCACTTGTTTAAGTTCCGATTGCAGAGTGGCA
+HWUSI-EAS1795_0092:3:1:2175:1764#0/1
ggfggggggcgfdggfggggdggdggcgdgggg
@HWUSI-EAS1795_0092:3:1:2272:1765#0/1
TGAGACTTCTTGCCACCAACATCGTGGACGGTT
+HWUSI-EAS1795_0092:3:1:2272:1765#0/1
ffefedYaa\_T_aYaa\cadddYddYba`\\V
@HWUSI-EAS1795_0092:3:1:3134:1775#0/1
CACAAATATAGCAGAAACGTCGATCACCATACC
+HWUSI-EAS1795_0092:3:1:3134:1775#0/1
ffaffffgggggfdggggggfgcefffcfcfff
@HWUSI-EAS1795_0092:3:1:3288:1775#0/1
CCTTGGAGTAACGCAGGATACCGCCCTTCAGGT
+HWUSI-EAS1795_0092:3:1:3288:1775#0/1
gcf^affffddf]aab^adeeefcfefdfacfc
@HWUSI-EAS1795_0092:3:1:3355:1765#0/1
GAGGGTTTTCACGAAGATCTGCATAATGGCGGC
+HWUSI-EAS1795_0092:3:1:3355:1765#0/1
gfgggcfgggggggcggggggggggffgggggc
@HWUSI-EAS1795_0092:3:1:3592:1771#0/1
CGCGGGCGGGATTCTGCAGGATTTCGGAGGTCG
+HWUSI-EAS1795_0092:3:1:3592:1771#0/1
hhhhhhhhhhchhffghffhcghhhghddf_d_
@HWUSI-EAS1795_0092:3:1:3617:1774#0/1
CGCCGCACCTTCTGCAAGAAGTGCAAGGTCCAC
+HWUSI-EAS1795_0092:3:1:3617:1774#0/1
gggggggggggggggggdfffdgggggfggggg
@HWUSI-EAS1795_0092:3:1:3863:1768#0/1
TAAAAAAGCCCACCAGGCAATTCGTAACGACCC
+HWUSI-EAS1795_0092:3:1:3863:1768#0/1
hhghhghgchhgfghhhhehhhheghghfghhh
@HWUSI-EAS1795_0092:3:1:4330:1774#0/1
AATCAATCGGCGTCCGAAAAGCGTACGTGAACC
+HWUSI-EAS1795_0092:3:1:4330:1774#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:4466:1770#0/1
TCCGCGCTCACCCTTAGGGCCAGGAGCACCGGT
+HWUSI-EAS1795_0092:3:1:4466:1770#0/1
affc]_fd_W[ab]``]^dda]fa_ffcafcfe
@HWUSI-EAS1795_0092:3:1:5466:1773#0/1
TCCGAATTGTCCTTCTTCTCCTCACCCTCCTTG
+HWUSI-EAS1795_0092:3:1:5466:1773#0/1
hhhhhhhhhhhhhhghhghhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5732:1767#0/1
GTGGCGAGGAAACCGTCCGTCCTGCAGCTTAGT
+HWUSI-EAS1795_0092:3:1:5732:1767#0/1
hhhhhhhhhhhhfgghghhgdfdhhgcchhahg
@HWUSI-EAS1795_0092:3:1:6145:1774#0/1
GGGTAGCCCACGGACAAACAAACGGCGGCCAAG
+HWUSI-EAS1795_0092:3:1:6145:1774#0/1
hhhhhhhhhfhghhhhhhhhhhhcdhc^a`^`b
@HWUSI-EAS1795_0092:3:1:6500:1765#0/1
CTGGAGAAGGGCTTGGGACCCAAACGTGGAATA
+HWUSI-EAS1795_0092:3:1:6500:1765#0/1
gggdfagadcfffeefegggggg_fggggcggg
@HWUSI-EAS1795_0092:3:1:6801:1771#0/1
GGGTTTTCTAGTTTAATGTTAATACTAGTTAAT
+HWUSI-EAS1795_0092:3:1:6801:1771#0/1
hhhhhhhhhhhghhhhhhhhchhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:7042:1771#0/1
GGGCGAAACGCCTACGGTCTTCTGAAGCAGCTT
+HWUSI-EAS1795_0092:3:1:7042:1771#0/1
hchhhghhhhfhhhghhhhhhghhhdhhhghhh
@HWUSI-EAS1795_0092:3:1:7211:1775#0/1
CAGAACCTCGTTGGCAATCTTCGAGGCGTCCAG
+HWUSI-EAS1795_0092:3:1:7211:1775#0/1
hhhhhhhhhhhhhhhhgfhhfhhhhhhghhhgh
@HWUSI-EAS1795_0092:3:1:7572:1775#0/1
GAACAACACTACTTTATATTTGATATGAATGGC
+HWUSI-EAS1795_0092:3:1:7572:1775#0/1
Rfhhhhfhhhhhhhhhhghhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7591:1765#0/1
GCTGGTGCCTGAAGAAATGTTTCGTTAAGTTTT
+HWUSI-EAS1795_0092:3:1:7591:1765#0/1
hhhhhehfhhheggdehhhhhhhhghhhchhhh
@HWUSI-EAS1795_0092:3:1:7787:1771#0/1
TCCGGCAGTTGGACCCCTCAATGGCTTCCAAAA
+HWUSI-EAS1795_0092:3:1:7787:1771#0/1
ggggggdfffcffdfffcfcdcfffffggfgdd
@HWUSI-EAS1795_0092:3:1:7888:1770#0/1
ATTTTATTGGGTTTTTTGTAGAAATTTACAAAT
+HWUSI-EAS1795_0092:3:1:7888:1770#0/1
Sfdf_ccfcffadfdfcggg[ed[ffdgaggcg
@HWUSI-EAS1795_0092:3:1:7975:1769#0/1
CTCGAGTTTGGTCGCCAATTAGCGCAGCCTCCT
+HWUSI-EAS1795_0092:3:1:7975:1769#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8668:1766#0/1
GGCCAGGGGCTTCTCCTGCCACACGGCGCACAG
+HWUSI-EAS1795_0092:3:1:8668:1766#0/1
gaffda[b`dbbcacfccade]gggbaeeWbbe
@HWUSI-EAS1795_0092:3:1:9024:1770#0/1
AGAAAATCTGGTCCAAGATTCCCGATTTGGCTG
+HWUSI-EAS1795_0092:3:1:9024:1770#0/1
hhfhhchhgghhhhhgghhhgggfhghfhhhgh
@HWUSI-EAS1795_0092:3:1:10336:1775#0/1
ATAATGTAGGTAAGGGAAGTCGGCAAATTAGAT
+HWUSI-EAS1795_0092:3:1:10336:1775#0/1
acfffffdffffcfffff]ddccdcdefaafaa
@HWUSI-EAS1795_0092:3:1:10712:1765#0/1
CAGCGGTGTAAAGTGTGATGTTCCTGTAACGAC
+HWUSI-EAS1795_0092:3:1:10712:1765#0/1
f_eaccbc`eede]WbefdWfffff]ffccWdf
@HWUSI-EAS1795_0092:3:1:10791:1766#0/1
CTTAAATTTACTTAAAACAAATGTGACTATTCA
+HWUSI-EAS1795_0092:3:1:10791:1766#0/1
ggggfgggfgcgfafffggggcgggegf_ggdf
@HWUSI-EAS1795_0092:3:1:11374:1770#0/1
GCGGTATATTCCGGCGTCCGTTTAGCCTCCAGA
+HWUSI-EAS1795_0092:3:1:11374:1770#0/1
hhhhhhhhhhhhhhhfhhghfhhehhhhhhfhe
@HWUSI-EAS1795_0092:3:1:11857:1772#0/1
CGAAGAAGAAACCCACGTGGAATACAGTTCTCT
+HWUSI-EAS1795_0092:3:1:11857:1772#0/1
gfgf_ggeggcggfggaeffefgdegcgegggf
@HWUSI-EAS1795_0092:3:1:12212:1771#0/1
AGTGGGTACTTGATGGCCGCCTCGGTGGTCAGT
+HWUSI-EAS1795_0092:3:1:12212:1771#0/1
hhhhhhhhhhgfcffchghhhhfffehhdfhff
@HWUSI-EAS1795_0092:3:1:12400:1773#0/1
CCGAGAAGGCCACCAAGGGCAAGAAGTAGCTGG
+HWUSI-EAS1795_0092:3:1:12400:1773#0/1
hghdhhhdhhhhhhhhhhhhhfhhhffhhhfhg
@HWUSI-EAS1795_0092:3:1:13317:1767#0/1
GCGGATGCCGCCAAGCGCGACGCGAGCCATGTG
+HWUSI-EAS1795_0092:3:1:13317:1767#0/1
hhhhhhhhhhhhhhgfhehcghghgfhgdeh_f
@HWUSI-EAS1795_0092:3:1:13940:1771#0/1
CAACAATGGCAAAGACACGCTGATTGAGTTCTA
+HWUSI-EAS1795_0092:3:1:13940:1771#0/1
hhhhghhhhhghhehghhhhhghhgghhehhhg
@HWUSI-EAS1795_0092:3:1:14178:1772#0/1
CTACCTCTTAACTTACCATTTCAGGTTCACCCT
+HWUSI-EAS1795_0092:3:1:14178:1772#0/1
hhhhhhhhhhhhhhhhhghhhfhhchhghhhhh
@HWUSI-EAS1795_0092:3:1:14639:1766#0/1
CGGCCAGTGCTTCATGTCAGACTGCACGGCGGC
+HWUSI-EAS1795_0092:3:1:14639:1766#0/1
ffdffffghhhhh_hghhhhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15186:1765#0/1
TAACAATGGAGCGTCTATTGATCAACACGATAT
+HWUSI-EAS1795_0092:3:1:15186:1765#0/1
hhghhhhfhhhhhhhhhW]\ZZhghghhhhhga
@HWUSI-EAS1795_0092:3:1:15326:1767#0/1
GTCATGTACCACAGTTCCTGGGGTCCAAAAGCG
+HWUSI-EAS1795_0092:3:1:15326:1767#0/1
]YVa]aaBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:15419:1773#0/1
GGACACCAACACGGACTCCAATGTCCGCTGGCA
+HWUSI-EAS1795_0092:3:1:15419:1773#0/1
dfdfffadffcfda]ffcfcddffffd[cfcaf
@HWUSI-EAS1795_0092:3:1:16110:1770#0/1
GCAACTGCTGGCAAAACTGCCGCTGACGTCCTC
+HWUSI-EAS1795_0092:3:1:16110:1770#0/1
hhhhhhhhhhhhhhhhhhhhhghghhhhghhhh
@HWUSI-EAS1795_0092:3:1:16255:1770#0/1
CTTCAGTGGCTTATCGTCCTTCAGCCAGGTGAC
+HWUSI-EAS1795_0092:3:1:16255:1770#0/1
hhghhhhhhhhhhhhhhhhhhhhhhhhhhhchh
@HWUSI-EAS1795_0092:3:1:16399:1766#0/1
CAAACTGAATGCCTCCGAGGCATATGAGAAGGC
+HWUSI-EAS1795_0092:3:1:16399:1766#0/1
hhhhhhghhhghhhhhhhhhghahhfhhhhhdh
@HWUSI-EAS1795_0092:3:1:16600:1770#0/1
TGCTGCCCGAGGACAAGGGGCACAACTTCCTGG
+HWUSI-EAS1795_0092:3:1:16600:1770#0/1
fffcfffgdggggggfgggg]ggggggggfgga
@HWUSI-EAS1795_0092:3:1:16734:1769#0/1
GAGGAGTCCGACGAGGACGACGATGATGAGAGC
+HWUSI-EAS1795_0092:3:1:16734:1769#0/1
hhhhhhhhhhhhhhhghhghhheghhehhhfgh
@HWUSI-EAS1795_0092:3:1:17065:1771#0/1
CAAAAACGCGGCGCGGCAGATGCCGTATTGCCG
+HWUSI-EAS1795_0092:3:1:17065:1771#0/1
gggggggfaafffafcaZ`]NVd``WdKMSVSc
@HWUSI-EAS1795_0092:3:1:17206:1770#0/1
AAAGGGAGACAAGGGTGACCGAGGACTCCAAGG
+HWUSI-EAS1795_0092:3:1:17206:1770#0/1
ghhhhhhhhhhhhhhehffhffhhhghhgghhf
@HWUSI-EAS1795_0092:3:1:17318:1764#0/1
TCCTGCTTAACGTAAGTGCTCTTCTGCCGCTGG
+HWUSI-EAS1795_0092:3:1:17318:1764#0/1
hhhghhhhhhhfhhhhahhghgghhdhhhghhh
@HWUSI-EAS1795_0092:3:1:17391:1765#0/1
GGACAAGAAGCGGAACATCCGCAACATGTCTGT
+HWUSI-EAS1795_0092:3:1:17391:1765#0/1
fafdfffdffffcacffXabaafcff[cbfcf^
@HWUSI-EAS1795_0092:3:1:18382:1765#0/1
AAAACACAAAATAAAGGAACAACTCACCAAAGT
+HWUSI-EAS1795_0092:3:1:18382:1765#0/1
hhhhhhhhhhhhhhhhfhhfhffffffhhhhhh
@HWUSI-EAS1795_0092:3:1:18623:1770#0/1
CAGGGGTCTCAAGGGCGAGGCGGATCGCTTCAT
+HWUSI-EAS1795_0092:3:1:18623:1770#0/1
hhghhhghhhhhhhhhhhhhhhhhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:1593:1784#0/1
TGATAGTGCCCTGCATGTGGCGTGCCAGCAAGA
+HWUSI-EAS1795_0092:3:1:1593:1784#0/1
W^cfacfQYd\cT^dd\dTaSddcSWdBBBBBB
@HWUSI-EAS1795_0092:3:1:2220:1779#0/1
GCAGATCTTCGTTAAGACCCTCACTGGCAAGAC
+HWUSI-EAS1795_0092:3:1:2220:1779#0/1
_f^SYa\^a\^cda[[dc\ZaYUYUSTddaYca
@HWUSI-EAS1795_0092:3:1:2821:1786#0/1
GCTTCACGAACAAGATGTCCCTGCCCATAATGC
+HWUSI-EAS1795_0092:3:1:2821:1786#0/1
ggacggggfgggf]f[cfffffeggeffdfcfc
@HWUSI-EAS1795_0092:3:1:2843:1777#0/1
CTGGAGAGCACCAACGCCCGTCTGGCGCTGGTG
+HWUSI-EAS1795_0092:3:1:2843:1777#0/1
ffbffcffffffYdd`d__\Q_acd\dYa^d^d
@HWUSI-EAS1795_0092:3:1:3081:1779#0/1
GTAAATGCCAGGCACCTGAGTGTTACCACCCAC
+HWUSI-EAS1795_0092:3:1:3081:1779#0/1
gggggggg^ggfa\fgggacfgf[ff[fcfc`f
@HWUSI-EAS1795_0092:3:1:3323:1787#0/1
CAGGAATCTAGTTCAGATAAGCCAGCGCCTTGG
+HWUSI-EAS1795_0092:3:1:3323:1787#0/1
hhghhhhhhhhhhhhhhgghggfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3438:1786#0/1
GCGAAGTTTGCGTCAAGACGGTTAGGCGGTTCG
+HWUSI-EAS1795_0092:3:1:3438:1786#0/1
f^dcaddaaa^^dd^dcdddddffaffdffffa
@HWUSI-EAS1795_0092:3:1:4049:1784#0/1
GGACCTGATACCCTTGGACCAGATGTGCTTGTT
+HWUSI-EAS1795_0092:3:1:4049:1784#0/1
hhhhhhhhhhhhhhhdhhhhhcfhdghhhhehh
@HWUSI-EAS1795_0092:3:1:5155:1787#0/1
CAAGTTCCCCTACACCGCGCCCACGCGCATCGT
+HWUSI-EAS1795_0092:3:1:5155:1787#0/1
ggggggcgggggfgggggfgggggggggegggg
@HWUSI-EAS1795_0092:3:1:5994:1783#0/1
GTGGCTTTAAGCTCTGGATGCGTAACGTGAGCC
+HWUSI-EAS1795_0092:3:1:5994:1783#0/1
hhhhhhhhhhhhhhhhhhghfhghhhhhhfhhg
@HWUSI-EAS1795_0092:3:1:6074:1784#0/1
GCTGTACAAGAACAAGGAGACCGGCGCCTCCAA
+HWUSI-EAS1795_0092:3:1:6074:1784#0/1
ggggcgggfgggggggfgfgg^fdaffffdcfg
@HWUSI-EAS1795_0092:3:1:6514:1777#0/1
TTATCTTGATGTCCGGCATTTCTGGAAGGGATC
+HWUSI-EAS1795_0092:3:1:6514:1777#0/1
hhhhgdhghhhhhfhgfhhghghhhhghhhhhc
@HWUSI-EAS1795_0092:3:1:7746:1784#0/1
CCTATGTAGAGTATGTGCTATGTCTTGTATACA
+HWUSI-EAS1795_0092:3:1:7746:1784#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhehhhggh
@HWUSI-EAS1795_0092:3:1:7830:1785#0/1
GAAAATGATTTGCGATGATGGTCACACATTTAC
+HWUSI-EAS1795_0092:3:1:7830:1785#0/1
gcgggggggggfdffWaffffcfdfffgggggg
@HWUSI-EAS1795_0092:3:1:8301:1782#0/1
CGACCGAGCAAATGGCCGCGACCATCAATAACA
+HWUSI-EAS1795_0092:3:1:8301:1782#0/1
hhhhhhhhhhhhghhhhghhghhhhghhghghh
@HWUSI-EAS1795_0092:3:1:8584:1783#0/1
AAAAAGGATGTCGCGTCACACACACACATACAA
+HWUSI-EAS1795_0092:3:1:8584:1783#0/1
hhhhhhhghghhhhhhhhhhghghhhhhghhhh
@HWUSI-EAS1795_0092:3:1:8769:1784#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8769:1784#0/1
f\cY^ba_\^W_fffcffff^a^Z__Z_\\]_^
@HWUSI-EAS1795_0092:3:1:8884:1781#0/1
CTACATTCGGTGGCGAAGTTGGCTCAGAGGAAT
+HWUSI-EAS1795_0092:3:1:8884:1781#0/1
hhhhhhhhhhhhhhhghhhhhhghhhhghhghh
@HWUSI-EAS1795_0092:3:1:9522:1786#0/1
GCTGATTCGGTTTTTTCGATTGCCTTTCTCACG
+HWUSI-EAS1795_0092:3:1:9522:1786#0/1
hghhhhhhhhhhhhhhhhgghghhghgghghhh
@HWUSI-EAS1795_0092:3:1:9647:1780#0/1
AGAACAGGCAGGGGGCCAATATGGACTTGTAAA
+HWUSI-EAS1795_0092:3:1:9647:1780#0/1
gggggggggggfgggfgcgcfgggggdggggfg
@HWUSI-EAS1795_0092:3:1:9987:1778#0/1
TGATCTTCTCACCGGTGACGGCGACATCGTCAT
+HWUSI-EAS1795_0092:3:1:9987:1778#0/1
hghhhghhhhhhhhhhhhghahhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10389:1776#0/1
ATCTGGTCTTCCCCGCCGAGATTGTGGGCAAGC
+HWUSI-EAS1795_0092:3:1:10389:1776#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10464:1782#0/1
GGATCCCCAACAACGTGAAGACCGCCGTGTGCG
+HWUSI-EAS1795_0092:3:1:10464:1782#0/1
hhhhhhhhhhhhhhhhhhhcghhghghgeeghh
@HWUSI-EAS1795_0092:3:1:10539:1787#0/1
GCCGAGCATGTCTTCTATCTGGGCCTTAAACAG
+HWUSI-EAS1795_0092:3:1:10539:1787#0/1
ffffffdaffdfXYV[Vaaa\aadaac\Z`\\_
@HWUSI-EAS1795_0092:3:1:11030:1782#0/1
GGGAATTCGGCAGGAGGAGATCGTTGCGCTGCA
+HWUSI-EAS1795_0092:3:1:11030:1782#0/1
gggggggggggggggggffdffggggggggggg
@HWUSI-EAS1795_0092:3:1:11059:1781#0/1
GTTCCAAGTCCATCCACCGCGACTCCCGTTCAC
+HWUSI-EAS1795_0092:3:1:11059:1781#0/1
hhhhhhhhhhhhfhhhhhghehhghhhhhhdch
@HWUSI-EAS1795_0092:3:1:11341:1783#0/1
GTGGATCTCGGAGTTATTGTAGAAGTTGATCTG
+HWUSI-EAS1795_0092:3:1:11341:1783#0/1
hhhhhhhhhhfdhhhhhghhhhghhhhhghhhh
@HWUSI-EAS1795_0092:3:1:11584:1785#0/1
GGGCATTCGTGCTGATGATCTTGAGGATATCTA
+HWUSI-EAS1795_0092:3:1:11584:1785#0/1
PPO``ZT``b]^dWdaac^ccaV^^Z]fff]fa
@HWUSI-EAS1795_0092:3:1:11939:1787#0/1
CGAAGAGTCCGGCGAGCATATCATTGCTGGTGC
+HWUSI-EAS1795_0092:3:1:11939:1787#0/1
hhhhhhhhhhhhhgggchghhcahhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:12100:1784#0/1
TGCTGATGGAGCGGCTACCGTGATCGCCGATTG
+HWUSI-EAS1795_0092:3:1:12100:1784#0/1
gggggggggggggggggggc[fc[fccfa`]cg
@HWUSI-EAS1795_0092:3:1:12176:1776#0/1
CCTGCCAGCAAGATCAATGTGGGCGTGGCCCCC
+HWUSI-EAS1795_0092:3:1:12176:1776#0/1
gggggggggdgdffcfffcffffffdBBBBBBB
@HWUSI-EAS1795_0092:3:1:12893:1786#0/1
AAGGAAGATGATGTGCGTCGCTTCGTTGTGCGT
+HWUSI-EAS1795_0092:3:1:12893:1786#0/1
hhhhhhgchchheghhhhhhfghhghehhhdgh
@HWUSI-EAS1795_0092:3:1:13407:1780#0/1
TGCAGTCCAGCACGGATACGACCTTAGAGGCGT
+HWUSI-EAS1795_0092:3:1:13407:1780#0/1
ffffcfffffafffaY]ffWafede[aaa[ac`
@HWUSI-EAS1795_0092:3:1:13737:1782#0/1
TAAATATCAGTTGGATATTATTATTCTAAATAG
+HWUSI-EAS1795_0092:3:1:13737:1782#0/1
gggfggggggggffddfggdgggggfcffeffc
@HWUSI-EAS1795_0092:3:1:13784:1780#0/1
GTTCGAATAATTCACCCCTGGCCACGCCGCCTG
+HWUSI-EAS1795_0092:3:1:13784:1780#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14084:1783#0/1
GTGACGATGATCGCGCCCCGCCTGCCGTCGCGT
+HWUSI-EAS1795_0092:3:1:14084:1783#0/1
caaccac^^aXaU\G[_BBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14270:1786#0/1
CATTGATGAACATGTCGTCGTCCGTCTTGAGAA
+HWUSI-EAS1795_0092:3:1:14270:1786#0/1
hhhhhhhhhhhhhhhhhhhaghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:14622:1778#0/1
GACCTGGGATCGCTTCCAGATGAGAATCCACAA
+HWUSI-EAS1795_0092:3:1:14622:1778#0/1
UX^`\_^YSaaZ\daddfffffffcc[dda]da
@HWUSI-EAS1795_0092:3:1:15170:1786#0/1
CCGTCGCCGAGGTCCATCATGCGTTAGGACTGG
+HWUSI-EAS1795_0092:3:1:15170:1786#0/1
hhhhhhhhhhhhbffff]caccebdddeghghd
@HWUSI-EAS1795_0092:3:1:15345:1783#0/1
CCCAGAATGGTGGACAGCCGTGCTCCAAGCGCC
+HWUSI-EAS1795_0092:3:1:15345:1783#0/1
hhhgghhhhghhhgfhghahdhhhhhhhegfhh
@HWUSI-EAS1795_0092:3:1:16327:1787#0/1
GATTGATTCGATTGGCGATTGGCTGCCCGCAGA
+HWUSI-EAS1795_0092:3:1:16327:1787#0/1
accfffffff__eacecYccccffffffac__]
@HWUSI-EAS1795_0092:3:1:16487:1780#0/1
ATTTGAAGCATAATACAAGAGGTATTCCAAGCC
+HWUSI-EAS1795_0092:3:1:16487:1780#0/1
fhhhhdgfhhchhgfhhhh^hhcafdfeghhch
@HWUSI-EAS1795_0092:3:1:16550:1784#0/1
ACGACAACTGCGCCACCTGAGGTACAGGGATGG
+HWUSI-EAS1795_0092:3:1:16550:1784#0/1
fefa_fdfffffgggggffaffKZWU\efbfad
@HWUSI-EAS1795_0092:3:1:16829:1782#0/1
CTAAGATTGGCCGTTTGACCCTCCCAAAAGGGA
+HWUSI-EAS1795_0092:3:1:16829:1782#0/1
[_^]__ZYZX\\abba]aaa`Xd___d^a^OaZ
@HWUSI-EAS1795_0092:3:1:16976:1783#0/1
CCTCCTTTCGTCCGTTCTGCAGTTGCTGTAGAT
+HWUSI-EAS1795_0092:3:1:16976:1783#0/1
hhghhhhhhhhhhfhhhhchdhchfhhghhhah
@HWUSI-EAS1795_0092:3:1:17510:1783#0/1
GGGATCTTCCAACTCGTACGCCATCAAGAAGAA
+HWUSI-EAS1795_0092:3:1:17510:1783#0/1
ggggegggggfeffggffgggfcggggffQfa]
@HWUSI-EAS1795_0092:3:1:18236:1783#0/1
TTATCTTTCAATTGTTTAAAAGGAAGTCTTGCC
+HWUSI-EAS1795_0092:3:1:18236:1783#0/1
hhhhhhhhhhhhhhhhhhhhhhghhghhhhhhh
@HWUSI-EAS1795_0092:3:1:18764:1779#0/1
CCCAGTGCCCCATTGTGGAGCGTTTGACCTGCT
+HWUSI-EAS1795_0092:3:1:18764:1779#0/1
gggggggggggggggcgfcfffcffcfdf_fcf
@HWUSI-EAS1795_0092:3:1:19118:1787#0/1
TCTGGATCAGCTTGCGGATGGACTTGGTCACCT
+HWUSI-EAS1795_0092:3:1:19118:1787#0/1
dYffcffccf^fffffc^Ua\^ac\ccQb`baf
@HWUSI-EAS1795_0092:3:1:19435:1779#0/1
CTCCGGTTCCGGCGGCGACAATCAGCACGGCGC
+HWUSI-EAS1795_0092:3:1:19435:1779#0/1
gggggggggggggggffeggg[ggdgggggfgc
@HWUSI-EAS1795_0092:3:1:19494:1786#0/1
TGGCGATGGCATTGGACTCGCTCAAGTACTGTC
+HWUSI-EAS1795_0092:3:1:19494:1786#0/1
gggggdagggffgggggggggecfdfdgfgfeg
@HWUSI-EAS1795_0092:3:1:19527:1781#0/1
TGAGTGCAGATCAAGATCGGCTGGATTTACTAG
+HWUSI-EAS1795_0092:3:1:19527:1781#0/1
ggffeffggdcgggggggggfgggecgf]ddeg
@HWUSI-EAS1795_0092:3:1:1746:1793#0/1
TTTGGCTCTCGTGGTGGTCGTGGTGGACGCGGG
+HWUSI-EAS1795_0092:3:1:1746:1793#0/1
_WYa_abc_ccacYa_Sa\^Za\Z]\KZ^BBBB
@HWUSI-EAS1795_0092:3:1:2039:1792#0/1
CAGCAATCCATGGCGCCGAGGACCACATGGCCA
+HWUSI-EAS1795_0092:3:1:2039:1792#0/1
ffdcd`S^dd\Saa\UaW_P_\bb^ddadcaff
@HWUSI-EAS1795_0092:3:1:2650:1788#0/1
CCGAAACGAAAAACGCCGACTGGGTAGCCCTAA
+HWUSI-EAS1795_0092:3:1:2650:1788#0/1
gggggggggggggadggggga]d]`ebfffafg
@HWUSI-EAS1795_0092:3:1:2740:1796#0/1
CTCGAATGGATGCAGGCTGGGCTGTGTGTAAGT
+HWUSI-EAS1795_0092:3:1:2740:1796#0/1
gggggggggggddcddf]ffdfgggggeeaggg
@HWUSI-EAS1795_0092:3:1:2977:1789#0/1
AACGTAAAGCTTGAGGATCTGGCCGCCGAGATC
+HWUSI-EAS1795_0092:3:1:2977:1789#0/1
ghhhhhhchhhhhgghcghgcbfacffeaddah
@HWUSI-EAS1795_0092:3:1:3227:1799#0/1
GCAACCACCAACGCGGAAAAGACTCATTTTTGT
+HWUSI-EAS1795_0092:3:1:3227:1799#0/1
hhhhhhhhhhhhfgfhhghfgeghhghhhhhhg
@HWUSI-EAS1795_0092:3:1:3820:1798#0/1
ACAGATCGGATTCATTACCAATCCATTTCCAGA
+HWUSI-EAS1795_0092:3:1:3820:1798#0/1
gggggggggggggggffedfffgfcgggg_ggf
@HWUSI-EAS1795_0092:3:1:4000:1791#0/1
CGGGAGGTACACATGAGTGCTTGGAGCAGCACA
+HWUSI-EAS1795_0092:3:1:4000:1791#0/1
hhhhhhgghhhhhhegfhhhhhhgghgfhhhhh
@HWUSI-EAS1795_0092:3:1:4526:1790#0/1
GCGAGGAGCTCCGCGGGCACAGATCAAAGCTAG
+HWUSI-EAS1795_0092:3:1:4526:1790#0/1
ggggggfgggegfdfffcgfgeeeffdgaeaga
@HWUSI-EAS1795_0092:3:1:4612:1795#0/1
CCTCGAGCTGCTTTCCGGCGAAAATCAAACGCT
+HWUSI-EAS1795_0092:3:1:4612:1795#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhfhhhhhhg
@HWUSI-EAS1795_0092:3:1:4810:1793#0/1
CCACCGCCATTGCTGCCAGTATCGCCGCTCTCC
+HWUSI-EAS1795_0092:3:1:4810:1793#0/1
gaggggffffdfcReeeffffaffffWdX`\aV
@HWUSI-EAS1795_0092:3:1:5458:1794#0/1
GGAGAAGGGCGTCTACGTGCGGCACATTGAGCA
+HWUSI-EAS1795_0092:3:1:5458:1794#0/1
hhhhhhhhhhghhhghhhfghehhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:5565:1791#0/1
CAGTAGCTGATGGAATATATCTCCCACGGACTC
+HWUSI-EAS1795_0092:3:1:5565:1791#0/1
hhhhhhhhhhhhhhggghghhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5731:1789#0/1
TGTGGAAGTACAAGCCGCAGGCGCTGTGCAGGA
+HWUSI-EAS1795_0092:3:1:5731:1789#0/1
ggggggdfffdffcfffgcgfgff_fcacccfg
@HWUSI-EAS1795_0092:3:1:6351:1792#0/1
CTCGCCAACTTAATGATTCTAAATCTACGGCAT
+HWUSI-EAS1795_0092:3:1:6351:1792#0/1
hhhhhhhhhhhhhhghghhhhhhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:6390:1799#0/1
CGGGAACGCGTCGGCGTGGAGCGCAACGGATGA
+HWUSI-EAS1795_0092:3:1:6390:1799#0/1
ggggggggggggfccfdgggfdggggfggfggg
@HWUSI-EAS1795_0092:3:1:6697:1790#0/1
GCCAACCAGAAGGGCATCCAACTCTTGTCCTTG
+HWUSI-EAS1795_0092:3:1:6697:1790#0/1
hhhhhhhhhhhghhhfhhhehhfghhhhhhgfh
@HWUSI-EAS1795_0092:3:1:6824:1794#0/1
CTGACAACAAACGCTCGTTCTGCATGTACATCC
+HWUSI-EAS1795_0092:3:1:6824:1794#0/1
hhghhhhhhhhhhhhghhhhcfhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8513:1792#0/1
AATACGGCAACTCATCTAACACGAACGGACGCA
+HWUSI-EAS1795_0092:3:1:8513:1792#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8692:1791#0/1
CTCCAATTAATGCTCCAGGATGTCCTAATTCAG
+HWUSI-EAS1795_0092:3:1:8692:1791#0/1
ggggfagfafaffcfcfggggggggWggccggg
@HWUSI-EAS1795_0092:3:1:9099:1797#0/1
GTTCGGTGTCCATTGCTGGAGACCTACTCAAAT
+HWUSI-EAS1795_0092:3:1:9099:1797#0/1
hhhhhhhhhhhghhhhhehghghhhhfgghhch
@HWUSI-EAS1795_0092:3:1:9120:1791#0/1
TATGGAAATATAATTTTCTATTTGTAAATGGAG
+HWUSI-EAS1795_0092:3:1:9120:1791#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:9898:1799#0/1
CTGGAAATCAGTACACCCCCGTACTCGAATCCT
+HWUSI-EAS1795_0092:3:1:9898:1799#0/1
hfghhhhhghhhhhhhhhhhhahhchhhhfhgg
@HWUSI-EAS1795_0092:3:1:10372:1795#0/1
GGAAAGAGTCCGTAGCGGTTCTTGCACAATCCC
+HWUSI-EAS1795_0092:3:1:10372:1795#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10610:1792#0/1
CTTCTAGTTTCTCCACATAGGATTCAGGGAACC
+HWUSI-EAS1795_0092:3:1:10610:1792#0/1
ffcffcfafffcdffdffffff]deecfdffd_
@HWUSI-EAS1795_0092:3:1:10982:1798#0/1
CGTCCAACCATTCATTCCAGCCTTCAATTAAAA
+HWUSI-EAS1795_0092:3:1:10982:1798#0/1
hhhhhhhhhhhhhhhhhhhhfhhghhhhgghhh
@HWUSI-EAS1795_0092:3:1:11175:1790#0/1
TGATGATTTTGTTGAAGGGCTCGGCGGCCTTCG
+HWUSI-EAS1795_0092:3:1:11175:1790#0/1
hhhhhhhhhghhhhhfhhhhhghghhhhhefdh
@HWUSI-EAS1795_0092:3:1:11245:1788#0/1
CGAGGTTCTTAATCAAGTCCTTCTTCTTGCTGT
+HWUSI-EAS1795_0092:3:1:11245:1788#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11723:1790#0/1
CTGCAGCAAATCGATGGACACCTTGTCGTCCTC
+HWUSI-EAS1795_0092:3:1:11723:1790#0/1
hhhhhhghhhhhhhfghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12048:1794#0/1
CGGCGCAATCGGCCTGCGAGGTACCAGTGATCA
+HWUSI-EAS1795_0092:3:1:12048:1794#0/1
fffWff]dcfffccaecabacWeedabcd[cff
@HWUSI-EAS1795_0092:3:1:12196:1793#0/1
CTAAAATATCACAATTTTTTAAAGATAGAAACC
+HWUSI-EAS1795_0092:3:1:12196:1793#0/1
hhhhhhhghhhhhghhhhhhhhhhhhehhhhhh
@HWUSI-EAS1795_0092:3:1:12354:1788#0/1
TATCCCTGCAACGGACTCATCGTCCTGGCGATA
+HWUSI-EAS1795_0092:3:1:12354:1788#0/1
hhhhhhfhhhhhhhhhhhhehghhhghhhhfhh
@HWUSI-EAS1795_0092:3:1:12713:1791#0/1
GCTGACCAGCAGATTCTTTAGTACCGAGTTCGA
+HWUSI-EAS1795_0092:3:1:12713:1791#0/1
gggfggggggggggggggggfggggggggcggg
@HWUSI-EAS1795_0092:3:1:12960:1793#0/1
CGTGACTGCCCTGGAGCGTTCGACCAACAAGGA
+HWUSI-EAS1795_0092:3:1:12960:1793#0/1
faggdggffff]fcacfafffdfcfacffed]f
@HWUSI-EAS1795_0092:3:1:13102:1788#0/1
GGCAGGTTAGACTTTATATATAATTCAAAAAGA
+HWUSI-EAS1795_0092:3:1:13102:1788#0/1
cY\\^aac^aaa_aaS_a^_Yaaaacaccc_^`
@HWUSI-EAS1795_0092:3:1:13364:1790#0/1
AGGAGAGCAGAAGCGGAAACGCAGAGAGCGAAA
+HWUSI-EAS1795_0092:3:1:13364:1790#0/1
hhhhhhhhhghhghhgghhhhghhghhhgghhg
@HWUSI-EAS1795_0092:3:1:13424:1789#0/1
GGAGGAGTTGATCGACAAGATTAGAACCAACGT
+HWUSI-EAS1795_0092:3:1:13424:1789#0/1
hhhghfhdhhffhhhfhhahghhfhfhhf_dfh
@HWUSI-EAS1795_0092:3:1:13874:1789#0/1
CAAAGGGCTATCGTCGCGGCACACGGGACATGT
+HWUSI-EAS1795_0092:3:1:13874:1789#0/1
]^a^a^^VT\V\VT^^V_ZZZZPYPHJbPX^]Z
@HWUSI-EAS1795_0092:3:1:14204:1789#0/1
GGAGTCCATGTGCTCCATGGCCGCCAAGCTGGC
+HWUSI-EAS1795_0092:3:1:14204:1789#0/1
gggggggggegg^affedfa\ffffffgfgcfg
@HWUSI-EAS1795_0092:3:1:14347:1791#0/1
TTTCAAACCGTGCGGTCGCTTAGCTCAGCCTCG
+HWUSI-EAS1795_0092:3:1:14347:1791#0/1
hhhgghhhhhhhhhghhgcgehhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:14859:1797#0/1
TATTACGATACGTTCGCGTTCGTGTAACTTTGT
+HWUSI-EAS1795_0092:3:1:14859:1797#0/1
ggggggggcgggggggggfggggcfgfggggfg
@HWUSI-EAS1795_0092:3:1:14920:1799#0/1
CGTGCTTCGCCAGCGAATCTCGTCGTCTTCTTC
+HWUSI-EAS1795_0092:3:1:14920:1799#0/1
gggafggggggdggd]gggagaaffafafcffg
@HWUSI-EAS1795_0092:3:1:15312:1796#0/1
TATGTACTCATTATATACGAAGATACATTTAGC
+HWUSI-EAS1795_0092:3:1:15312:1796#0/1
hhhfhhhhhhhhhhhhhhhghh_hhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:15581:1791#0/1
GTCCGAATCTCCAGGATCGGTGATGGACAGGGT
+HWUSI-EAS1795_0092:3:1:15581:1791#0/1
hhhhhhhhhhhhhhhfhhhhghghhhhhhhha[
@HWUSI-EAS1795_0092:3:1:16594:1789#0/1
CGGCGCAATCGGCCTGCGAGGTACCAGTGATCA
+HWUSI-EAS1795_0092:3:1:16594:1789#0/1
hhhhhfhhhhhhhhhhhggghehfhggghhhgd
@HWUSI-EAS1795_0092:3:1:16694:1792#0/1
CCGATATGCACGACCCATGGGATTCCCCTTGGG
+HWUSI-EAS1795_0092:3:1:16694:1792#0/1
hhhhgghhhhhhhhhhaggghfgghghgfhhhh
@HWUSI-EAS1795_0092:3:1:17111:1793#0/1
ACGCAATTCACGATGCTTGTGGACATGCTTGCA
+HWUSI-EAS1795_0092:3:1:17111:1793#0/1
hhgghhhhhhhhhefhhhgfghhhhehhhfghg
@HWUSI-EAS1795_0092:3:1:17895:1794#0/1
CGCGTTGATGTGCAGGAACTTTGGATATGAAGC
+HWUSI-EAS1795_0092:3:1:17895:1794#0/1
hhghhhhhhhghghhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17997:1798#0/1
CACCAAGTTCATGCGCGACTTGGTCCGCGAGGT
+HWUSI-EAS1795_0092:3:1:17997:1798#0/1
hhgghgdhhhfg]dfffhhhh_]`ffdffdfc^
@HWUSI-EAS1795_0092:3:1:18339:1797#0/1
ATCTTAAAATTGATGAGAAACGCACTTAACTGT
+HWUSI-EAS1795_0092:3:1:18339:1797#0/1
hfgfhhhfhcgahhhfghhhhhhhhghhhhhhg
@HWUSI-EAS1795_0092:3:1:18705:1788#0/1
CTCCGAGCTAACCATCTTTGCTGCGTTTTCTTG
+HWUSI-EAS1795_0092:3:1:18705:1788#0/1
ggggafgcbfffgdggggggg[ggggggfgeg`
@HWUSI-EAS1795_0092:3:1:19287:1792#0/1
AATATCTTTTGCGATTCGCTAATGGAGTTCTCT
+HWUSI-EAS1795_0092:3:1:19287:1792#0/1
ffageggggggggfggfgfgfggggcggggggf
@HWUSI-EAS1795_0092:3:1:19402:1793#0/1
CTGGAGTTCCTCGATCAACTTGTTGCAAGCGGG
+HWUSI-EAS1795_0092:3:1:19402:1793#0/1
fegg]ggggggggeggggggfgggfgggggggc
@HWUSI-EAS1795_0092:3:1:1474:1804#0/1
CGACGATCGCAGCAGCAGCAAATCAGCGTTTTC
+HWUSI-EAS1795_0092:3:1:1474:1804#0/1
ac^PW`bcccccccaLYQT_\\ccPacaaccaa
@HWUSI-EAS1795_0092:3:1:2291:1801#0/1
TGCTGGATCCACTGGCGAACTGCAACTGCGCTT
+HWUSI-EAS1795_0092:3:1:2291:1801#0/1
gggggfggggggggggcdffffcfgfffdecec
@HWUSI-EAS1795_0092:3:1:3050:1805#0/1
GTAGGCGCCCATGGCCAAGTACTGGTAGGAGGC
+HWUSI-EAS1795_0092:3:1:3050:1805#0/1
fghhhhhhhhhhhhhhhghhhhgghghhhgahh
@HWUSI-EAS1795_0092:3:1:4051:1802#0/1
TGAAGACCTGGTTCAACCAGCCGGCCCGCAAGG
+HWUSI-EAS1795_0092:3:1:4051:1802#0/1
ggggggggggggggggggg_ggfgggdcffffg
@HWUSI-EAS1795_0092:3:1:4585:1811#0/1
TCATTAGATCGTATACCTTTATTTGTTTGATCA
+HWUSI-EAS1795_0092:3:1:4585:1811#0/1
hhhhhhhghhhhhhhhhhhhghhghhhhhfhhf
@HWUSI-EAS1795_0092:3:1:4898:1811#0/1
TGGAGATGTCCTTGAGGTACTGCTGCTTGTACA
+HWUSI-EAS1795_0092:3:1:4898:1811#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5089:1809#0/1
TGCATGAGACCAAGATCGCCTTCCTCTGCTTCC
+HWUSI-EAS1795_0092:3:1:5089:1809#0/1
cffffafgggggggge]fffffgecgg]ffffd
@HWUSI-EAS1795_0092:3:1:5586:1804#0/1
CCCAGTTCTCCTCCCATCCGGGAGTCACCTTCT
+HWUSI-EAS1795_0092:3:1:5586:1804#0/1
gggeffggfgggdgcggggggggggggeggfeg
@HWUSI-EAS1795_0092:3:1:5674:1803#0/1
TGCGAAGCTCCACTACTGCGTGTCCTGCGCAAT
+HWUSI-EAS1795_0092:3:1:5674:1803#0/1
ggggggggggggfgggggfdggggggafgegfg
@HWUSI-EAS1795_0092:3:1:6189:1810#0/1
GTGTTATACTACTATTGTGTTCGCTGCTGCTGT
+HWUSI-EAS1795_0092:3:1:6189:1810#0/1
ggfgggggggggggggcfffffggggggggggg
@HWUSI-EAS1795_0092:3:1:6274:1803#0/1
TGAACATCTTCTCGGTGATCTCCTCGTAGCCCT
+HWUSI-EAS1795_0092:3:1:6274:1803#0/1
aYacc[ccacac[a\aacc^ccccc\_cccccY
@HWUSI-EAS1795_0092:3:1:6477:1800#0/1
GGACAGGGCGGCGGCACCATCGGTCCACTCCTG
+HWUSI-EAS1795_0092:3:1:6477:1800#0/1
ggggggggggg`gggcagfadggdgcggegggf
@HWUSI-EAS1795_0092:3:1:7297:1802#0/1
GCTGGGGAAGAGGAAATCATCGAAAGGATTCTC
+HWUSI-EAS1795_0092:3:1:7297:1802#0/1
hghhheghhgchghhhghhhhhghhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:7336:1802#0/1
CTGGCTGGAGCGGGCATTTTGGGCTATCTGTTC
+HWUSI-EAS1795_0092:3:1:7336:1802#0/1
hhghhhhhhegghghghhhhgghghhhfhhhhh
@HWUSI-EAS1795_0092:3:1:7782:1801#0/1
AGTAAATCTTCTACACACACACACACACATATA
+HWUSI-EAS1795_0092:3:1:7782:1801#0/1
hghhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8474:1810#0/1
ACCTTTTCAAGTGTTTTAAAAGCTCCGTCAAAA
+HWUSI-EAS1795_0092:3:1:8474:1810#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8603:1802#0/1
GGCAGGTTCCGACTGGTAAAACTGCATGTTCCA
+HWUSI-EAS1795_0092:3:1:8603:1802#0/1
hhhhhhhhhhhhhhhhhhhhhgghhhghhhhhh
@HWUSI-EAS1795_0092:3:1:8850:1809#0/1
GCGAATGTGGGAGGGAGCCTGGAAGTGACGCTT
+HWUSI-EAS1795_0092:3:1:8850:1809#0/1
gggegggfffffgggcggggggcgggggegggg
@HWUSI-EAS1795_0092:3:1:8899:1802#0/1
CGGCGATCACGTACAGGTTCTTGGCTCCGGTGT
+HWUSI-EAS1795_0092:3:1:8899:1802#0/1
gggggggggfgggggdggggggegecgfggagd
@HWUSI-EAS1795_0092:3:1:9191:1808#0/1
TGGAACCACTTCATGGCATCCTCCTTGGTGAGG
+HWUSI-EAS1795_0092:3:1:9191:1808#0/1
hhehhhhhhhhhhhghhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9405:1803#0/1
GCCGTCAGTGGCATCGCCAGACGGCCATGCCCT
+HWUSI-EAS1795_0092:3:1:9405:1803#0/1
hhhghhhhhhhhhghhhhhfhhehhhhhghhhe
@HWUSI-EAS1795_0092:3:1:9433:1809#0/1
CACATGAATGAGGAGGCTCGCGTGGAGCAGGCT
+HWUSI-EAS1795_0092:3:1:9433:1809#0/1
hhhhhghhhhfghhghhghghhghgghhhhhhg
@HWUSI-EAS1795_0092:3:1:9648:1810#0/1
CTCGCTTTCTTTTCTTACTCTCATTCAGAAAAT
+HWUSI-EAS1795_0092:3:1:9648:1810#0/1
hhhghfhhhhhhhhhhfhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10006:1805#0/1
GAACGCGTTTTTAGTTCAAACCACAATTCACAT
+HWUSI-EAS1795_0092:3:1:10006:1805#0/1
hhhhhhhhhhhghhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10226:1810#0/1
GTTAGTTCCGTTATCCAGACGGCGCAGTTTACG
+HWUSI-EAS1795_0092:3:1:10226:1810#0/1
ehhhghhhhgghhhghhhhhhgfhfhghhghhh
@HWUSI-EAS1795_0092:3:1:10727:1803#0/1
TGGGAGAGCAACTTTGACGAGCTGTTTCCCAGT
+HWUSI-EAS1795_0092:3:1:10727:1803#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11150:1810#0/1
ACGAGAGCCATATCATCATAATAAGCAACTGCG
+HWUSI-EAS1795_0092:3:1:11150:1810#0/1
hhhhhhhhhhhhhhhhhhhffhhhhghhfhhhh
@HWUSI-EAS1795_0092:3:1:11263:1806#0/1
GCCGTGGATGCGGGTGACCTTGCCCCAGACAGC
+HWUSI-EAS1795_0092:3:1:11263:1806#0/1
cffffffggfgcfffffggcggggggfcff]ca
@HWUSI-EAS1795_0092:3:1:11439:1800#0/1
GGCATGTTCTGGAACACACGCAGCACACCATGC
+HWUSI-EAS1795_0092:3:1:11439:1800#0/1
hhfhhhghhgghhhhhfhhdcgacfhfhfgfhe
@HWUSI-EAS1795_0092:3:1:11642:1806#0/1
CTCCTCGTTATCTTCGGAAATGGTTGCACATGG
+HWUSI-EAS1795_0092:3:1:11642:1806#0/1
dcffffaddeceffcfdc_c^da^c_^fccffa
@HWUSI-EAS1795_0092:3:1:11733:1811#0/1
TGTTCAGCTGATATTTGCACCGCAAGGGATTAT
+HWUSI-EAS1795_0092:3:1:11733:1811#0/1
hhhhhhhhhhghhhhhghhghhghhhhhdgghg
@HWUSI-EAS1795_0092:3:1:12612:1808#0/1
GAAACCGAGTCCCACATCGCGGGAGCGACGCAG
+HWUSI-EAS1795_0092:3:1:12612:1808#0/1
hghhhghhfchhgdhhhhfahhhhhhhdhhhch
@HWUSI-EAS1795_0092:3:1:12941:1802#0/1
CCTGGCTGTCTGCATCACTGGCCGTGGACTTCA
+HWUSI-EAS1795_0092:3:1:12941:1802#0/1
hhhhhhhhhhhhhghfhhghhhhffchghgheh
@HWUSI-EAS1795_0092:3:1:14392:1805#0/1
CCCGGATAAAGCAAGACGTTTAGGATACAGAGC
+HWUSI-EAS1795_0092:3:1:14392:1805#0/1
hhhhhhhhhhhhhfhhhhhhhhhhgghhhchgh
@HWUSI-EAS1795_0092:3:1:14425:1805#0/1
GTGTTGTTGGCTGCATTATGATGTTGGTTATAT
+HWUSI-EAS1795_0092:3:1:14425:1805#0/1
ccdddccddd\[c^^ac\aaU^^\^aafdfcfa
@HWUSI-EAS1795_0092:3:1:14700:1802#0/1
CCAGTTGATTCTCTGAATTTTTGACAACCATTA
+HWUSI-EAS1795_0092:3:1:14700:1802#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhghghhgh
@HWUSI-EAS1795_0092:3:1:15157:1811#0/1
GCGCTTGATGCCATTACGATGGGCCTTCTTGTT
+HWUSI-EAS1795_0092:3:1:15157:1811#0/1
hhhhhhhhhhhhhhghhgggghghhhhghhggh
@HWUSI-EAS1795_0092:3:1:15515:1806#0/1
GGAGCCTGGAAGTGACGCTTGCGGTTCTTCCTG
+HWUSI-EAS1795_0092:3:1:15515:1806#0/1
gfggggggggggdggggggggfggggggggggg
@HWUSI-EAS1795_0092:3:1:15626:1807#0/1
GAGCTTTGGCAGCGTCACTATCCCGCTGATAGT
+HWUSI-EAS1795_0092:3:1:15626:1807#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhffhd
@HWUSI-EAS1795_0092:3:1:15989:1803#0/1
CGCGTGCGCAAGATGAAGGAACGATATGCGCTG
+HWUSI-EAS1795_0092:3:1:15989:1803#0/1
hhhhhhhhghhgghchhfefhhhghhfhhhghg
@HWUSI-EAS1795_0092:3:1:16024:1808#0/1
TCGCATTTGAATAATTCGACGCATAATGCCAAT
+HWUSI-EAS1795_0092:3:1:16024:1808#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhfghhdh
@HWUSI-EAS1795_0092:3:1:16770:1806#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16770:1806#0/1
c\WacdeeddbcHVVW]ffffffWfcf_ccfff
@HWUSI-EAS1795_0092:3:1:16920:1803#0/1
CGCTGACCGCATGCAAAAGGAAATCACGGCGTT
+HWUSI-EAS1795_0092:3:1:16920:1803#0/1
g]geggggagggegcfdfffafggagegcfged
@HWUSI-EAS1795_0092:3:1:17060:1809#0/1
CAGCAGTCTGCTCCACCTGTACGAGTACGTCCT
+HWUSI-EAS1795_0092:3:1:17060:1809#0/1
dabdb^baaaaYdbaaaV^X[Y[Z[YY`Y]`^c
@HWUSI-EAS1795_0092:3:1:17416:1805#0/1
ATTTGGCGGTCCCTCCTTCTTGGCCTTGCGCAG
+HWUSI-EAS1795_0092:3:1:17416:1805#0/1
ffff[W_dadddfafcPda_a[Z^^^R^a]a^f
@HWUSI-EAS1795_0092:3:1:17465:1808#0/1
GCGCAGACCTCGCAGCGAATCCGCTTCTTGGCA
+HWUSI-EAS1795_0092:3:1:17465:1808#0/1
gggggggggggagefgg[d[bbdfcccfgggg]
@HWUSI-EAS1795_0092:3:1:17539:1809#0/1
TCGAACTTGTTCACTTGTTTACAAAAAAGGTAG
+HWUSI-EAS1795_0092:3:1:17539:1809#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhehhghf
@HWUSI-EAS1795_0092:3:1:17597:1806#0/1
CCGCGATATCGATGTTGATCAGCTTCTCCACCT
+HWUSI-EAS1795_0092:3:1:17597:1806#0/1
hhhgcchhhhhfadgheaghhhchhhhhgfhfe
@HWUSI-EAS1795_0092:3:1:17669:1800#0/1
ATGCATACACAATTCAAGACAATCATTTACATA
+HWUSI-EAS1795_0092:3:1:17669:1800#0/1
hhhhhhhhhhhhhhhhhghhhhghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:18301:1806#0/1
CAGGCACCAATACAGGCCACCTTGCGCAGACCC
+HWUSI-EAS1795_0092:3:1:18301:1806#0/1
hfhhhhhhhhdhhhhhgfghffhhhghhhfhhh
@HWUSI-EAS1795_0092:3:1:19054:1806#0/1
TTGACCCGTTTGTATGTTTGGCGAGTTCCTAAT
+HWUSI-EAS1795_0092:3:1:19054:1806#0/1
f[fdcfffcff_dffffffdafa`d``ffdfff
@HWUSI-EAS1795_0092:3:1:1360:1816#0/1
GCGAAAACAGAAACAGCATCTCTGTGAACCCAC
+HWUSI-EAS1795_0092:3:1:1360:1816#0/1
Ya^aaccdc]ddd_fdffafffgggggdffefe
@HWUSI-EAS1795_0092:3:1:1543:1818#0/1
GAACAGGTGGCTGAAAACCACATAGCCTATGTG
+HWUSI-EAS1795_0092:3:1:1543:1818#0/1
fcffffedfcfdf_aaf[ffcfdafffedd_df
@HWUSI-EAS1795_0092:3:1:1983:1820#0/1
TTTGAATGGCATCTAGAGCTCGTCGGAGAGATG
+HWUSI-EAS1795_0092:3:1:1983:1820#0/1
adffff[fcfdccabb]fccfffffdafcfcff
@HWUSI-EAS1795_0092:3:1:2751:1816#0/1
CTCCCATGTCGCGGTAGCACTGAGTGACGGCAC
+HWUSI-EAS1795_0092:3:1:2751:1816#0/1
hhhhhhhhhhhhhgghhhehhhhhghhhhhggh
@HWUSI-EAS1795_0092:3:1:4024:1822#0/1
CATGGTGGTGGTGTTGGTGTTGGGTGGTTGTGG
+HWUSI-EAS1795_0092:3:1:4024:1822#0/1
fgdafdfffffccedaeffdf^ddde_cffffg
@HWUSI-EAS1795_0092:3:1:4338:1819#0/1
GAAGGCCCGTGTGGTGACCATCACCGGAACCCG
+HWUSI-EAS1795_0092:3:1:4338:1819#0/1
\\W__W_dd^d]ab^aVWZ]_XfcffcBBBBBB
@HWUSI-EAS1795_0092:3:1:4806:1822#0/1
GGCGTGCGCCCACCCGAAACGCGGTTCCGCTCT
+HWUSI-EAS1795_0092:3:1:4806:1822#0/1
gggggdSefeffdgcgegggaacYffddedadc
@HWUSI-EAS1795_0092:3:1:5348:1819#0/1
TGAAATTCGTCGATGGCCTGATGATCCACTCGG
+HWUSI-EAS1795_0092:3:1:5348:1819#0/1
gggggggfggggfgggggg_acgfggagggggg
@HWUSI-EAS1795_0092:3:1:5733:1812#0/1
CTGATTGTGTCCGCCATTGCCCCACTTATCACC
+HWUSI-EAS1795_0092:3:1:5733:1812#0/1
hhhghhhhfhhhhhhhhhfhhhghhhhhghhhg
@HWUSI-EAS1795_0092:3:1:5926:1820#0/1
TGAAGATCTACAAGGATATCATCACCGGCGACG
+HWUSI-EAS1795_0092:3:1:5926:1820#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6083:1821#0/1
GCCAACTGGACAATTTCGTCCACCTTTTCGTAA
+HWUSI-EAS1795_0092:3:1:6083:1821#0/1
ggdffaffff[fgggggf_fffdafffa`a]ee
@HWUSI-EAS1795_0092:3:1:6319:1818#0/1
GGATTGTTGAAGTGGATGACGGTGCCATCGTTC
+HWUSI-EAS1795_0092:3:1:6319:1818#0/1
gegggfggggggggggaffffff[fffgggggg
@HWUSI-EAS1795_0092:3:1:6679:1812#0/1
CGCTGCTCTCTAGTGGTTTCCGTATGATTTCGT
+HWUSI-EAS1795_0092:3:1:6679:1812#0/1
hhhgfghghhhghhhhhhhhhhdhhhehhhfhh
@HWUSI-EAS1795_0092:3:1:7276:1813#0/1
ATTTTATCAATTTATCAATTTAGCCAAATGCAA
+HWUSI-EAS1795_0092:3:1:7276:1813#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7497:1814#0/1
GGCGAACTGTGGACCGTATTTGGTGACAAAAAT
+HWUSI-EAS1795_0092:3:1:7497:1814#0/1
hhhhhhhhhhghhhhhhhhhhhhehhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8999:1811#0/1
GCGGCCGCGTCGCAACAATTTTTGGCCGCCCAG
+HWUSI-EAS1795_0092:3:1:8999:1811#0/1
cff]_fcffcfcabd^bffdffff]f_[V[UX]
@HWUSI-EAS1795_0092:3:1:9058:1821#0/1
AGAACAAGGAGATCAAGGACAATATCCGAAAGT
+HWUSI-EAS1795_0092:3:1:9058:1821#0/1
hhhhhhhhhghhhhhhhhhhhhfhhhhfhhhfh
@HWUSI-EAS1795_0092:3:1:10751:1818#0/1
GTTATGTGGGTGCAAGGGAGCTCGGTGGCCGGC
+HWUSI-EAS1795_0092:3:1:10751:1818#0/1
ggfggggggg[g^ffffcgggcfffdfggefea
@HWUSI-EAS1795_0092:3:1:11114:1815#0/1
CAGCAACAACAAGCATATAACCAACATCATAAT
+HWUSI-EAS1795_0092:3:1:11114:1815#0/1
hhhhhhhfhhhhhhhhghhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:11294:1821#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11294:1821#0/1
hhhhhhhhhhfhhhdhfghhhghghchhhghhh
@HWUSI-EAS1795_0092:3:1:12072:1818#0/1
CGTCCAGGTCGCACCACTTCCACACGGCGGCGT
+HWUSI-EAS1795_0092:3:1:12072:1818#0/1
fd_cffcfffY_fScaYaaaaX[fffW\_Ycc`
@HWUSI-EAS1795_0092:3:1:12550:1819#0/1
GTTGCAACGGGTTTCCACGCTTTCTATTAACAG
+HWUSI-EAS1795_0092:3:1:12550:1819#0/1
hhhfghhghghhhhhhhhghchhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:13224:1816#0/1
GGCGGGAAGAAATGCAAGCCAAGATGCGGCCGG
+HWUSI-EAS1795_0092:3:1:13224:1816#0/1
hhhhhhcghghhfhghhghhhd_ffffhdghhh
@HWUSI-EAS1795_0092:3:1:13484:1822#0/1
TGGGTGGTGAATGGGGAGTTTAAAACTTTCAAT
+HWUSI-EAS1795_0092:3:1:13484:1822#0/1
hghghhhhhhhhhhhchhegcghhghfhhhhgh
@HWUSI-EAS1795_0092:3:1:13920:1812#0/1
GCCCGGTCTGCTTGGCGGCATCGCGCTGCTTGA
+HWUSI-EAS1795_0092:3:1:13920:1812#0/1
caad`cdff\f^a^_\`caaWc``Y\`dc]Wdd
@HWUSI-EAS1795_0092:3:1:14351:1813#0/1
CGGTGTTATACTACTATTGTGTTCGCTGCTGCT
+HWUSI-EAS1795_0092:3:1:14351:1813#0/1
ggefggfgeggggggggggfgggggfgfffd]f
@HWUSI-EAS1795_0092:3:1:14618:1812#0/1
GAGAAGTTAGCGAAACGTATCGATGTTCTGACA
+HWUSI-EAS1795_0092:3:1:14618:1812#0/1
hhhhhghhhhhhghhhhhhhhhhdhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:14770:1817#0/1
CTGCTGAGCTGGCATGAGTGGCGAAGGGTTGTA
+HWUSI-EAS1795_0092:3:1:14770:1817#0/1
hhdhhhhhhhhhhhhdcheghhhhghhhdgfgd
@HWUSI-EAS1795_0092:3:1:15429:1818#0/1
TCGGTCATCTTGCGCAGGACAGGTGTTGGTGTT
+HWUSI-EAS1795_0092:3:1:15429:1818#0/1
hhgghhhhhhheghgchhchhhhdghfhehfhf
@HWUSI-EAS1795_0092:3:1:15684:1821#0/1
GGCGAAGGCGCAGCTGCAAAAATCTCTGGACAA
+HWUSI-EAS1795_0092:3:1:15684:1821#0/1
hhhhhhhfhghhghhhchhhhfcghhhhghhhh
@HWUSI-EAS1795_0092:3:1:15830:1816#0/1
GAAAATGAAGGGGTACTTGTGCTAGGCACCTTT
+HWUSI-EAS1795_0092:3:1:15830:1816#0/1
hghhghgfghhhhehhhhfhhfhghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:16666:1812#0/1
CGGACCACAGCGAGAATCTTTCCGGCACTAAGG
+HWUSI-EAS1795_0092:3:1:16666:1812#0/1
hhhhhhhhhhhhgefhhhhhhhhhhhhfhhghd
@HWUSI-EAS1795_0092:3:1:16822:1823#0/1
AGACCATCAAGTGGCTGGATGCCAACCAGCTGG
+HWUSI-EAS1795_0092:3:1:16822:1823#0/1
fffggggggggggggggfc[fff_afffff_fg
@HWUSI-EAS1795_0092:3:1:17027:1823#0/1
CATTATGGTACAGTACCACGCGTTGGGTCTGCT
+HWUSI-EAS1795_0092:3:1:17027:1823#0/1
hhhhhhdfhhhhhhhhhhhhghhhhhgghgage
@HWUSI-EAS1795_0092:3:1:17742:1823#0/1
CCGCTTCATCCGCGTTCTCGTGGTCGTGTTGCT
+HWUSI-EAS1795_0092:3:1:17742:1823#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhgh
@HWUSI-EAS1795_0092:3:1:17784:1820#0/1
CTGGGCGCGGAACTCCTCCAAGCAAGAGCCCGG
+HWUSI-EAS1795_0092:3:1:17784:1820#0/1
ggf]ffffcfffgfggcfffffgggefdfffcc
@HWUSI-EAS1795_0092:3:1:18148:1820#0/1
TGTAGATACAATCAAAGGTGAGCATGAGTCTCT
+HWUSI-EAS1795_0092:3:1:18148:1820#0/1
fdfdfffgggggggfgeggggdggggfgggggg
@HWUSI-EAS1795_0092:3:1:18438:1814#0/1
CCACCGAAGCAGAGCGAAGATGTCGCATTCAGT
+HWUSI-EAS1795_0092:3:1:18438:1814#0/1
ggggg_efaffacffcfffacfdffaff]cafa
@HWUSI-EAS1795_0092:3:1:18553:1812#0/1
CAGGAACAAGATCAAGTTCCTGGCCTACCTGCG
+HWUSI-EAS1795_0092:3:1:18553:1812#0/1
ggggggggggggfggggggg[gaffffgggggg
@HWUSI-EAS1795_0092:3:1:18702:1812#0/1
GTGGTCCCAATGCGTTGGCGCCATGTCGTTGAA
+HWUSI-EAS1795_0092:3:1:18702:1812#0/1
gfhhhhhhehhhhhgcfhhahfgghgeffdcWf
@HWUSI-EAS1795_0092:3:1:19270:1811#0/1
TGGAGCTCACCAAGCAGACGGATAAGGAAAAGG
+HWUSI-EAS1795_0092:3:1:19270:1811#0/1
hhhhhhhhhhhhhghhhghhhfhhhhhhhhegh
@HWUSI-EAS1795_0092:3:1:19407:1814#0/1
GGGTGATTAGAAATCTAATTAAAAGCAATTCGC
+HWUSI-EAS1795_0092:3:1:19407:1814#0/1
fd[f[f_ac[ac_addcfddaaca^ac`^^a`[
@HWUSI-EAS1795_0092:3:1:19593:1814#0/1
AAATGATGAGTCGCCGTATACCGACAGTGTGGA
+HWUSI-EAS1795_0092:3:1:19593:1814#0/1
gggggggggeggffJfffffffgfffgdddffc
@HWUSI-EAS1795_0092:3:1:1466:1832#0/1
TCTGGTACCGCCGTCGCCAAGCCTGCTGCCGAA
+HWUSI-EAS1795_0092:3:1:1466:1832#0/1
JaY^ad^fcfSS^aaY[^cccLa\aY^fffca\
@HWUSI-EAS1795_0092:3:1:2002:1831#0/1
GGATGTGGCACCGACTTCACCGCCCACGCAACG
+HWUSI-EAS1795_0092:3:1:2002:1831#0/1
ff[cfcfedcc`a^^aacccff_fccdfacfad
@HWUSI-EAS1795_0092:3:1:2229:1833#0/1
CTCAAGCTGACAAGCTAAAGCTATCGAAAGCTA
+HWUSI-EAS1795_0092:3:1:2229:1833#0/1
c^]]caaW`__\]aa[\__L_`cXcYcBBBBBB
@HWUSI-EAS1795_0092:3:1:2533:1830#0/1
GCGAAATCAACGGCGACAGCGTGCCCGTGCTCA
+HWUSI-EAS1795_0092:3:1:2533:1830#0/1
fcffcfdf_fa^daddafadffadfaffdfdfc
@HWUSI-EAS1795_0092:3:1:3005:1830#0/1
GTCGTTCTGAAGTAGAGCTTGAGTTCCCGGCGA
+HWUSI-EAS1795_0092:3:1:3005:1830#0/1
QaYcaaaca[ccZ_cZccYc^]cc[[aaaac_B
@HWUSI-EAS1795_0092:3:1:3188:1825#0/1
GCGTCATCGACCTGATCAAGTATATGCAGAGCA
+HWUSI-EAS1795_0092:3:1:3188:1825#0/1
hhhghhhhhhhhfafhgfghhhhhgfgfaffcf
@HWUSI-EAS1795_0092:3:1:3231:1828#0/1
CTGCCTTCTCGGCAATCATGAAGACGGGTCCAT
+HWUSI-EAS1795_0092:3:1:3231:1828#0/1
_cdfdffgfgggacfffcfcf_Wbbbbceggag
@HWUSI-EAS1795_0092:3:1:3327:1825#0/1
GATCACTGGTACCTCGCAGGCCGATTGCGCCGT
+HWUSI-EAS1795_0092:3:1:3327:1825#0/1
fchhhhhghhhfhhhffhhhhhhghfchhhhhd
@HWUSI-EAS1795_0092:3:1:4226:1825#0/1
CTTCACTACTCGATGACGCATCTCCTTGGCGAC
+HWUSI-EAS1795_0092:3:1:4226:1825#0/1
hhhghhhcghhhhgfhghhhhggedhhghghhh
@HWUSI-EAS1795_0092:3:1:4650:1834#0/1
CGTGTACAAGCGCCGCGCTGATGGCGTCAACAT
+HWUSI-EAS1795_0092:3:1:4650:1834#0/1
hhhhhhghhhghhhhhhhfhhhhhhfhhhhhgh
@HWUSI-EAS1795_0092:3:1:4869:1828#0/1
GGGTGACCAGGGACGCAGTGGAATCGATGGACG
+HWUSI-EAS1795_0092:3:1:4869:1828#0/1
hhhhhhhhhhghhfhhhhghhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:5444:1829#0/1
GGAGTAGGCGCCGTCGCCAGCCATGCAGTCCTT
+HWUSI-EAS1795_0092:3:1:5444:1829#0/1
hhghhhhhhhhhhhhhhhhghhhhhhhhghfhg
@HWUSI-EAS1795_0092:3:1:5556:1834#0/1
TGATTATGCGCCGCTCCTTGTTTCCTGGAGACA
+HWUSI-EAS1795_0092:3:1:5556:1834#0/1
ffddffffffdaadeaeff[ffccafdba`dbf
@HWUSI-EAS1795_0092:3:1:6520:1827#0/1
GATTGTTGAAGGAGTACGAGGTCGTGGGGCGCG
+HWUSI-EAS1795_0092:3:1:6520:1827#0/1
ffacfcafdfff\dfffffcf]e`dQdBBBBBB
@HWUSI-EAS1795_0092:3:1:6556:1823#0/1
CCGATCCATCGGCCACGCGGGCCGTTTCCAACT
+HWUSI-EAS1795_0092:3:1:6556:1823#0/1
cfdacffdadcf\_ZZWf]adac^^a^SURWSZ
@HWUSI-EAS1795_0092:3:1:6728:1833#0/1
TCACGCTCCCACTACCGCCGTGGACAATTATGA
+HWUSI-EAS1795_0092:3:1:6728:1833#0/1
hhhhhhhhhhhhfghhhhhg_ahehhhghhhdh
@HWUSI-EAS1795_0092:3:1:6920:1827#0/1
CCTCTCACACCTGTTGTCGCTGTTTAGAATTCC
+HWUSI-EAS1795_0092:3:1:6920:1827#0/1
hhhhhhhhhhhhhhhhhhfhgghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7147:1834#0/1
TAAATATCCGCCAGAAAACTCGCCGACTTTCGG
+HWUSI-EAS1795_0092:3:1:7147:1834#0/1
gggggggggggffffffgegggggfgaggggg_
@HWUSI-EAS1795_0092:3:1:7364:1834#0/1
AAAGCAGACGCAAGTGGACTCGTTGACTGCGCA
+HWUSI-EAS1795_0092:3:1:7364:1834#0/1
dggggggggacgfffccffdcffdccffgggeg
@HWUSI-EAS1795_0092:3:1:7714:1834#0/1
CAGCACTCATCAATATGAATAGAATGAGAAGAC
+HWUSI-EAS1795_0092:3:1:7714:1834#0/1
fdfffddecffcfafcfgcacdeeggdegfWgf
@HWUSI-EAS1795_0092:3:1:7897:1824#0/1
CAAGGCGGTTGTCATCGCGAAGTTCTTCATAAC
+HWUSI-EAS1795_0092:3:1:7897:1824#0/1
ggggggggdgdgddad`ccafc^b`bdcccffg
@HWUSI-EAS1795_0092:3:1:8217:1827#0/1
ATTTGGGACGTGTCGGCACCGTTGTCAACCGTG
+HWUSI-EAS1795_0092:3:1:8217:1827#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhfhg
@HWUSI-EAS1795_0092:3:1:8704:1830#0/1
GTGGAAAACGCCAACATGGGTTTCGCTACTCTC
+HWUSI-EAS1795_0092:3:1:8704:1830#0/1
fgagfgffdgfcgggfggggggafdfffggggg
@HWUSI-EAS1795_0092:3:1:8958:1833#0/1
TAAAGAGTGCATGCAGAAGGCAAACGACTTAAG
+HWUSI-EAS1795_0092:3:1:8958:1833#0/1
hhhhhghhhhhhhghgghhhhfhhfgefhchdh
@HWUSI-EAS1795_0092:3:1:9586:1824#0/1
TCCCAACGTAGAAGGATCCGTGCTCCTTGCGGC
+HWUSI-EAS1795_0092:3:1:9586:1824#0/1
hhhhhhhgghhhhhhhghhhhchhhhghfhfeh
@HWUSI-EAS1795_0092:3:1:9871:1834#0/1
GTGTTGTCGGCACAGTTCATCACGGCGCCCACG
+HWUSI-EAS1795_0092:3:1:9871:1834#0/1
fffffaffffdfaaccdffffWfffffdffcff
@HWUSI-EAS1795_0092:3:1:10020:1834#0/1
CTACGACCAAGGTGCACTGGTTAAAGTCAATGA
+HWUSI-EAS1795_0092:3:1:10020:1834#0/1
gegggggggggggegggdggffcdffcfffffg
@HWUSI-EAS1795_0092:3:1:10060:1824#0/1
CTGAGCCCAGAGAGAGCCCCTTAATCATTACAT
+HWUSI-EAS1795_0092:3:1:10060:1824#0/1
f_fffffcfff]fffdJffffffaffffffddf
@HWUSI-EAS1795_0092:3:1:10090:1834#0/1
GCACGACAAGCCCCGCCAGGAGTTCGTCAAGTA
+HWUSI-EAS1795_0092:3:1:10090:1834#0/1
ggggggdggcfgffWf`ccf_fadffaafcfaf
@HWUSI-EAS1795_0092:3:1:10108:1832#0/1
GATTTCTTGGGTTGAGTCTACATAGTGAGCTCC
+HWUSI-EAS1795_0092:3:1:10108:1832#0/1
hhhhhhhhhhhhhhghhhhghhgghhhghhhhh
@HWUSI-EAS1795_0092:3:1:10183:1825#0/1
GTGCCCTGCGGTTTTCCAAACGCTCCTCGCATT
+HWUSI-EAS1795_0092:3:1:10183:1825#0/1
ggggcg]ecce[fdfefggdggffWfffef_af
@HWUSI-EAS1795_0092:3:1:10790:1834#0/1
CCGAGGTGATAGAATTCTTAAGGTAACACCATC
+HWUSI-EAS1795_0092:3:1:10790:1834#0/1
caa`^\b_\W_\dd^adff_cccYccaddddcc
@HWUSI-EAS1795_0092:3:1:11087:1833#0/1
TGAAAATTTATGGTGGGGACACGCAAACTTCTC
+HWUSI-EAS1795_0092:3:1:11087:1833#0/1
gfgggfgggdgggdggggeggcfffffgggggg
@HWUSI-EAS1795_0092:3:1:11266:1831#0/1
CGCCAGGGCATGTTGGTAGAGGGTTCCAACATG
+HWUSI-EAS1795_0092:3:1:11266:1831#0/1
hhhhhhhhhhgfhhggfhgchgchhhhhhgfgg
@HWUSI-EAS1795_0092:3:1:11447:1825#0/1
GTTGTTTTTCGCATCGAAGTCATCGCGCGACGT
+HWUSI-EAS1795_0092:3:1:11447:1825#0/1
ggdggggggfgggggggfaafffffefgfg_e`
@HWUSI-EAS1795_0092:3:1:11606:1826#0/1
GCCAGGGCGGCCGAGGACGACGTAGAAGTCCAG
+HWUSI-EAS1795_0092:3:1:11606:1826#0/1
hhhhhhhhhhghhgchhfghchehhhhhfhggh
@HWUSI-EAS1795_0092:3:1:11901:1830#0/1
CTCGAGGAGAAGATTCGCGATCCGTGCCTTAAT
+HWUSI-EAS1795_0092:3:1:11901:1830#0/1
hhhhhhhhehhhhghhhfhgghhhghQfffffh
@HWUSI-EAS1795_0092:3:1:13179:1831#0/1
ATGGAAGTCTTTCGCAGAGAGATATGGTAGATG
+HWUSI-EAS1795_0092:3:1:13179:1831#0/1
hhhhhhhhhhhhhhhfhhghhhhfhhhggghff
@HWUSI-EAS1795_0092:3:1:13554:1833#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13554:1833#0/1
hhhhhghhhhhh_ffffhhhfh_hhfhhfechh
@HWUSI-EAS1795_0092:3:1:14310:1835#0/1
ATTGGAGGCCTGTCGCTTCATAATGGTGGCCAT
+HWUSI-EAS1795_0092:3:1:14310:1835#0/1
gggacgggeggcgggggffffccacc_ggfgaf
@HWUSI-EAS1795_0092:3:1:14455:1833#0/1
CTTGTATAGCCCGCTGCATTTAAGGCATCGCTA
+HWUSI-EAS1795_0092:3:1:14455:1833#0/1
ggggfggggggggfggggggggggggffggfgg
@HWUSI-EAS1795_0092:3:1:14577:1829#0/1
GCTGTGGCCCGTATTCCCCGTGTGCGTGGTGGC
+HWUSI-EAS1795_0092:3:1:14577:1829#0/1
gdgggggggggg_ggggggfgfdfffddfafff
@HWUSI-EAS1795_0092:3:1:14635:1825#0/1
GAAAAAGTGCCAATTGCCTCCAATGCTGTAAGA
+HWUSI-EAS1795_0092:3:1:14635:1825#0/1
gffdffffa_fffcfdfffffdeWdf]ddeeeg
@HWUSI-EAS1795_0092:3:1:15556:1830#0/1
GATTTTGGACATCTTATATGCGACTGAGGATGG
+HWUSI-EAS1795_0092:3:1:15556:1830#0/1
gaggggfggggggggggggggggcgggggdegg
@HWUSI-EAS1795_0092:3:1:16034:1832#0/1
TGCACAATGGTGCGATTAAACAGGCGCCTGCTG
+HWUSI-EAS1795_0092:3:1:16034:1832#0/1
hhfff^ffffcffhhhhghhhhhchhgghghaf
@HWUSI-EAS1795_0092:3:1:16150:1824#0/1
CGGCAGATCCGGAGACAGACTCAATATCGTTTC
+HWUSI-EAS1795_0092:3:1:16150:1824#0/1
ffa]fffff]fcf]aRf[da_ad]dadffcW_b
@HWUSI-EAS1795_0092:3:1:16239:1834#0/1
CAGGAATGCTGTCGCAACAACGTTTTGTCATTA
+HWUSI-EAS1795_0092:3:1:16239:1834#0/1
hhhhgffhhhghghhhhhhhhhhhhhehhhhhh
@HWUSI-EAS1795_0092:3:1:16478:1828#0/1
GGAGTTCGTGTCGAGTACTTGGACCGAGGCGAA
+HWUSI-EAS1795_0092:3:1:16478:1828#0/1
hhhghhhhgehghhhghhhhchhhhhhghgfh_
@HWUSI-EAS1795_0092:3:1:17633:1834#0/1
CACGAAGCTGCAGTCCCTGCTGGATCTTATTCT
+HWUSI-EAS1795_0092:3:1:17633:1834#0/1
ffffaffafffffafffcafaffafdffffffd
@HWUSI-EAS1795_0092:3:1:17854:1831#0/1
TGCTACCGCCGTTTCCGTTGGCTAAGAGTCTTG
+HWUSI-EAS1795_0092:3:1:17854:1831#0/1
cfdadcdZ\aS^WO_aBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18808:1825#0/1
GTTGTCGTGCGCTGGAGCTGATAGGCTTCAAAC
+HWUSI-EAS1795_0092:3:1:18808:1825#0/1
gggggggdfffdfffdfgggfdgggggggaggg
@HWUSI-EAS1795_0092:3:1:19551:1830#0/1
AGGAGGTCCGCGCGGAGTTTGGCCACAGTGACG
+HWUSI-EAS1795_0092:3:1:19551:1830#0/1
hhhghhfhhhhhdhhfhhdghhghhhggdghhe
@HWUSI-EAS1795_0092:3:1:19666:1832#0/1
CTTCCGGCATTTTCGCAACGTATTCTGTAGTTT
+HWUSI-EAS1795_0092:3:1:19666:1832#0/1
ccaa_ccc\cccUYZYX]Zcc^aaccacca^a^
@HWUSI-EAS1795_0092:3:1:19722:1827#0/1
TCGGTTTCTATATCTTGTTGCGGTATCCGGATT
+HWUSI-EAS1795_0092:3:1:19722:1827#0/1
gggggggfgfgdgggggggfgaaffffgfgggg
@HWUSI-EAS1795_0092:3:1:1836:1846#0/1
GTCTCATGGTTATATTTAGTTTTAGATGGAGTT
+HWUSI-EAS1795_0092:3:1:1836:1846#0/1
affffff__heffhdhdhfhhhhfffhcchggh
@HWUSI-EAS1795_0092:3:1:2674:1844#0/1
GTCTACAAGAAGCTGACTGGTCGCGATGTTACC
+HWUSI-EAS1795_0092:3:1:2674:1844#0/1
gfgfggggeggafffffffYffffafegggegg
@HWUSI-EAS1795_0092:3:1:2979:1845#0/1
TTATATAAAGTGCAAACACTGCTGATTTTTATT
+HWUSI-EAS1795_0092:3:1:2979:1845#0/1
hhhhhhhghfhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4674:1837#0/1
CGGGCAGCGGGGCTCCGATCCCGGAGCTCACAG
+HWUSI-EAS1795_0092:3:1:4674:1837#0/1
cgggggg^ffffegcgefdcafaaKb^db^bcg
@HWUSI-EAS1795_0092:3:1:4898:1838#0/1
GCACGACCTGCTTGATCAGACCCTTCTCGCGCA
+HWUSI-EAS1795_0092:3:1:4898:1838#0/1
hhhhhhhhhhhhhhchhhghhhhhhhhhghagh
@HWUSI-EAS1795_0092:3:1:5303:1836#0/1
TGACAGATAACAGATAACACGACTGGCTGATAA
+HWUSI-EAS1795_0092:3:1:5303:1836#0/1
dbacb_eaba^a]aabafffddgfgfg_fffff
@HWUSI-EAS1795_0092:3:1:5325:1845#0/1
GCAGGTTTTTCCGAGCGAGGGACGTGCGAATTG
+HWUSI-EAS1795_0092:3:1:5325:1845#0/1
fWffffffdaf_dddbcfffffWd^ddfcWdcc
@HWUSI-EAS1795_0092:3:1:5401:1845#0/1
GCCAGAGATGTTCTTAAGCTCCGGATCCAAAGC
+HWUSI-EAS1795_0092:3:1:5401:1845#0/1
hhhhhhhghghhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:5878:1841#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5878:1841#0/1
gghhgghhghggghghhdhhhgfghhhddghdh
@HWUSI-EAS1795_0092:3:1:6075:1839#0/1
GTTCTTGTACACATCTGGGTTGTTGATCACGAA
+HWUSI-EAS1795_0092:3:1:6075:1839#0/1
hhhhhhhhhhhhhghhhhhhhghhhghhhhghh
@HWUSI-EAS1795_0092:3:1:6141:1842#0/1
AAAATACTGAATTTTCCCAGATCTGAAAGTTCA
+HWUSI-EAS1795_0092:3:1:6141:1842#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhg
@HWUSI-EAS1795_0092:3:1:6234:1841#0/1
ATATTCGTGTCCATCGCCGTGCCCTTGTACGGG
+HWUSI-EAS1795_0092:3:1:6234:1841#0/1
hhhhhhhhhhhhhhhchhfheeffcfWccccfh
@HWUSI-EAS1795_0092:3:1:6489:1843#0/1
ACGGCTGTGCATCAGCTCCACCAGCTGGTTGTT
+HWUSI-EAS1795_0092:3:1:6489:1843#0/1
gggggggggggggafcgffcfffcdcfggfaga
@HWUSI-EAS1795_0092:3:1:6797:1835#0/1
GCTACGCCCGTCTGCATCCTCGTGCCACCAACT
+HWUSI-EAS1795_0092:3:1:6797:1835#0/1
hhhhhfhhhhhhhhhhghhehfhhhhghhghhh
@HWUSI-EAS1795_0092:3:1:7054:1838#0/1
TGGTGGTGGTGGTCGTGGTGGAAGAAGTTGTAG
+HWUSI-EAS1795_0092:3:1:7054:1838#0/1
cgcdcffddeaaaccYcaWa_aX`SN_\_a_\f
@HWUSI-EAS1795_0092:3:1:7115:1837#0/1
TACACATATATCGAGTACGATCGGAGACGATTT
+HWUSI-EAS1795_0092:3:1:7115:1837#0/1
gggggggggcgggggggcffdfgggggdgfggg
@HWUSI-EAS1795_0092:3:1:7914:1841#0/1
GGCAATAGAAGTCACCCAAGTCGGAGCACAAGG
+HWUSI-EAS1795_0092:3:1:7914:1841#0/1
gggggggggggggggfgggeggggggggggggg
@HWUSI-EAS1795_0092:3:1:10156:1842#0/1
GGAGGAGGAGAAGTCGAGGAAGCAGCAGCGAAA
+HWUSI-EAS1795_0092:3:1:10156:1842#0/1
gggggggggggcgggfggefgg_gfeggggggg
@HWUSI-EAS1795_0092:3:1:10463:1836#0/1
TTAAAGGGAAATCACAACAACGTGAATTTCCAT
+HWUSI-EAS1795_0092:3:1:10463:1836#0/1
hhhhghhhhhhhhhhghghhhhhghhhhggheg
@HWUSI-EAS1795_0092:3:1:11235:1843#0/1
GAAACTAATCGGACTCCTTTTGATTTTGCTGAA
+HWUSI-EAS1795_0092:3:1:11235:1843#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:11791:1842#0/1
TATCCTAGTCATTTTAAACCCCGACCTCACACG
+HWUSI-EAS1795_0092:3:1:11791:1842#0/1
hhhhhhehhhfhhhhhhhhhhhhhhhhdhhhhh
@HWUSI-EAS1795_0092:3:1:12226:1842#0/1
GCACACTGTTCGACTTCTCCGAGCCGCTCAGCG
+HWUSI-EAS1795_0092:3:1:12226:1842#0/1
hhhhhhhhhhhhhhhhhfhhfhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:13721:1839#0/1
ATCAAGGTCATGGAGGCTGAGGAGCGAAGGGGC
+HWUSI-EAS1795_0092:3:1:13721:1839#0/1
cfdfcf_fcafffdacfb]^daO_\`ZdfKbfX
@HWUSI-EAS1795_0092:3:1:14751:1844#0/1
CTCGAATCTATGGGTGGTGGTGCATGGCCGTTC
+HWUSI-EAS1795_0092:3:1:14751:1844#0/1
fffffffffffffcffcZdd^dffcfdfffffa
@HWUSI-EAS1795_0092:3:1:15367:1843#0/1
GAAACTAATTGCTAGCCTGCTCCTGTTGGCCGT
+HWUSI-EAS1795_0092:3:1:15367:1843#0/1
gggggaggcgfdeffffaffffgegg]ffffec
@HWUSI-EAS1795_0092:3:1:15534:1842#0/1
GTCGAATGTAGTCCACTTGCTTTTTTCTTCTGT
+HWUSI-EAS1795_0092:3:1:15534:1842#0/1
hhhhhhhghghhhhghhhgfhhhhhhghhghhh
@HWUSI-EAS1795_0092:3:1:15792:1842#0/1
TTGGCTTCGTCGCAATGCTGCTGATCGCCAAGG
+HWUSI-EAS1795_0092:3:1:15792:1842#0/1
hghhhhhhhfhhghhhhhhghhhhfhhhhhghc
@HWUSI-EAS1795_0092:3:1:15815:1837#0/1
AAACACAGTAGAAGAGTTGCTTAAACAAACTTG
+HWUSI-EAS1795_0092:3:1:15815:1837#0/1
gggggggggggfgeggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:16653:1845#0/1
GAGGGATACCTGTGAGCAGCTTTCACTCCTACA
+HWUSI-EAS1795_0092:3:1:16653:1845#0/1
gggggfgdgggffggggggggggdgfggggggg
@HWUSI-EAS1795_0092:3:1:16728:1835#0/1
CCTGAAGAACCAGATCGGTGACAAGGACAAGCT
+HWUSI-EAS1795_0092:3:1:16728:1835#0/1
ffcffccfcfdff__d_]Ya``eccbeeeca]Y
@HWUSI-EAS1795_0092:3:1:17416:1842#0/1
CGGAACAATATGCCTACATGCTGGAACTTAAGC
+HWUSI-EAS1795_0092:3:1:17416:1842#0/1
f^fdfffhahehgahhegfhfhffY\ffffcfh
@HWUSI-EAS1795_0092:3:1:17615:1841#0/1
CCCGGAGGTCCTGGCATGCCGGTTTGGCCGGGC
+HWUSI-EAS1795_0092:3:1:17615:1841#0/1
hhhhhhhhghhehhhhcghhhhhhhghgfhghh
@HWUSI-EAS1795_0092:3:1:18215:1836#0/1
GAGAGCTTCAAAAGGCAGTTTAGCCGATACATC
+HWUSI-EAS1795_0092:3:1:18215:1836#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhhchghhh
@HWUSI-EAS1795_0092:3:1:18713:1846#0/1
TGGCAATGCTGTGCGGGGCCGAGGCGATGGTGG
+HWUSI-EAS1795_0092:3:1:18713:1846#0/1
hhhhhhghea_dggghaghhgdhfghgehhbhf
@HWUSI-EAS1795_0092:3:1:19174:1846#0/1
GGGGCAGGGGCTGCCGGAAAGGGGCTAACAAAA
+HWUSI-EAS1795_0092:3:1:19174:1846#0/1
fcgggggggdggdfffa_ffdfeggggg_gggc
@HWUSI-EAS1795_0092:3:1:19432:1844#0/1
AAAACATTTGAGAGGGTTTGGTGCAACTGTTTA
+HWUSI-EAS1795_0092:3:1:19432:1844#0/1
ff^ffccfad\fffJfffffccff_affcdaff
@HWUSI-EAS1795_0092:3:1:1782:1847#0/1
CGAGGCTGCGGTTGGAATGGTATTTGAGGAGGC
+HWUSI-EAS1795_0092:3:1:1782:1847#0/1
ffdfffffggggffgdgffc_ffc_f[fddfef
@HWUSI-EAS1795_0092:3:1:2728:1854#0/1
TTTGTCTTGAGTATATTCCTACAGAGAATCAAC
+HWUSI-EAS1795_0092:3:1:2728:1854#0/1
ffgcgggf[fffd]fffgggggfdfffeggggg
@HWUSI-EAS1795_0092:3:1:3278:1857#0/1
GGCTTACACCGGTTTGAACTCAGATCATGTAAG
+HWUSI-EAS1795_0092:3:1:3278:1857#0/1
hfhchhhhhhhhfhfdfhghhffhhghhfhheg
@HWUSI-EAS1795_0092:3:1:4138:1850#0/1
GTGGAACAGGGCATGGTCGACGGCCAAGAGACG
+HWUSI-EAS1795_0092:3:1:4138:1850#0/1
gggggggggdggggggfggggffcf]ca^aQ`a
@HWUSI-EAS1795_0092:3:1:4220:1848#0/1
TTGTGATGTACGAACCAGGCGCGGAGGATTTGA
+HWUSI-EAS1795_0092:3:1:4220:1848#0/1
hhhhghhdhehhhhghghhhhhhgaghcggfdg
@HWUSI-EAS1795_0092:3:1:4406:1857#0/1
CATGGACCTGAGGTCCTCCACGGATCTACTCGG
+HWUSI-EAS1795_0092:3:1:4406:1857#0/1
ce]fa]badc[`fdd[_]``Xa^^W^^dR^bbd
@HWUSI-EAS1795_0092:3:1:4717:1856#0/1
CATTAAGCTGTACGTGCGCCGTGTCTTCATCAC
+HWUSI-EAS1795_0092:3:1:4717:1856#0/1
gggggggggegggggdggfcagggggggggdgg
@HWUSI-EAS1795_0092:3:1:5172:1848#0/1
GCAACAAGCCCTACATCTCCCTGCCTAAGGGCA
+HWUSI-EAS1795_0092:3:1:5172:1848#0/1
hhhhhhghhfhhhhhhfghhhfghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5196:1850#0/1
GGGCCTTGCGCGTGGGCTTGGGCAGGATCTTGC
+HWUSI-EAS1795_0092:3:1:5196:1850#0/1
hhgghhhhhhhhghhfhfgehhgghhhchhhgh
@HWUSI-EAS1795_0092:3:1:5275:1857#0/1
TCAAGAACGATGGCACCGTCATCCACTTCAACA
+HWUSI-EAS1795_0092:3:1:5275:1857#0/1
hhhhhhhhhhhhhghhhhhhghhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5376:1850#0/1
TGGCTACCAACAGCGTCCGTCTGGACAACAACA
+HWUSI-EAS1795_0092:3:1:5376:1850#0/1
fhfhhhhhhhhhhhhehhhghhchghhhghhch
@HWUSI-EAS1795_0092:3:1:5834:1857#0/1
GCGACCTCGATGTTGGATTAAGATATAATTTTG
+HWUSI-EAS1795_0092:3:1:5834:1857#0/1
hhhhhhhhhhhhhhghehhchhahghhehhhfg
@HWUSI-EAS1795_0092:3:1:6190:1851#0/1
CTCATCATCGTCATCTATGTCATCGTACTCATC
+HWUSI-EAS1795_0092:3:1:6190:1851#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6293:1853#0/1
GTTTTTTTGTGTTTTTTTTTTTTTTTTTTCTTA
+HWUSI-EAS1795_0092:3:1:6293:1853#0/1
hhhhhhhhehghhhhhhhhhhhhhhhhhfVhfZ
@HWUSI-EAS1795_0092:3:1:6559:1847#0/1
GTCCAGCAGGCGGATAACCTGGCCCAGGAGGCC
+HWUSI-EAS1795_0092:3:1:6559:1847#0/1
hhhhhghhghhhhghhfhfdffhhhhehfhdhg
@HWUSI-EAS1795_0092:3:1:6755:1854#0/1
ATTGCGTTTAGATTTTGATAGTGGCAAGGACTT
+HWUSI-EAS1795_0092:3:1:6755:1854#0/1
ddPXccaadd]dPTSYS^^]a^^^Waacfa]fB
@HWUSI-EAS1795_0092:3:1:7864:1856#0/1
CATCAATGATGGTCACGTAGTACTTGGCAGTTT
+HWUSI-EAS1795_0092:3:1:7864:1856#0/1
ggfgfgggeegffgggggg[_gdfffffafffg
@HWUSI-EAS1795_0092:3:1:8080:1852#0/1
TGCGCAAGCTCTACGACATCAAGGTGGCCAAGG
+HWUSI-EAS1795_0092:3:1:8080:1852#0/1
hhhhhhhhhhhhhhhhhfhhhhhhdhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8167:1853#0/1
CTTCAAATGGCTGGTACTTTGGCGATGCCATTT
+HWUSI-EAS1795_0092:3:1:8167:1853#0/1
hghhhhghfhhhhhaghhhhcgehgffghhhhh
@HWUSI-EAS1795_0092:3:1:8190:1847#0/1
CACTGGACCGGTGGCCAAGGAATGCGCCGATCT
+HWUSI-EAS1795_0092:3:1:8190:1847#0/1
hhhhhhhhhhhhhhhhhfghhhdhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8288:1858#0/1
AAGTGATTGATGTGCCTGACGAGGCTGCCGATG
+HWUSI-EAS1795_0092:3:1:8288:1858#0/1
hhhhhghhgehhhghhfhhhhggdhhehghgah
@HWUSI-EAS1795_0092:3:1:8419:1849#0/1
GGGCGAGTAGGTCTTGGCGAACGATGCAATTTC
+HWUSI-EAS1795_0092:3:1:8419:1849#0/1
hhhhhhhhhhhhhhhghhhhhhhgghhhhhhhf
@HWUSI-EAS1795_0092:3:1:8459:1854#0/1
CACAATTCCAGCTGGTGCTCGCTAGTCGTCTTG
+HWUSI-EAS1795_0092:3:1:8459:1854#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8631:1852#0/1
GTGCATTCTGGGAAGTGTTAACTGATCCAGCAT
+HWUSI-EAS1795_0092:3:1:8631:1852#0/1
ffd_f_affccffffcfffffffffffggaagg
@HWUSI-EAS1795_0092:3:1:8965:1856#0/1
CCTAGTTAAAGTTAATGTTGACGTTGTAGTTGT
+HWUSI-EAS1795_0092:3:1:8965:1856#0/1
ggggggggggcggffgfdfdffgggggfdfdfg
@HWUSI-EAS1795_0092:3:1:9837:1855#0/1
CACGAGTTGAGGGCGAAGGGTCCGGTGACCAGC
+HWUSI-EAS1795_0092:3:1:9837:1855#0/1
hhhhhhhhhghhhhfghahfehhhhahhhghhh
@HWUSI-EAS1795_0092:3:1:10578:1855#0/1
CTGGCCGAAGACGTTGCTGACCTGGATGGGCTT
+HWUSI-EAS1795_0092:3:1:10578:1855#0/1
hhhhfhhhhfhhhhhhhhhhhhhhhffhhhhhh
@HWUSI-EAS1795_0092:3:1:10606:1854#0/1
GCGGATATTGGTACGGCCTGTTGAGAAGTTTGC
+HWUSI-EAS1795_0092:3:1:10606:1854#0/1
hhhhghhhhhhhhhhhhhhgghehhhhhghhhh
@HWUSI-EAS1795_0092:3:1:11037:1852#0/1
GGGTTCTTCGCTAAGTGCTGCGCACTCAGGTTG
+HWUSI-EAS1795_0092:3:1:11037:1852#0/1
cc\V\\`fffc[^[ca_\Ya\^SUUR_^ddba`
@HWUSI-EAS1795_0092:3:1:11378:1855#0/1
TTTTGCTCTATGTGTGGTTTCTGTCCGCACTGA
+HWUSI-EAS1795_0092:3:1:11378:1855#0/1
hgghhhghhghhhhhghhhhhhgfghhhhfghh
@HWUSI-EAS1795_0092:3:1:11404:1852#0/1
GAGGTCGACGCCGACACCAAGGAGATGTTGAAG
+HWUSI-EAS1795_0092:3:1:11404:1852#0/1
ZY_`Z_[_aSaaacYdd\^c_c^Z\\\\\`ZZc
@HWUSI-EAS1795_0092:3:1:11537:1853#0/1
CCTTATGGGACATGTGCTTTTATTAGGCTAAAA
+HWUSI-EAS1795_0092:3:1:11537:1853#0/1
g_gggggcgggfgggggggggggggcfggfggc
@HWUSI-EAS1795_0092:3:1:12662:1855#0/1
CGGCGAGCCTCGGCCTGATCAGCCAGCATCTTG
+HWUSI-EAS1795_0092:3:1:12662:1855#0/1
ggggggggfgggccf_eafffafffdfafgga]
@HWUSI-EAS1795_0092:3:1:13277:1850#0/1
TTCCGGCGAGGGTTTCGTTAAGGTAGTCAAGAA
+HWUSI-EAS1795_0092:3:1:13277:1850#0/1
ggdf_ggc_fadefffffgggcfadffcffffg
@HWUSI-EAS1795_0092:3:1:14393:1847#0/1
GGAGGCTTCCCTGGAGCACCTCCACCGCTTCCA
+HWUSI-EAS1795_0092:3:1:14393:1847#0/1
gggfgagffffdfgffggfgeggcggf_d]ff]
@HWUSI-EAS1795_0092:3:1:14818:1856#0/1
CGGGATTCGGTGAAGACGCTCTGTGATAAAATG
+HWUSI-EAS1795_0092:3:1:14818:1856#0/1
affd]ff\^\Y^^\aYZbdb^``\b`]\VVUUd
@HWUSI-EAS1795_0092:3:1:14887:1854#0/1
GTTCAGCTCGGTGACGGCGCAGGTAGCCTCGCT
+HWUSI-EAS1795_0092:3:1:14887:1854#0/1
hhhhhhhhhhhhghhhhhhhhhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15104:1847#0/1
CGACAACAGAGTGCGTCGCCGCTTCAAGGGACA
+HWUSI-EAS1795_0092:3:1:15104:1847#0/1
hhhhhhhhfhhhhehhhhhhgfhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:15174:1852#0/1
GCGCACCATTGTCATTCGGCGCGACTACCTGCA
+HWUSI-EAS1795_0092:3:1:15174:1852#0/1
gggegggcdcffggcggg\ffdafcffaggggd
@HWUSI-EAS1795_0092:3:1:15217:1858#0/1
GCCCAGTTGGCCAAGCCACTGCCCATTGCTGTC
+HWUSI-EAS1795_0092:3:1:15217:1858#0/1
hfhhghhhehhhhhhfhhhhehhhhdhhhhghh
@HWUSI-EAS1795_0092:3:1:15655:1848#0/1
CGCGGGTCATGTAGTGGATGGCATCCTGGTCGC
+HWUSI-EAS1795_0092:3:1:15655:1848#0/1
gfgggeggggdda]Zabfffffgggcgffdffg
@HWUSI-EAS1795_0092:3:1:15860:1851#0/1
CTGCGTTGAATTCTCATTCTCTGACCTAGATGC
+HWUSI-EAS1795_0092:3:1:15860:1851#0/1
hhghhhhhhhhhfhhhhhhhhhfhhghhgfhhh
@HWUSI-EAS1795_0092:3:1:15920:1853#0/1
GCCAGCGAGCAGTATGTGAGCGCTGTGGTCCTG
+HWUSI-EAS1795_0092:3:1:15920:1853#0/1
ggggfggccfffdffcefddffa`d]d[]`a]c
@HWUSI-EAS1795_0092:3:1:16047:1856#0/1
TCCTTCTCGAACTTCTCGATGGTACGCTTGTCG
+HWUSI-EAS1795_0092:3:1:16047:1856#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:16455:1848#0/1
CCAATTTGTCTCGTAACTCCACAAATCTCGCAG
+HWUSI-EAS1795_0092:3:1:16455:1848#0/1
hhhhhhhhhhghghhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:16563:1855#0/1
CTCTTGCTTTAGCAAACAATTTAAACCATGTAC
+HWUSI-EAS1795_0092:3:1:16563:1855#0/1
hhhhghhghhhhhhhhhhhhhhgghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:17237:1854#0/1
CGCGCGAGAACATCGCGAAGGCCGCCGAGCCCT
+HWUSI-EAS1795_0092:3:1:17237:1854#0/1
ggggggggfgggggggeaafffdffdf]geggg
@HWUSI-EAS1795_0092:3:1:17331:1847#0/1
GCGCGACTGTTCAAGCCAAGATACCGCTATGCC
+HWUSI-EAS1795_0092:3:1:17331:1847#0/1
cffffWffacffdRfffaffffc]ffc[ffc_`
@HWUSI-EAS1795_0092:3:1:18267:1850#0/1
GCTGACGGTCAAGGCGCGCGAGAACATCGCGAA
+HWUSI-EAS1795_0092:3:1:18267:1850#0/1
f_ffff_`Z``b^ad^d___^aR]`aWa^aWW^
@HWUSI-EAS1795_0092:3:1:18324:1849#0/1
GTTCGCCAGAAGGGGGGCATTGAAAATGTGCAG
+HWUSI-EAS1795_0092:3:1:18324:1849#0/1
ggggggggggggggggggegggeeggggggggg
@HWUSI-EAS1795_0092:3:1:18373:1850#0/1
CCGCATACTGTTCGCTTTATTGATTCCATTTTA
+HWUSI-EAS1795_0092:3:1:18373:1850#0/1
hhhhfhhhhfhhhhhhhhfhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18490:1858#0/1
CGCCGCTCCACGTTCGACTGGCTGGGCTTGAGC
+HWUSI-EAS1795_0092:3:1:18490:1858#0/1
c_caZcRaac[aULZ_USVWZZZ`BBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18681:1851#0/1
GGGAAGACGGCCTTAGCCTTCTTGACGCGGTTC
+HWUSI-EAS1795_0092:3:1:18681:1851#0/1
hhefhhfhfhhfggehhhghghfhhfhhghahe
@HWUSI-EAS1795_0092:3:1:19275:1857#0/1
TAGCAAGCCCATTGGCAATCTGATCAAGCAAAC
+HWUSI-EAS1795_0092:3:1:19275:1857#0/1
hhhghffhhhhghchhhhhhhhhhghhgghhhh
@HWUSI-EAS1795_0092:3:1:19779:1854#0/1
GCCGCCGTTCTGCCTCCATTCGCGAGTCCAAGA
+HWUSI-EAS1795_0092:3:1:19779:1854#0/1
ff_f\acd[cdbBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2960:1861#0/1
GGGACCTTAAAGAGATATATTCGACACATTTTG
+HWUSI-EAS1795_0092:3:1:2960:1861#0/1
ggfgcggggggfcafafffffff_fffeggggg
@HWUSI-EAS1795_0092:3:1:3049:1859#0/1
TGAATTTTTGACAACCATTAACCCATTTTTCGA
+HWUSI-EAS1795_0092:3:1:3049:1859#0/1
fddfggaggg]g^fdcfgggaggfecggcdggg
@HWUSI-EAS1795_0092:3:1:3438:1862#0/1
ATTGCGGCACTGGATGCGGCCAACAGCCGGCTG
+HWUSI-EAS1795_0092:3:1:3438:1862#0/1
egggacgffcfdffcaf[c\cce`_`dc^\^QR
@HWUSI-EAS1795_0092:3:1:3456:1869#0/1
GCTGGTCAAGGTGCACCTGGACAAGAACCAGCA
+HWUSI-EAS1795_0092:3:1:3456:1869#0/1
adgggggffffcfffffggggggfcgggggggg
@HWUSI-EAS1795_0092:3:1:3913:1866#0/1
TATCAATGTCCTCGGGAAGACCGTCTGGCATAG
+HWUSI-EAS1795_0092:3:1:3913:1866#0/1
f^df_cfffcWfd_e[ea[aed\YYaBBBBBBB
@HWUSI-EAS1795_0092:3:1:4333:1869#0/1
TGGGCCTTGGGGCGGTTCAGGGTGATCACGCCT
+HWUSI-EAS1795_0092:3:1:4333:1869#0/1
hhhhhhhfhhhhhghehffdffZaaa`hehhhg
@HWUSI-EAS1795_0092:3:1:4451:1870#0/1
AAGGAGTCCAAGGCCAAGCGCGAGGAGGCCAAG
+HWUSI-EAS1795_0092:3:1:4451:1870#0/1
hhhfhhhhhhhghhghhhhhdhehhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4523:1869#0/1
CAGAACCGTTTCTGCTACTCGAAGAGATAAGAA
+HWUSI-EAS1795_0092:3:1:4523:1869#0/1
dff]fafcfcff[Weaea]`a]fff[abf]b]S
@HWUSI-EAS1795_0092:3:1:4928:1867#0/1
CACCGCCCAGGTCATCGTGCTGAACCACCCCGG
+HWUSI-EAS1795_0092:3:1:4928:1867#0/1
hghfhhhhhhhhhhhghgaghhgfgcghghghc
@HWUSI-EAS1795_0092:3:1:5138:1869#0/1
TTCGTGCTTGTCCTCCACCTCTTCTGCCTTTTC
+HWUSI-EAS1795_0092:3:1:5138:1869#0/1
hhhhhhhhhhhhhghhhhhghghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:5303:1858#0/1
GTCTGACGACGACATGGGCTTCGGTCTGTTCGA
+HWUSI-EAS1795_0092:3:1:5303:1858#0/1
a_dadddc\__cad_SSacccc^S[QZ^\aZZW
@HWUSI-EAS1795_0092:3:1:5645:1862#0/1
ATATATATTAATATTTATAAATCGCCTCCAGCT
+HWUSI-EAS1795_0092:3:1:5645:1862#0/1
fhhhhhhhhhhhhhWhhhghhghhghhhhhhfh
@HWUSI-EAS1795_0092:3:1:5805:1862#0/1
AGCCAGCCAAACAGCGAAGCAGCTAAACAGCCA
+HWUSI-EAS1795_0092:3:1:5805:1862#0/1
hhhhhhhhhhhghghhhhfghfhhhhhhhfhfh
@HWUSI-EAS1795_0092:3:1:5852:1864#0/1
ACGGAATACTGGTTGGCCAGCTTTTGCAGGCGG
+HWUSI-EAS1795_0092:3:1:5852:1864#0/1
fff_fcf\Z^^affff[]^XZ]ac\a[dd[]bf
@HWUSI-EAS1795_0092:3:1:6436:1866#0/1
CAAGCACGGTCTGGAGGAGGAGAAATGCTAGAT
+HWUSI-EAS1795_0092:3:1:6436:1866#0/1
hhhhhhhhhhhhhhhhhhhhhghhhghhhhghg
@HWUSI-EAS1795_0092:3:1:6820:1863#0/1
GGAGCAGAGGATCAACTCGTTCTTCAACTACTG
+HWUSI-EAS1795_0092:3:1:6820:1863#0/1
hhhghhhhhhhhhhhhhhhghghhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:7930:1860#0/1
CCGGGAAGCGACTGAGAGAGCCATAAAAGTAGC
+HWUSI-EAS1795_0092:3:1:7930:1860#0/1
hhhhhhhhhhhhhhgfdhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:8320:1866#0/1
CGAAGACAATCAAGGCTGTATTAGCATAGCAAA
+HWUSI-EAS1795_0092:3:1:8320:1866#0/1
hhhhffhhghhhhfhggghffhfhcfeghfhhh
@HWUSI-EAS1795_0092:3:1:8587:1864#0/1
CGGCCCTCGAAATCGCTTGCCTCGTTAGTAAAC
+HWUSI-EAS1795_0092:3:1:8587:1864#0/1
dc_f\ffff^ffdadcRaa`\adddddfffcfc
@HWUSI-EAS1795_0092:3:1:8690:1860#0/1
GGCTATCCTGGGCGATAAGGGCGCTGCAAGCGT
+HWUSI-EAS1795_0092:3:1:8690:1860#0/1
hhhhhhhhhhhhhhghhhhhhhehghhhhheh_
@HWUSI-EAS1795_0092:3:1:8827:1861#0/1
TCTTGGACTCGGTCTCTTCGCCAAGGCCCTGGA
+HWUSI-EAS1795_0092:3:1:8827:1861#0/1
aaaaa[dddbbdbd]bddc`caff]]_[a^^^]
@HWUSI-EAS1795_0092:3:1:8847:1869#0/1
TTGCTTTATCCGGGCGAGTAGGTCTTGGCGAAC
+HWUSI-EAS1795_0092:3:1:8847:1869#0/1
gdgggggeggggggggegggggcffffgfgagg
@HWUSI-EAS1795_0092:3:1:9033:1859#0/1
ATATTGTTGGTTTCTACATATCCTGCGAACTCT
+HWUSI-EAS1795_0092:3:1:9033:1859#0/1
hhhhhghhgfhhhhhhhfhgghhhghhehhhhh
@HWUSI-EAS1795_0092:3:1:9374:1864#0/1
GGTGGAGACGCCAGTGCCCGGTCATGTGACCAA
+HWUSI-EAS1795_0092:3:1:9374:1864#0/1
ggggggggggggeggggggggcgggffgggfgg
@HWUSI-EAS1795_0092:3:1:9399:1869#0/1
TTGGGGCGCAGGTTGTTGGTGTGTCCGCACTTC
+HWUSI-EAS1795_0092:3:1:9399:1869#0/1
hhhhhghhhhhhghhhhhhhhhehhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9700:1863#0/1
CTCCGTGCTTATCTAGTCGCCGTTTTAGAAGCT
+HWUSI-EAS1795_0092:3:1:9700:1863#0/1
fafffff]ddadfcffffffcdaddadffffff
@HWUSI-EAS1795_0092:3:1:10308:1863#0/1
GGGAAGTGGATGAGGAGTGGATGCATAAATGCA
+HWUSI-EAS1795_0092:3:1:10308:1863#0/1
gggggggggeggfgfgggggdgfeaffgafggg
@HWUSI-EAS1795_0092:3:1:10437:1868#0/1
GCTGGATTGTGTAACATTTTCTTTTTTTTTTTT
+HWUSI-EAS1795_0092:3:1:10437:1868#0/1
]`Y\a^Z\\Y\YSVQQSWV[YU[[[[]_____c
@HWUSI-EAS1795_0092:3:1:10906:1870#0/1
GCACTTCTTGGTCTCGGCCTTGTAGACATAGAC
+HWUSI-EAS1795_0092:3:1:10906:1870#0/1
hhhhhhhghfhhhhhfhhhhhghhehghhhhhh
@HWUSI-EAS1795_0092:3:1:10960:1859#0/1
GTCAGATTGGGATAGCCCCAGGTGATGTAGGGC
+HWUSI-EAS1795_0092:3:1:10960:1859#0/1
hhhhhfhfhhhgdhhhhhhchhdhfchfghhhh
@HWUSI-EAS1795_0092:3:1:11014:1859#0/1
TACGGACTCAAACGATGGTGAATGGGTTAACGT
+HWUSI-EAS1795_0092:3:1:11014:1859#0/1
ggggegggggggggfgggggfgdggggggggge
@HWUSI-EAS1795_0092:3:1:11180:1864#0/1
CAAAAATATAATTTGTATTTCTCGGCGCGCGCA
+HWUSI-EAS1795_0092:3:1:11180:1864#0/1
hhhhhhhhhhhhhhghhhhhhhhfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11694:1862#0/1
GGTTCACGTTGCACCGCTTGCGCAGGTAGGCCA
+HWUSI-EAS1795_0092:3:1:11694:1862#0/1
gggggggggggggggfggggedfgggdgggggg
@HWUSI-EAS1795_0092:3:1:12099:1867#0/1
AAGCGATTCCAGGAGCGCTCACATCTGCAGCGC
+HWUSI-EAS1795_0092:3:1:12099:1867#0/1
cccccS_\\Z]ZOVV\]ZaVaaSVSPScXaZcc
@HWUSI-EAS1795_0092:3:1:12124:1858#0/1
GTAGCCGTTCAAATTTTAAGTCTGTTCGACTTT
+HWUSI-EAS1795_0092:3:1:12124:1858#0/1
ggggfggggggggggggggagggggggfegggg
@HWUSI-EAS1795_0092:3:1:13462:1869#0/1
CATCCATTGTGGCCAATGAGGGTACCGCGCAAT
+HWUSI-EAS1795_0092:3:1:13462:1869#0/1
hhhhhhhhgfhhhhhhfhehhfhhhhgghhhhg
@HWUSI-EAS1795_0092:3:1:13609:1859#0/1
CAGCAATCTGCGCGACATCGCCACTCAGAACAA
+HWUSI-EAS1795_0092:3:1:13609:1859#0/1
hghhhhhhhfhghhhhhfhhhhfhhhghhghhh
@HWUSI-EAS1795_0092:3:1:13912:1867#0/1
GTTTATTGTTAATATAAGAATCTCAGATGTTTA
+HWUSI-EAS1795_0092:3:1:13912:1867#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:14378:1861#0/1
CTATTTTCGACAAGACCTCCAAGCGTTTTGACG
+HWUSI-EAS1795_0092:3:1:14378:1861#0/1
hhhhhhhhhhhhhhhhghhhhhhhhghhhhdhg
@HWUSI-EAS1795_0092:3:1:14765:1863#0/1
TGGGGTCGCAATGCTTCGGAAGTTGTTGGGAAT
+HWUSI-EAS1795_0092:3:1:14765:1863#0/1
gfggffgdfacfgfggfffccfffffcffQdff
@HWUSI-EAS1795_0092:3:1:14949:1858#0/1
TTTTAATATATTTTCTTTATTCTCGAGTAGAAA
+HWUSI-EAS1795_0092:3:1:14949:1858#0/1
hhhhhhgggchhhhchhfehhghhgdhaffffh
@HWUSI-EAS1795_0092:3:1:16310:1870#0/1
GGCATTTTGTGGTGTTGCTGTTGGCCATTCTGG
+HWUSI-EAS1795_0092:3:1:16310:1870#0/1
hhhhhhhhhhhhhhhhghhhhgehhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16974:1860#0/1
TTGGGCCATTCGCAATATATCAAGGAACTATTG
+HWUSI-EAS1795_0092:3:1:16974:1860#0/1
ac]]Xabc[]cccccSaacPccacaaacaaaXc
@HWUSI-EAS1795_0092:3:1:17595:1866#0/1
CACCCTGCACTTGGTGCTCCGCCTGCGTGGTGG
+HWUSI-EAS1795_0092:3:1:17595:1866#0/1
hhhhhdhhhhhhhhhhhhhhhfhgfffcffafh
@HWUSI-EAS1795_0092:3:1:17676:1862#0/1
CATCGCAGAGCAACGCTGCCGCTGGCACAGTTA
+HWUSI-EAS1795_0092:3:1:17676:1862#0/1
gggfgdgfggggffbf[dfdbdefef_ffdc[`
@HWUSI-EAS1795_0092:3:1:17915:1867#0/1
ACGAGGCAAGTCAGAAAATAGCACAAGCATACA
+HWUSI-EAS1795_0092:3:1:17915:1867#0/1
gggggggggagggfgggfcccffgggfcfeffg
@HWUSI-EAS1795_0092:3:1:17934:1860#0/1
GTGGGAAGTCCCGAAGTGGTGGCTGCCGTGGCG
+HWUSI-EAS1795_0092:3:1:17934:1860#0/1
egfffaaccdffdada`^\\a^`N\^]QTTRVO
@HWUSI-EAS1795_0092:3:1:18070:1862#0/1
CGACAACAGCTACATCAGCGGATATACTCCCAG
+HWUSI-EAS1795_0092:3:1:18070:1862#0/1
cadadbdcd]cd[d_ddccdcaWd_ddadaddc
@HWUSI-EAS1795_0092:3:1:18447:1866#0/1
TTGGCCGCTTCAAGGAGCTGCAGTTCTTCACCG
+HWUSI-EAS1795_0092:3:1:18447:1866#0/1
ghhhhhhhhhhhhhhhghhhhhhhhhhhfghhh
@HWUSI-EAS1795_0092:3:1:19246:1864#0/1
ATTCGGCAAAAATAATATTCGCCTGTTTAACAA
+HWUSI-EAS1795_0092:3:1:19246:1864#0/1
^\dffdfcfdaaffc`afffdfcbddefaffff
@HWUSI-EAS1795_0092:3:1:1903:1876#0/1
AATTTGCATTGTATGGCTTCTAAACCATTTAAA
+HWUSI-EAS1795_0092:3:1:1903:1876#0/1
gggggfgggdgggggggcffffcfffaggaggg
@HWUSI-EAS1795_0092:3:1:2924:1881#0/1
CGGTCATCTTGCGCAGGACAGGTGTTGGTGTTA
+HWUSI-EAS1795_0092:3:1:2924:1881#0/1
ffafaffggcgcffffcQa^a^\edeeebeedf
@HWUSI-EAS1795_0092:3:1:3172:1877#0/1
GCTTAACATGTTCCAGACACTGCGCCTGCTGAT
+HWUSI-EAS1795_0092:3:1:3172:1877#0/1
hghghhhhhhhhhhhghhhghfhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:3531:1879#0/1
ACTTCATCTCGGCGGCCGAGTTGCGTCACGTGA
+HWUSI-EAS1795_0092:3:1:3531:1879#0/1
KffffffgggggggggefWcffV^W\U`]``bc
@HWUSI-EAS1795_0092:3:1:3665:1875#0/1
CTCCTTCTTGTAATTCATAATGGCATCGAACAC
+HWUSI-EAS1795_0092:3:1:3665:1875#0/1
hhhhhghhhehgghhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:5068:1875#0/1
CACCGAAGCGCTGAAGCCCTACGGCAAGGGCCT
+HWUSI-EAS1795_0092:3:1:5068:1875#0/1
ed_fffff]fffd]fc_]d]ddggg[Rb[dabc
@HWUSI-EAS1795_0092:3:1:5703:1879#0/1
GCCGATCATCAGCTTGTCCAGGCCGTACATGGC
+HWUSI-EAS1795_0092:3:1:5703:1879#0/1
ffghhgghghhhhhcaghehfffffchefeffc
@HWUSI-EAS1795_0092:3:1:6615:1874#0/1
CGCTGGGTGATTTCCATCTTCTTGACCATCTTA
+HWUSI-EAS1795_0092:3:1:6615:1874#0/1
S]\\[a_V\[\Ucc_cc^aa^acca\cccaccc
@HWUSI-EAS1795_0092:3:1:7232:1877#0/1
CAACAAACCGAAACCACAACCCCGATCCAAGCT
+HWUSI-EAS1795_0092:3:1:7232:1877#0/1
aZac]c\PZMXZSTXVSa]_aaccYca^YI^YP
@HWUSI-EAS1795_0092:3:1:7744:1879#0/1
TCCGCGTTCATTTTGATTTTACTAGAATTTAGC
+HWUSI-EAS1795_0092:3:1:7744:1879#0/1
hhhghghhhghhhhhhhhhhhhhhhghhhghhc
@HWUSI-EAS1795_0092:3:1:7762:1870#0/1
TTCAATTTAAGAACTGACTTTACTTGACTGCCG
+HWUSI-EAS1795_0092:3:1:7762:1870#0/1
hhhhhhhhhhfhhhhhhhhhhghhhhgfhhhhh
@HWUSI-EAS1795_0092:3:1:7885:1874#0/1
CCGGTTCCGTCGGGGCCGAAGCACCAGATCTTA
+HWUSI-EAS1795_0092:3:1:7885:1874#0/1
hhhhghhhhhhghhhhhgghhhhhfhchhhhhh
@HWUSI-EAS1795_0092:3:1:7923:1880#0/1
GGCGGAACATGTTGCGGTTCACCTCGGCCCGCT
+HWUSI-EAS1795_0092:3:1:7923:1880#0/1
hhhhhhhghhhhhhhhghhhfhhhhhhhhhhhd
@HWUSI-EAS1795_0092:3:1:7994:1880#0/1
CGAACACGAGGATGCAAATTGCGAGCTTGGCCA
+HWUSI-EAS1795_0092:3:1:7994:1880#0/1
hhghhhhghhhhhhhhhhhgfhhfhhhhhhhhc
@HWUSI-EAS1795_0092:3:1:8480:1879#0/1
GCGCGGTGTAGGGGAACTTGATGCGGTACTTGG
+HWUSI-EAS1795_0092:3:1:8480:1879#0/1
hhhhhhhhhhhhhhghhhhghdhhhhhggghhh
@HWUSI-EAS1795_0092:3:1:8673:1880#0/1
CTGGTGCAGCGGACTTCTCAACAGGGGCGGCCA
+HWUSI-EAS1795_0092:3:1:8673:1880#0/1
dfa_`accdedacffdcffff_^^^^\ccccfg
@HWUSI-EAS1795_0092:3:1:8910:1871#0/1
CCGATTTCCTGGGGTACTTGGGACTCCTGGGCA
+HWUSI-EAS1795_0092:3:1:8910:1871#0/1
hhhhhhhhhhhhhhghhhhfhghhhhhhhhhff
@HWUSI-EAS1795_0092:3:1:8957:1873#0/1
CCTAGTTAAAGTTAATGTTGACGTTGTAGTTGT
+HWUSI-EAS1795_0092:3:1:8957:1873#0/1
__WZ]\_acccacYc_RY]NMTZZ_\\P]^`SV
@HWUSI-EAS1795_0092:3:1:9142:1877#0/1
GTATGTTTTCCATTCATGTTTTCTGTTTTTGTG
+HWUSI-EAS1795_0092:3:1:9142:1877#0/1
gggegfgggggggggegcggggggggggggggf
@HWUSI-EAS1795_0092:3:1:9938:1875#0/1
AGATTAGATGCATGTTCATCTAAGATCTTGGGC
+HWUSI-EAS1795_0092:3:1:9938:1875#0/1
aa^bfdd_ffff[ffffcffdfffWcff]fefa
@HWUSI-EAS1795_0092:3:1:10258:1880#0/1
GGGGGGGGTTGTGTGTTAGGGACTTACAGCAAC
+HWUSI-EAS1795_0092:3:1:10258:1880#0/1
hghhghhhhhhgfffhhhhhhhhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:10469:1878#0/1
GTGGGTTTATTGAAAAGGAAACTCCTTAGGCTA
+HWUSI-EAS1795_0092:3:1:10469:1878#0/1
hghhhhhhghhhhghhhhghhhhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:11680:1874#0/1
GCGGCGCTTGGCCTCCTCGCGCTTGGCCTTGGA
+HWUSI-EAS1795_0092:3:1:11680:1874#0/1
ggggggggggggggggggggggggfggfggcfg
@HWUSI-EAS1795_0092:3:1:11884:1874#0/1
AGCAATTTCGGATTACTTTTCATTCTTTTTTTT
+HWUSI-EAS1795_0092:3:1:11884:1874#0/1
cggggggggggfggggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:11952:1880#0/1
AAGTACTCGCTGGACGAGTTCGAGCGCAAGATG
+HWUSI-EAS1795_0092:3:1:11952:1880#0/1
gggggggggggggggfggggfgafggfgagddg
@HWUSI-EAS1795_0092:3:1:12412:1872#0/1
TGGATGCTGGTCATCTTGTAGAGTTTGGATCTC
+HWUSI-EAS1795_0092:3:1:12412:1872#0/1
hgghghghhhhhhhhhhggfhgfhhhhhfhhfh
@HWUSI-EAS1795_0092:3:1:12967:1876#0/1
GCCTTCGAGAAGCGTCGCGCCGAGGGCGACAAG
+HWUSI-EAS1795_0092:3:1:12967:1876#0/1
ggggggggggggggggcgfgggdggdcggggge
@HWUSI-EAS1795_0092:3:1:13203:1875#0/1
CATAAATGCAAGTGTTTTCCCAGTGTGCACTCT
+HWUSI-EAS1795_0092:3:1:13203:1875#0/1
hhhhhhhhghhhhhhhhhhhhhhhhghefhhhh
@HWUSI-EAS1795_0092:3:1:13271:1878#0/1
GTAGAACTTGGTGCCCTCCTGCAGATTTCCAGA
+HWUSI-EAS1795_0092:3:1:13271:1878#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14517:1876#0/1
CATTGACTGAGGACAGCACCACGTTTCCCAAAT
+HWUSI-EAS1795_0092:3:1:14517:1876#0/1
f_gggggdggcfggggdgfgagggggggggcgg
@HWUSI-EAS1795_0092:3:1:15414:1871#0/1
TCGGCTATTGTACGTGCGGAACCTGCCGTACAA
+HWUSI-EAS1795_0092:3:1:15414:1871#0/1
gggggggggfggggggggggggggggggfgggg
@HWUSI-EAS1795_0092:3:1:15455:1878#0/1
CCCTCCTGTCAGACATCTACGACACCAGCGAGA
+HWUSI-EAS1795_0092:3:1:15455:1878#0/1
hhhhhhhhhhghhhhhhhhhhghghchhhhhhh
@HWUSI-EAS1795_0092:3:1:15475:1882#0/1
CTCCTCTCGTGGATCATTTGGTTGTGATCAACG
+HWUSI-EAS1795_0092:3:1:15475:1882#0/1
hhhhhhhhghhhhhhghhgfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15771:1874#0/1
GCGAGAAGACGGTTGGTGTTGTTATTTTTTTTT
+HWUSI-EAS1795_0092:3:1:15771:1874#0/1
aQZV_[Xf]ddfZ]]b^c^[aa^\^^Zcccc_^
@HWUSI-EAS1795_0092:3:1:16275:1878#0/1
GATTGGTGAAGCCGGTAGAGCGTAAGGAAATCG
+HWUSI-EAS1795_0092:3:1:16275:1878#0/1
hhhhhhhhhhhhhhhhhfghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16398:1879#0/1
CTCGTTTGTGAGTTTCTTAGCATTCCACCTTTT
+HWUSI-EAS1795_0092:3:1:16398:1879#0/1
ffacdcba^cac^ccc\__aWW\^\ZU]^a]]f
@HWUSI-EAS1795_0092:3:1:16545:1881#0/1
CCCCACTATGCCGTGGTGGTCGAGGACGCTGCT
+HWUSI-EAS1795_0092:3:1:16545:1881#0/1
hhhhhhhhhhhhhhhhggfhhgfhhhfhhfffg
@HWUSI-EAS1795_0092:3:1:16590:1876#0/1
GGCCAGTCGAGGTAATTGCGAGTTACATTAAAC
+HWUSI-EAS1795_0092:3:1:16590:1876#0/1
gggggggggcggfgcfgadf_ffffffgggcgg
@HWUSI-EAS1795_0092:3:1:16637:1878#0/1
GCGCGGATCGCGCTTGAAGAACATCCAAACCCG
+HWUSI-EAS1795_0092:3:1:16637:1878#0/1
hhhhhhhhhghhhhhfhhgfhghhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:17107:1878#0/1
TGCTTGCCTTTGAGGGCAGGTTAGTAAGGATGT
+HWUSI-EAS1795_0092:3:1:17107:1878#0/1
ggggggggggggggggg]ffffdffffggdfgf
@HWUSI-EAS1795_0092:3:1:18041:1882#0/1
ATCTTTTTTAGCAGCGTGTTTGAGATGTATTCT
+HWUSI-EAS1795_0092:3:1:18041:1882#0/1
hhehghhhhhhhhhhhhehhhfaehhghhhhgh
@HWUSI-EAS1795_0092:3:1:18271:1872#0/1
ATCCACCAGGCCTGCAAGGCCCTGGACAAGCGT
+HWUSI-EAS1795_0092:3:1:18271:1872#0/1
cgfccfc\aacdf]]aa[aadef][ff`ZU`XO
@HWUSI-EAS1795_0092:3:1:18310:1874#0/1
CGGGTGTGTTGAAGGTCTCGAACATGATCTGGG
+HWUSI-EAS1795_0092:3:1:18310:1874#0/1
hhhhhhghhhhhghhhhhhhghhgghhhgfhhh
@HWUSI-EAS1795_0092:3:1:18932:1875#0/1
CCTCGCTTGACGGTGGAGGCCTTACCAATGTGC
+HWUSI-EAS1795_0092:3:1:18932:1875#0/1
ggggggegaggafddfcdaffeegdggf[aacb
@HWUSI-EAS1795_0092:3:1:1270:1888#0/1
CGACGGATACGAATGCTAAATGCAGACGAGGCC
+HWUSI-EAS1795_0092:3:1:1270:1888#0/1
ccc_VV_dad[^aSQcaYSaa\K_V__acaaaY
@HWUSI-EAS1795_0092:3:1:1563:1882#0/1
AGAAAATCGAAAAGATCCACCTGCAAAAGACGC
+HWUSI-EAS1795_0092:3:1:1563:1882#0/1
dafffffggfeggc`fefgggggggggggggcg
@HWUSI-EAS1795_0092:3:1:1953:1887#0/1
CGCCAAGCAGGTACTCGTCGCGACCGCTCACTT
+HWUSI-EAS1795_0092:3:1:1953:1887#0/1
ggggag^\aeeaaR_dcfff_ad^deaH]OX_f
@HWUSI-EAS1795_0092:3:1:1977:1885#0/1
GTGCTGAGTGTCTTACTATGCGAATGAGCGATT
+HWUSI-EAS1795_0092:3:1:1977:1885#0/1
afgfggadffffgcgggggegecafffggdggg
@HWUSI-EAS1795_0092:3:1:2833:1884#0/1
GGGGGTTTGGCATTGCGAAGGACGACCGTTTTG
+HWUSI-EAS1795_0092:3:1:2833:1884#0/1
gggegggg[gfeaafffaffdfZa^^Uebdbfg
@HWUSI-EAS1795_0092:3:1:3379:1884#0/1
GCTGGATCTGGTGGTCTTCGGACGTGCATGCGC
+HWUSI-EAS1795_0092:3:1:3379:1884#0/1
Y^Y_^c^\[\\XW`^adffffedfWcffca]fa
@HWUSI-EAS1795_0092:3:1:3417:1892#0/1
CTAAGCGCGATCAAGCCCAGGAAAAGGAGAACA
+HWUSI-EAS1795_0092:3:1:3417:1892#0/1
hhhhhhhhhhhhhhhghhfhhhghdh_gfhhfh
@HWUSI-EAS1795_0092:3:1:3702:1892#0/1
CGTATGGTCTTGTACCGACGACAGATCTTTCAA
+HWUSI-EAS1795_0092:3:1:3702:1892#0/1
hhhgfhhhhghefafffhhhhhhhhhhhhhhdh
@HWUSI-EAS1795_0092:3:1:3753:1884#0/1
TAGGCGTCTTTGAAGTTACCCTGGATGAGATCG
+HWUSI-EAS1795_0092:3:1:3753:1884#0/1
hhghhhhhhhhhhghhhhhhhhhhfhhhgdhgg
@HWUSI-EAS1795_0092:3:1:4265:1886#0/1
TCTGAGTTCAAACCGGTGTAAGCCAGGTTGGTT
+HWUSI-EAS1795_0092:3:1:4265:1886#0/1
gggfgggggggggggggfffffggcfgffd_fc
@HWUSI-EAS1795_0092:3:1:4372:1883#0/1
GCAATATACGGCTTGAAGCAGTCAGGCAGAGAG
+HWUSI-EAS1795_0092:3:1:4372:1883#0/1
hhhhhhhhhghhhhgehhhhghehhhghgedgh
@HWUSI-EAS1795_0092:3:1:4604:1893#0/1
CCCCGGGGTACCTTTTATCCGTTGAGCGACACC
+HWUSI-EAS1795_0092:3:1:4604:1893#0/1
_fcccffggggggggggegggggg_egddddda
@HWUSI-EAS1795_0092:3:1:4693:1888#0/1
CACGACCTCCTCGATGTAGGCAGTCCCATTGAG
+HWUSI-EAS1795_0092:3:1:4693:1888#0/1
hhhhhhhhhhhhhhhghghhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:5428:1888#0/1
CGGCAGATGGGTCTCAAAGAATTTGTACAGTTC
+HWUSI-EAS1795_0092:3:1:5428:1888#0/1
hhhhhhhhghhhhhhhhhghhh[ffffhghhhg
@HWUSI-EAS1795_0092:3:1:5520:1893#0/1
CGGATACGAATGCTAAATGCAGACGAGGCCGCC
+HWUSI-EAS1795_0092:3:1:5520:1893#0/1
hhhhhhhhhhhhhgfhhhhhhghhhghhhgfhh
@HWUSI-EAS1795_0092:3:1:5675:1886#0/1
TCGAGACATTCGTGATCGGCATGGTGTGCTACT
+HWUSI-EAS1795_0092:3:1:5675:1886#0/1
hfhhhghghhhfhheghhhhhhhhhhhhfghfh
@HWUSI-EAS1795_0092:3:1:6083:1887#0/1
GGACGCGCTGCAATGCGGGGCTTAGGTGTTGTT
+HWUSI-EAS1795_0092:3:1:6083:1887#0/1
hhghghhhhhhhghhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:6136:1888#0/1
GCTCGATGTTGATGGAGGTAATCTTCTTGACGA
+HWUSI-EAS1795_0092:3:1:6136:1888#0/1
hhhhhhhhhhhhhhhghhghghhhhhhhfhfhh
@HWUSI-EAS1795_0092:3:1:7406:1883#0/1
GGCAGCTCCAGACCCTCCTTGGTGACAGAGACC
+HWUSI-EAS1795_0092:3:1:7406:1883#0/1
ffcfc_L___\Zffcff_Zac^IZX_\X`^Z]_
@HWUSI-EAS1795_0092:3:1:9005:1883#0/1
ACGCAGTTATATTGGCGTATGGTCAACTGATCA
+HWUSI-EAS1795_0092:3:1:9005:1883#0/1
hhhhghhhhghhhhghehghhhhhhhghgghhh
@HWUSI-EAS1795_0092:3:1:9058:1886#0/1
GTCGCTTGTTGCGAAATTTAAAAACGAGTCGCT
+HWUSI-EAS1795_0092:3:1:9058:1886#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:9253:1888#0/1
CCGCAGGTGGCCGACGCCATCCTGGGCAATGCT
+HWUSI-EAS1795_0092:3:1:9253:1888#0/1
hhhhhhhghhhghhdfhhghhhghghcfhchdh
@HWUSI-EAS1795_0092:3:1:9443:1888#0/1
GCGCGTGCAGCCCAGGACATCTAAGGGCATCAC
+HWUSI-EAS1795_0092:3:1:9443:1888#0/1
hhhhhhhhhhhhhhhghhhhfghhhgfhhhghh
@HWUSI-EAS1795_0092:3:1:10005:1885#0/1
GTGGGACTGCTGCTTCCGCTACTGGCGCTTCCT
+HWUSI-EAS1795_0092:3:1:10005:1885#0/1
ghhhhhhhhhhhdhfhhhhhhghhchhhhhhee
@HWUSI-EAS1795_0092:3:1:10487:1889#0/1
AACAAAACCATCAGAAAGCAGGCAATGTCATTG
+HWUSI-EAS1795_0092:3:1:10487:1889#0/1
hhhhhhhhhhhghhhhhfhghhhgghhhhdhhh
@HWUSI-EAS1795_0092:3:1:11303:1892#0/1
TTGTGCAGATCCGCAAAAGTACTTGTGACAGCA
+HWUSI-EAS1795_0092:3:1:11303:1892#0/1
gegfdffc_cfffafffffcfffffcfgggagg
@HWUSI-EAS1795_0092:3:1:11418:1882#0/1
GCACAGTTCCTGAGGACGAGCCAACCATCGAGG
+HWUSI-EAS1795_0092:3:1:11418:1882#0/1
hhhhhhhhhhhhhhghhhhhdhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:11737:1883#0/1
CTCACACCTTTAAGTGTACAGCGCTACAAGTGA
+HWUSI-EAS1795_0092:3:1:11737:1883#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:11828:1887#0/1
TATTCCTGGCTTGGAGGGTCTATCCGGAATGCC
+HWUSI-EAS1795_0092:3:1:11828:1887#0/1
hhhhhhhhghhhfhcghfehhhghhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:12240:1890#0/1
ATTTTAAATTAAATGTACCTTTAATTGCCGTCT
+HWUSI-EAS1795_0092:3:1:12240:1890#0/1
hghhhhhhhghhhhfhhhhhhhhhhehghhhhh
@HWUSI-EAS1795_0092:3:1:12628:1890#0/1
GTTTGACCTGCTCCCTGATGATGAAGGGTCGCA
+HWUSI-EAS1795_0092:3:1:12628:1890#0/1
gggfggggggffggggg_ff_fffffdfeffff
@HWUSI-EAS1795_0092:3:1:12808:1882#0/1
ATCGTGACCAACTGGGACGATATGGAGAAGATC
+HWUSI-EAS1795_0092:3:1:12808:1882#0/1
gggggggcggggggggdffa_]fff[_fffccc
@HWUSI-EAS1795_0092:3:1:13692:1889#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13692:1889#0/1
hhgghhhhhhhgfhghghhhhhhghhgdahhhg
@HWUSI-EAS1795_0092:3:1:14177:1888#0/1
CCGCAAGGCCATCCTGGAGCGTCGCGGCAAGGG
+HWUSI-EAS1795_0092:3:1:14177:1888#0/1
hhhhhhhhhhhhhhhhhhghhghhhhhfdhfhf
@HWUSI-EAS1795_0092:3:1:14499:1889#0/1
TGGTGTGTGTTTGGAGGGGCGTTGGGAGGTAAG
+HWUSI-EAS1795_0092:3:1:14499:1889#0/1
hhhhhfghhhhhhgfhhhhghhghhehhh]hgh
@HWUSI-EAS1795_0092:3:1:14739:1889#0/1
GTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC
+HWUSI-EAS1795_0092:3:1:14739:1889#0/1
fgfffggcfdffgggeafaffceefffeggc_f
@HWUSI-EAS1795_0092:3:1:15804:1886#0/1
CCGTAGGTCGCAGTGTGGAGGAGACCCTGCGTC
+HWUSI-EAS1795_0092:3:1:15804:1886#0/1
hhhhhhhhhhhhhhhhhhhdhgfhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:15968:1892#0/1
ATAGGGGGTTCCTTGATAAAAAAAAAAAAAACA
+HWUSI-EAS1795_0092:3:1:15968:1892#0/1
hhhhhhhhghhhhhhhghhhhhhhhhhhhhe_c
@HWUSI-EAS1795_0092:3:1:16806:1885#0/1
GTTTCGTTCGATTCTTAAACCGTTCGCCACGAG
+HWUSI-EAS1795_0092:3:1:16806:1885#0/1
Q\cca^ca_ccYddddbggadcbYcfdaaccca
@HWUSI-EAS1795_0092:3:1:17121:1893#0/1
CCCAATGTCAAGATCCTGCTGAGTGTGGGTGGT
+HWUSI-EAS1795_0092:3:1:17121:1893#0/1
hhhhhhhhhhhfhgghhhhhhegghhhhhchh`
@HWUSI-EAS1795_0092:3:1:17213:1893#0/1
CAATTGGTTGATCATTCGCAACAACAACGCCTT
+HWUSI-EAS1795_0092:3:1:17213:1893#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhahhhh
@HWUSI-EAS1795_0092:3:1:17432:1883#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17432:1883#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:17773:1890#0/1
AGGACTTAAGTATGGTGTGGTATGCCATAAAAT
+HWUSI-EAS1795_0092:3:1:17773:1890#0/1
hhfhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:18461:1888#0/1
CGGCCTCCTCGGCGGATGCGTTGGCGCCCTCCA
+HWUSI-EAS1795_0092:3:1:18461:1888#0/1
ggggggggggggfffWdbcbbbffcf_cfWfc`
@HWUSI-EAS1795_0092:3:1:19051:1893#0/1
GGCCTTTGAGACCCAGGCTGCTGGCCCTGGTGA
+HWUSI-EAS1795_0092:3:1:19051:1893#0/1
gggggggggggfgagfgeffffggggggggdgf
@HWUSI-EAS1795_0092:3:1:19136:1883#0/1
GTAACCAGCACGGCATATGCACCAATTGGAGAA
+HWUSI-EAS1795_0092:3:1:19136:1883#0/1
hhghhhghhchhfhdhchhhchghghhghhch_
@HWUSI-EAS1795_0092:3:1:1748:1902#0/1
TGGAGAACTGCCAGGAGAGTAGGGCGCAGGCGG
+HWUSI-EAS1795_0092:3:1:1748:1902#0/1
fedfaffcffcfa\^a]^`^a\X\Q[^\acc_f
@HWUSI-EAS1795_0092:3:1:1809:1897#0/1
TGTCGAAGTGCTGTGGCTAATCACTGATTGTGC
+HWUSI-EAS1795_0092:3:1:1809:1897#0/1
hhhhhhhhhhhhgchahhhhghhhghghgaefh
@HWUSI-EAS1795_0092:3:1:2120:1895#0/1
GACTGTTTGTTTGTAATCATTAATCATAATCAT
+HWUSI-EAS1795_0092:3:1:2120:1895#0/1
hhhhhhhhhhhhhhhhhhghhhhhghhhghhhh
@HWUSI-EAS1795_0092:3:1:2377:1905#0/1
TACGAGTTGGCCCAATGCGAAACGGAGTTTGTG
+HWUSI-EAS1795_0092:3:1:2377:1905#0/1
dda^^WWSURZZacaW[]Pbaaacadad]```X
@HWUSI-EAS1795_0092:3:1:2430:1895#0/1
ATTACCCAGCCGATCTACGGCTATGAGAGCACC
+HWUSI-EAS1795_0092:3:1:2430:1895#0/1
hhfhhhhhghhhhghhhhhhhhfhafgehhhhh
@HWUSI-EAS1795_0092:3:1:2609:1895#0/1
GAAAAAATAGCTAAATCAACTGAAGCTCCACCA
+HWUSI-EAS1795_0092:3:1:2609:1895#0/1
hhhhhhhhhghfhhhhhhhhhdhfhhhhfhhhg
@HWUSI-EAS1795_0092:3:1:3059:1905#0/1
GCCTTCTTCTGCTCGATCAGCTTGGTCACCGTG
+HWUSI-EAS1795_0092:3:1:3059:1905#0/1
gfggggggggcgfffffggggeggggegggggg
@HWUSI-EAS1795_0092:3:1:3498:1898#0/1
GGTGGACTGTAATAAACCCATATATGCCACCAA
+HWUSI-EAS1795_0092:3:1:3498:1898#0/1
hhghhhhhhhhfhhhhhhhhhhghghhhfhhgh
@HWUSI-EAS1795_0092:3:1:3933:1899#0/1
GTTGCAGCGTCCGCTGTTTTTGGCCGCGCAGCT
+HWUSI-EAS1795_0092:3:1:3933:1899#0/1
hhhffhhghghghghhhhhehfehhhfffcafW
@HWUSI-EAS1795_0092:3:1:4251:1898#0/1
AAGACCCGTATCGCCGATGTTGTGTACAACGCC
+HWUSI-EAS1795_0092:3:1:4251:1898#0/1
ggcgggagggfgddfacfaffddffffgggggg
@HWUSI-EAS1795_0092:3:1:4983:1896#0/1
GCTCCTCCTCGGCAGCATCCTCGTGCTCCGCAT
+HWUSI-EAS1795_0092:3:1:4983:1896#0/1
hhhhhhhhhhhghhhehfhhfgfghfhhhfhhh
@HWUSI-EAS1795_0092:3:1:5145:1899#0/1
GCGCAAGATGGTCTAAGGACTCCTTTTGATTTA
+HWUSI-EAS1795_0092:3:1:5145:1899#0/1
]b^c^W]URUS\Z]]Z]QT]RPZ]^^]VUXZ]f
@HWUSI-EAS1795_0092:3:1:5600:1902#0/1
GTGGCTACGTTGCCGGTGACTCCAAGGCTAACC
+HWUSI-EAS1795_0092:3:1:5600:1902#0/1
ffdd]ffaddd]^a^_U_^V__ccc\^^cacRa
@HWUSI-EAS1795_0092:3:1:5667:1903#0/1
TGAACTTGCTCTCTGGCAAAATGATATTTAATA
+HWUSI-EAS1795_0092:3:1:5667:1903#0/1
hhghghhghhhhhhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5960:1905#0/1
CTGCCCGACATGCTGAAAAATGCCCCGATGTTC
+HWUSI-EAS1795_0092:3:1:5960:1905#0/1
hhghhhhahhhfhhhghhhhhghhhhghhhhhg
@HWUSI-EAS1795_0092:3:1:6496:1901#0/1
GCTCGTCCGTGTGTGTCCTCTCGTGGATGAGCA
+HWUSI-EAS1795_0092:3:1:6496:1901#0/1
hhhhhhhhhhhhhghhhfhfhghhhhghhehec
@HWUSI-EAS1795_0092:3:1:6792:1898#0/1
TAGCGTCCAAAATCACCCAGATGGATGATGGCC
+HWUSI-EAS1795_0092:3:1:6792:1898#0/1
ggffggfggcgggagggdfcafdff_ccff_fg
@HWUSI-EAS1795_0092:3:1:6857:1894#0/1
TTTTCATCTTGTAGTTGGTGTTGTTGTTGATTT
+HWUSI-EAS1795_0092:3:1:6857:1894#0/1
hhfhghhgfhfhhahhhhfehhchfehhhhhfh
@HWUSI-EAS1795_0092:3:1:6983:1900#0/1
GTTCAACATTGGGTTCTTGGTTGTCATTGTTTG
+HWUSI-EAS1795_0092:3:1:6983:1900#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhghhhh
@HWUSI-EAS1795_0092:3:1:7026:1894#0/1
CACCTACTCCTGCGTGGGTGTCTACCAACATGG
+HWUSI-EAS1795_0092:3:1:7026:1894#0/1
hhhhhhhhhhhhhhhhhhghhhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:7275:1895#0/1
GCTGCGCATCGCCGAGCCCTACATCACCTGGGG
+HWUSI-EAS1795_0092:3:1:7275:1895#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7478:1902#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:7478:1902#0/1
hhhgehhhhgghdcdffghhhhghhhhhchghh
@HWUSI-EAS1795_0092:3:1:7646:1895#0/1
CGCGGATCTTGCGGGCACGGGTGCCGAAGGCGC
+HWUSI-EAS1795_0092:3:1:7646:1895#0/1
hhhhhhhhhhgchhhgdhhhhfhhghhfhfhhf
@HWUSI-EAS1795_0092:3:1:7801:1897#0/1
CCAACAGCCAGAAGACCAATGTCAAGCTCAGCT
+HWUSI-EAS1795_0092:3:1:7801:1897#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:7987:1903#0/1
TCCAGGTGCTCCTGGACTGATGGGCATTAAGGG
+HWUSI-EAS1795_0092:3:1:7987:1903#0/1
hhhgheghfghhhhhhhhhhgghhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:8621:1895#0/1
AAGTAAGAAGCACCAGCGTCCTGCCAACCCAGC
+HWUSI-EAS1795_0092:3:1:8621:1895#0/1
gefgggfgggfggggeafgggggfgggggcggB
@HWUSI-EAS1795_0092:3:1:8888:1905#0/1
TGGTCCTTTCGTACTAAAATATCACAATTTTTT
+HWUSI-EAS1795_0092:3:1:8888:1905#0/1
gg^gggggggggggegaggfggggggggggggf
@HWUSI-EAS1795_0092:3:1:9213:1899#0/1
GCGACGCATTGCCTGCTGAGTCCTCCCCAGCTG
+HWUSI-EAS1795_0092:3:1:9213:1899#0/1
hhhghghhhfdhhhhgghhhghhfhhhhhhheh
@HWUSI-EAS1795_0092:3:1:9305:1900#0/1
CTGAAGAAGGCCCCGGGCAACTCGCACTTCGTG
+HWUSI-EAS1795_0092:3:1:9305:1900#0/1
ggcegagcdfffgggfgggggfffc]eded[df
@HWUSI-EAS1795_0092:3:1:9420:1901#0/1
CAGACCGTGGCTGTCGGTGTCATTAAGGCTGTC
+HWUSI-EAS1795_0092:3:1:9420:1901#0/1
ggggggggggggggggg`dbbbffffcgggggg
@HWUSI-EAS1795_0092:3:1:9506:1898#0/1
AGTTGGGCACCTTGTACTGCAGAGGGTTCGAGA
+HWUSI-EAS1795_0092:3:1:9506:1898#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:9957:1902#0/1
TGTAATTTGAACAGATCAACGTATTGCGGCAGC
+HWUSI-EAS1795_0092:3:1:9957:1902#0/1
egggggggfffggggggdfcffggggggggfgg
@HWUSI-EAS1795_0092:3:1:10310:1903#0/1
TGACCGGGGTGGTTCAGCACGATGACCTGGGCG
+HWUSI-EAS1795_0092:3:1:10310:1903#0/1
hhhhhhhhhfhghhhhffhhffhhehhhhgfgh
@HWUSI-EAS1795_0092:3:1:10636:1894#0/1
TTGGCTTCGAAGACATTCTGGCCATCGCCCGCG
+HWUSI-EAS1795_0092:3:1:10636:1894#0/1
hhhhhghfhhhgfhhgghhhhhhhhhhhha_cd
@HWUSI-EAS1795_0092:3:1:11628:1899#0/1
AAAAGACGCTATAGTTAGTAGCGCAAATATAAA
+HWUSI-EAS1795_0092:3:1:11628:1899#0/1
ghhhhhhhhhhhdfghhfhhhhghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:11838:1904#0/1
GGGAGGCTTAGATATTCTGTCCCTCAAGGAGGA
+HWUSI-EAS1795_0092:3:1:11838:1904#0/1
hhhghhhhhghhhhhhhhfhhhhhgghchhhfh
@HWUSI-EAS1795_0092:3:1:12036:1904#0/1
CATATATCCATTCAACTTCTTCTTTTGATTTTA
+HWUSI-EAS1795_0092:3:1:12036:1904#0/1
hhghhhhhhhhhghhfhhhhhghhfhghhhhfh
@HWUSI-EAS1795_0092:3:1:12670:1905#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12670:1905#0/1
gehfhghhhghfhhghfhhhhgfhhhhfhhhhf
@HWUSI-EAS1795_0092:3:1:13046:1903#0/1
AATACTTTATGGTTTCTCGTACAATCTTTATCG
+HWUSI-EAS1795_0092:3:1:13046:1903#0/1
hhhhghhhhghhhhhghhhhghghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13365:1894#0/1
GCACGATTCCGATTGAGATTAGGTTATGAGTGA
+HWUSI-EAS1795_0092:3:1:13365:1894#0/1
ggcgc_gdddffggcc_Vaa`_ebfdfffdcf]
@HWUSI-EAS1795_0092:3:1:13492:1901#0/1
CGCTTGCGTCCCAGGGGCAGCACGTAGTGAGCC
+HWUSI-EAS1795_0092:3:1:13492:1901#0/1
fffcff_fefffddfffg_faeffb_eaaccfc
@HWUSI-EAS1795_0092:3:1:14304:1904#0/1
CCCGGTGGATAATGCCCTTAGCGTGCAGAAAAC
+HWUSI-EAS1795_0092:3:1:14304:1904#0/1
ggggeggggefffffffggggggefffg_ggge
@HWUSI-EAS1795_0092:3:1:14634:1896#0/1
GCGACTTTCCTGGGTCAAACCTACCTGACCTAC
+HWUSI-EAS1795_0092:3:1:14634:1896#0/1
hhhhhghhhhhhhhhhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:14712:1896#0/1
ATGGTTTTAGTTTTTGGTGTCCACGTAATTAGA
+HWUSI-EAS1795_0092:3:1:14712:1896#0/1
hhhhhhhhghhhhhhfhhghhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:15385:1903#0/1
TTTGTTTTGAGAGTATGAAATCCGGTCCGAAGA
+HWUSI-EAS1795_0092:3:1:15385:1903#0/1
hhhhhhhhhhhhfhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:15436:1895#0/1
TCCTTCTCGAACTTCTCGATGGTACGCTTGTCG
+HWUSI-EAS1795_0092:3:1:15436:1895#0/1
Rfggggggggcggggggggggg_ffffgffgdg
@HWUSI-EAS1795_0092:3:1:15481:1903#0/1
TTGTGATCCTCCAGGCAATCGGCCATTTGATCG
+HWUSI-EAS1795_0092:3:1:15481:1903#0/1
hhchhhhhhhhhhhhhhhhgehhhghhhhghhh
@HWUSI-EAS1795_0092:3:1:15520:1895#0/1
CCTGGTCGTGTTGTTCTTTTTTTTCGTTCCGTT
+HWUSI-EAS1795_0092:3:1:15520:1895#0/1
ggggggggggggfggfggggggggggggggdgg
@HWUSI-EAS1795_0092:3:1:15665:1894#0/1
CAAATTTGACTTTCATGCGACAATTCATTAAAT
+HWUSI-EAS1795_0092:3:1:15665:1894#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhggh
@HWUSI-EAS1795_0092:3:1:16090:1900#0/1
GTTTAATTTCTTCCATCGAAAGGAGTTTCGACG
+HWUSI-EAS1795_0092:3:1:16090:1900#0/1
hhhhhhhhhhhhhhhhhhhggghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:16408:1899#0/1
CACACGCGGATTTCGCTGGGCGGATTTTGAAAT
+HWUSI-EAS1795_0092:3:1:16408:1899#0/1
fffdfff_fc[a``]XQb]abdc`ffc^J]^^c
@HWUSI-EAS1795_0092:3:1:17522:1905#0/1
TGTTGGTGGCCACCACCCATCTGGGTTCCGAGA
+HWUSI-EAS1795_0092:3:1:17522:1905#0/1
gggggaggaggffc]ff`Zfdfff]_dfdf]S^
@HWUSI-EAS1795_0092:3:1:17703:1899#0/1
GTAGTGGGGCAGCCCGGTTGCAAAGGGCGGTCC
+HWUSI-EAS1795_0092:3:1:17703:1899#0/1
hhghhfhhgghhhhhgehghgghhhhhehhghh
@HWUSI-EAS1795_0092:3:1:17960:1896#0/1
CTTAACAGCGGATTAACATTTTATATATCGATG
+HWUSI-EAS1795_0092:3:1:17960:1896#0/1
hhhhhhhhhhhghhghhhhhhhghghhhhhhhf
@HWUSI-EAS1795_0092:3:1:18182:1900#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:18182:1900#0/1
gheehhhhhhhhgghhhehhhhhhhhghghhhh
@HWUSI-EAS1795_0092:3:1:19295:1902#0/1
AAATACTTCGGTAGAGGCGGAGAATGTGGCTTT
+HWUSI-EAS1795_0092:3:1:19295:1902#0/1
gfgaggfffffdf_cff[edW`BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:19502:1903#0/1
CAGGAAGCTCTTGCGTTTGCTGCGTATGGATTC
+HWUSI-EAS1795_0092:3:1:19502:1903#0/1
gfggcgcgggggWfaffggagggcdcgdf_ddg
@HWUSI-EAS1795_0092:3:1:19763:1904#0/1
GGAGGATGTACTCTTTTGTAAGGAAGCTGCTGG
+HWUSI-EAS1795_0092:3:1:19763:1904#0/1
ffffffafcff[f]ffccccffcaffddffff_
@HWUSI-EAS1795_0092:3:1:1610:1906#0/1
CACCAGTTGGGCCTTCTTCTGCTCGATCAGCTT
+HWUSI-EAS1795_0092:3:1:1610:1906#0/1
faddaY\^dc^df^^^fd^addS\aaadff\ff
@HWUSI-EAS1795_0092:3:1:2893:1906#0/1
CAGACCATAGATACCGATGGAGGGATCGTACTT
+HWUSI-EAS1795_0092:3:1:2893:1906#0/1
acdafcfffadcfdcfWdddcef`cfffcffcf
@HWUSI-EAS1795_0092:3:1:3018:1910#0/1
CTTATTTATACCTAAAGGTAATTTCGTACTGCG
+HWUSI-EAS1795_0092:3:1:3018:1910#0/1
gffacfZ_aecefadfffff\faffcffefcdf
@HWUSI-EAS1795_0092:3:1:3300:1909#0/1
AATTCTTGTTGTTTTTGGCTTACGCTAAATACT
+HWUSI-EAS1795_0092:3:1:3300:1909#0/1
gggggggfgggggggg`ggggggfggfgfgggg
@HWUSI-EAS1795_0092:3:1:3903:1907#0/1
CTCGTCTTTAAGGGTCGACAAATTGCTGACTCT
+HWUSI-EAS1795_0092:3:1:3903:1907#0/1
_ffffffffcfe]f`dccffffd]fc_adbddf
@HWUSI-EAS1795_0092:3:1:4576:1915#0/1
CTGCGTTGTTGGTGCCTGCATCAAATTAAATTT
+HWUSI-EAS1795_0092:3:1:4576:1915#0/1
gggggggfggggeggggggggfggggggggggg
@HWUSI-EAS1795_0092:3:1:4614:1913#0/1
GTAATACGTATCCTATAAAAGCTGTTCCTATTA
+HWUSI-EAS1795_0092:3:1:4614:1913#0/1
affffffegggcgfggcffccfgggcgcffadg
@HWUSI-EAS1795_0092:3:1:5177:1911#0/1
AGCATGAGTTCTCTAAAGCTCCAGAAGAGGCTC
+HWUSI-EAS1795_0092:3:1:5177:1911#0/1
gdfcgg_fffccfafffgfggacgggdcf_ccf
@HWUSI-EAS1795_0092:3:1:5553:1908#0/1
ATAATAACAACGCAGGGCACAGCAAATCAGGAT
+HWUSI-EAS1795_0092:3:1:5553:1908#0/1
ffdfffdeceafgggggeaggde_gggf^fcff
@HWUSI-EAS1795_0092:3:1:5621:1916#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5621:1916#0/1
hhdhhhhhhhhgchhhhhghhhhchfggghhhh
@HWUSI-EAS1795_0092:3:1:5916:1908#0/1
TGGAAAGCCACTACGTGGGTGATGTACTCTACG
+HWUSI-EAS1795_0092:3:1:5916:1908#0/1
hhhfhhhhhdhhhhhhhhhghhhhhhhhghfgh
@HWUSI-EAS1795_0092:3:1:6081:1917#0/1
CTATCCCAGTACTTGGACAAGTTGTAAAGCACC
+HWUSI-EAS1795_0092:3:1:6081:1917#0/1
hhhghghhfhfghhhhghhhhhhhhhhhhadhg
@HWUSI-EAS1795_0092:3:1:6344:1911#0/1
CTGTGGTTAAGGGAGCAGCTGCTATCTCCGTCC
+HWUSI-EAS1795_0092:3:1:6344:1911#0/1
hhhhghhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6591:1913#0/1
GGCGACGTGGGATGGTGGTGTCGGTGAGACCGG
+HWUSI-EAS1795_0092:3:1:6591:1913#0/1
ffcfWccW\\_]faafc[^d^[[_T[U^caacc
@HWUSI-EAS1795_0092:3:1:7339:1914#0/1
CAAGAAGCTGCGCAAGGCCAAGAAGGAGGCACC
+HWUSI-EAS1795_0092:3:1:7339:1914#0/1
cYacccc^[cccccaccQ\ZZ_cac[caYcaaB
@HWUSI-EAS1795_0092:3:1:7455:1909#0/1
CAGACATTTGAAAGATCTGTCGTCGGTACAAGA
+HWUSI-EAS1795_0092:3:1:7455:1909#0/1
hhhhhehhhhhhhhghhhhhhhhhhhhhhhhdh
@HWUSI-EAS1795_0092:3:1:8240:1915#0/1
CGCGCATGTAATGAATTTCATTCCTCGAACTAA
+HWUSI-EAS1795_0092:3:1:8240:1915#0/1
c^ddcd]Y[^aadb^[bZZ_ZXdbdd^faf_db
@HWUSI-EAS1795_0092:3:1:8528:1906#0/1
GCCGGCGATGTCAGACGGAGCCATGAGCAGGTG
+HWUSI-EAS1795_0092:3:1:8528:1906#0/1
hhhhhhhhhhhhhhhhhhfhdhhhfgdcggccg
@HWUSI-EAS1795_0092:3:1:9158:1915#0/1
CGATACTCTGCTCCTTTCGATACTTCATGGCAC
+HWUSI-EAS1795_0092:3:1:9158:1915#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:9179:1908#0/1
GCTGTGTACACGTGTTTCACAATGGCACCCATC
+HWUSI-EAS1795_0092:3:1:9179:1908#0/1
hhhhhchhhhhhghhhhhhhhhhhhhhhcfhff
@HWUSI-EAS1795_0092:3:1:9253:1908#0/1
TCCCCTGAAGCGTTGCAAGCACTTCGAGCGGGG
+HWUSI-EAS1795_0092:3:1:9253:1908#0/1
_____\\\\Y_\Z_]\_ZZXVP`BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:9324:1911#0/1
GAATGATGCTGCACGACCTGCTTGATCAGACCC
+HWUSI-EAS1795_0092:3:1:9324:1911#0/1
hghhhhgghhhhhhghhhghgghghhhhfhhhh
@HWUSI-EAS1795_0092:3:1:9444:1911#0/1
CCAGTGCGTTGATGCAAAACTTGTGCTTACCAC
+HWUSI-EAS1795_0092:3:1:9444:1911#0/1
hhhhhhhhhhghfhhhhhhhhhhhhghhhhhhg
@HWUSI-EAS1795_0092:3:1:9621:1915#0/1
TCGCGCGCCAGGCGCACATAGGCCTTCTTCTGG
+HWUSI-EAS1795_0092:3:1:9621:1915#0/1
hhghhhfhhhhhhhhhhhhhgehhhghhhhhch
@HWUSI-EAS1795_0092:3:1:9675:1913#0/1
GTAAAACTTTCCATGCCTCAGCCGCAGTGAGAC
+HWUSI-EAS1795_0092:3:1:9675:1913#0/1
fffffffggffgccfdfcffffffdaffffffg
@HWUSI-EAS1795_0092:3:1:9897:1912#0/1
CGCCTTCCATGGTGCCGTAGTGATTGGATACGG
+HWUSI-EAS1795_0092:3:1:9897:1912#0/1
hhhhhhhhhhhhhghhhhhhhhfhhhghfhfhh
@HWUSI-EAS1795_0092:3:1:10185:1908#0/1
AGATTGTACATATAGAGACGCAATCCGGGATTA
+HWUSI-EAS1795_0092:3:1:10185:1908#0/1
hhhhhhhhhhhhhhggghhhhhhhhhhhhdhhh
@HWUSI-EAS1795_0092:3:1:10254:1908#0/1
TTATGACATGAGGGATTGTTTGCTATGCTAATA
+HWUSI-EAS1795_0092:3:1:10254:1908#0/1
hhhhhhhghhhhhhghhfhhhhhfhghhhhghh
@HWUSI-EAS1795_0092:3:1:11229:1914#0/1
CCCAAAGCTCCTAGAGGAGATGATCCACCATTG
+HWUSI-EAS1795_0092:3:1:11229:1914#0/1
hhhhhhhhhhhhhhgdgehfedfhhfhhgghhh
@HWUSI-EAS1795_0092:3:1:11314:1911#0/1
AAATCCACTAGCTGGTCGTACAGCTCCTCCGGA
+HWUSI-EAS1795_0092:3:1:11314:1911#0/1
hhfhhhhhhhhhhhghhhhhhgfhghhahhhgh
@HWUSI-EAS1795_0092:3:1:11566:1912#0/1
CGGGGGTCAAGTACGCGTACGTCTTGGCGATGG
+HWUSI-EAS1795_0092:3:1:11566:1912#0/1
gggggfgaa_ffggccgfafffYdeedffQ_ff
@HWUSI-EAS1795_0092:3:1:11928:1910#0/1
CCGGACCCAAGGGAGATCGCGGAGAGCCAGGCG
+HWUSI-EAS1795_0092:3:1:11928:1910#0/1
hhfhhghhhhhhhhghhhhhhccfcffhehfhh
@HWUSI-EAS1795_0092:3:1:11977:1917#0/1
TACGACAGCAAAATGATCATGTCCACTATTTTT
+HWUSI-EAS1795_0092:3:1:11977:1917#0/1
hhhhhhhfhhhghhgghhhggghhhhhahhhhg
@HWUSI-EAS1795_0092:3:1:12877:1912#0/1
TTCCTCGGGCAACTCCTGGGAAAGGAGGTGTTG
+HWUSI-EAS1795_0092:3:1:12877:1912#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:13680:1914#0/1
TCGTAACTCCACAAATCTCGCAGCAGGCAACGG
+HWUSI-EAS1795_0092:3:1:13680:1914#0/1
hghhhhfdhhhhhhfhghhhhhhhghhhhghhc
@HWUSI-EAS1795_0092:3:1:13814:1915#0/1
GGACTATGAACGCGAGTGCTTGCGGCTTGGAAC
+HWUSI-EAS1795_0092:3:1:13814:1915#0/1
hhhhhhhhhhhghhehhhghhhhhheff[fcff
@HWUSI-EAS1795_0092:3:1:14588:1917#0/1
GCTTCCCAAATACGGGATCCAGGTTGGATTGAC
+HWUSI-EAS1795_0092:3:1:14588:1917#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15589:1911#0/1
GTGGAACACTCTCACCCTTTTGGCCATAGATCA
+HWUSI-EAS1795_0092:3:1:15589:1911#0/1
fdffafffffffggggggffg_gggggfgeggg
@HWUSI-EAS1795_0092:3:1:16196:1915#0/1
CAATGCCCAGTTTGACCACGAAGCCTTCTTGGG
+HWUSI-EAS1795_0092:3:1:16196:1915#0/1
hhhhhhhhhghhhhhhhhhhhhfhhhggggehf
@HWUSI-EAS1795_0092:3:1:16531:1909#0/1
GTTCCATCTGCTAGTGGTACATCAGAACCGCGC
+HWUSI-EAS1795_0092:3:1:16531:1909#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17090:1911#0/1
AAAAATTATTTTTAAGATGACCTCTGTCGCTCT
+HWUSI-EAS1795_0092:3:1:17090:1911#0/1
hhhhhhhhhhhhhhghfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18522:1906#0/1
GATAAATATATCAATGCAAACTCCTCAGGACCA
+HWUSI-EAS1795_0092:3:1:18522:1906#0/1
ggfcggggggggggggfgggggggggggfgggd
@HWUSI-EAS1795_0092:3:1:18656:1912#0/1
GACGTCAGCGAGGTGAGAATGAACGAGACCAAT
+HWUSI-EAS1795_0092:3:1:18656:1912#0/1
gggggggggggggagggffdefggggegggggg
@HWUSI-EAS1795_0092:3:1:19635:1907#0/1
GCAACGTATTCTGTGAGAAAGCCAGTATGATCG
+HWUSI-EAS1795_0092:3:1:19635:1907#0/1
hhhhhgghhhhhhhghfhhgchfdf[ffcfffd
@HWUSI-EAS1795_0092:3:1:1878:1925#0/1
TAAATCTATGATTAGCCCCACAGATTTCTGAAC
+HWUSI-EAS1795_0092:3:1:1878:1925#0/1
ehhghfhgfhhcgghfhhgfhfhahhfggfhfg
@HWUSI-EAS1795_0092:3:1:2245:1926#0/1
CAAACAGCGAAGCGCTAGGAAGGATGTGAACGT
+HWUSI-EAS1795_0092:3:1:2245:1926#0/1
caaddedfcccfecea]fffffd_c[cX`Xb`f
@HWUSI-EAS1795_0092:3:1:2423:1920#0/1
GCGCACTGGCCTTCTCGCCGGACACCTCGCTCA
+HWUSI-EAS1795_0092:3:1:2423:1920#0/1
hhhhahhhhhhhhfghhhhhhfghhhghghehf
@HWUSI-EAS1795_0092:3:1:3157:1920#0/1
CAAAAATCCATAGATTTTGTTCCAAGGCCTTCA
+HWUSI-EAS1795_0092:3:1:3157:1920#0/1
f\dccdSddbddfc__\^a[[[adYcWcWS\cQ
@HWUSI-EAS1795_0092:3:1:3730:1927#0/1
GCAGAACTTAAAAAGAGTTCTTAGATATTTGAA
+HWUSI-EAS1795_0092:3:1:3730:1927#0/1
hhhhghhhhhhhhghhghhhhhhhghhhhgfhg
@HWUSI-EAS1795_0092:3:1:3832:1921#0/1
CTGGAATGAATGGTTGGACGAAATATTAACTGT
+HWUSI-EAS1795_0092:3:1:3832:1921#0/1
hfhhhhhhghhhhhhhhhdhhhhhhhhehcfhh
@HWUSI-EAS1795_0092:3:1:3874:1925#0/1
GCTATACTGATTTATCTGGCCGAGAAGTACGAT
+HWUSI-EAS1795_0092:3:1:3874:1925#0/1
fcffffdd^cc]ddad_cddcdffff_YaV^Zb
@HWUSI-EAS1795_0092:3:1:3973:1926#0/1
GTGAAAGTGGGCTCCGTGAATGCCGATGCGGAC
+HWUSI-EAS1795_0092:3:1:3973:1926#0/1
hhhhhhhhhhhhghhhhhhhghhhhghfhhhhh
@HWUSI-EAS1795_0092:3:1:4034:1928#0/1
GTCCAAGGTCAAGCCCTTCCTGAAGAGCCTGAA
+HWUSI-EAS1795_0092:3:1:4034:1928#0/1
hhhhhhhhhhhhhghhhhhhhgghhfhhhhfhh
@HWUSI-EAS1795_0092:3:1:4241:1918#0/1
GGGATCGCTTCCAGATGAGAATCCACAAGCGCA
+HWUSI-EAS1795_0092:3:1:4241:1918#0/1
hhhhhhhhhhhghhdhhghhffghhghhhhgeg
@HWUSI-EAS1795_0092:3:1:4278:1923#0/1
TCCCTCCACAACGGCTGTATTTGAAGGCACTCG
+HWUSI-EAS1795_0092:3:1:4278:1923#0/1
gggggg`ggegggggggfafff[cfffgggggc
@HWUSI-EAS1795_0092:3:1:4623:1929#0/1
TAACAACAACAGCAATGTCTTGAAACTAAAGCC
+HWUSI-EAS1795_0092:3:1:4623:1929#0/1
_ffa]ffeead]\\^\\cffc[aaeaaffcca]
@HWUSI-EAS1795_0092:3:1:4961:1922#0/1
TTTCCTGGCTCAACCCAATGTGCTGGAGCACTT
+HWUSI-EAS1795_0092:3:1:4961:1922#0/1
ff_ffWfdcffffcfc_fWddfZO\_Z\ZZZ_[
@HWUSI-EAS1795_0092:3:1:4997:1918#0/1
GGTGGTTATGGTAGTGGTGGTGGAGTTTCCGCC
+HWUSI-EAS1795_0092:3:1:4997:1918#0/1
Y`ffcffffffffffffdbdbd_Wa^afdfecf
@HWUSI-EAS1795_0092:3:1:5422:1923#0/1
TGCGCTTCAAAAATGTCACATGTCGCATCAGCG
+HWUSI-EAS1795_0092:3:1:5422:1923#0/1
hhehffhhhhfhhd_dhgghghhchhhhgcehh
@HWUSI-EAS1795_0092:3:1:6165:1920#0/1
GGGGAAGCAGGGGATTCGACTGGTTGGATTGAT
+HWUSI-EAS1795_0092:3:1:6165:1920#0/1
dhhhhdghhfhhhhhhffhhhhhhehhghhdhh
@HWUSI-EAS1795_0092:3:1:6315:1919#0/1
TGTCCGGTGAAGAACCAACGCGTCGATGCTTGT
+HWUSI-EAS1795_0092:3:1:6315:1919#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhhghhfh
@HWUSI-EAS1795_0092:3:1:7155:1925#0/1
CACCCACATTCGAGGCGACAATCCGAGAGGACA
+HWUSI-EAS1795_0092:3:1:7155:1925#0/1
hhhhhhhhhhhhhhhhgfghhghhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:7508:1917#0/1
CGACTATGTCGAGACCGCCACCCGTCATGTGCT
+HWUSI-EAS1795_0092:3:1:7508:1917#0/1
hhghhhhhhhhghhhhhhfghhhhghhhgghhe
@HWUSI-EAS1795_0092:3:1:8208:1928#0/1
GGGGATTTAAGCAAGGACAAAGCGCATCGAAGC
+HWUSI-EAS1795_0092:3:1:8208:1928#0/1
gfggeggcggfgdggfffggggaggggcffffg
@HWUSI-EAS1795_0092:3:1:8345:1926#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8345:1926#0/1
ggeggfgfggfggfafgaffdfcaggggWgggg
@HWUSI-EAS1795_0092:3:1:8398:1928#0/1
GCAAGACGAAGGAGGCCTACAAATACATCTACG
+HWUSI-EAS1795_0092:3:1:8398:1928#0/1
hfghhfhhhghhgghhhhhhhhhehhhghhhhh
@HWUSI-EAS1795_0092:3:1:9579:1925#0/1
CTCCGCCTGCTCCATCACTGCCCACTGTGTTGT
+HWUSI-EAS1795_0092:3:1:9579:1925#0/1
hhhhchhhfhhhhhghghfehhghhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:9868:1919#0/1
CTTGGTAAGAAATTCTTGGGCAGGATTGGATTC
+HWUSI-EAS1795_0092:3:1:9868:1919#0/1
hhhhhhgghhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10229:1924#0/1
GCGGTGTTTACTTCTTGTCGCTGGAGACAGAGC
+HWUSI-EAS1795_0092:3:1:10229:1924#0/1
heghhhfhhhhghhhhhghhhhhhhhhhdhhgf
@HWUSI-EAS1795_0092:3:1:10338:1925#0/1
GTCGATACGAGTCCTTAAATCGCGCCAAATAAT
+HWUSI-EAS1795_0092:3:1:10338:1925#0/1
hhhhghhhhhehhhhhhhhhfghghhhhhdhgg
@HWUSI-EAS1795_0092:3:1:10457:1917#0/1
GACGGACTTCGATGGAGATCTGTGGAAGCTTGG
+HWUSI-EAS1795_0092:3:1:10457:1917#0/1
hhhhhhhhhhhhhhhefhhhhfhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:10980:1925#0/1
CCCGTATTAAATCCGCTCAGGGGGTTATCGTTT
+HWUSI-EAS1795_0092:3:1:10980:1925#0/1
hhhhhhhhehhhhhhhgghhhhhhghhhhghhh
@HWUSI-EAS1795_0092:3:1:12067:1919#0/1
CGCGCAGGAAGAACCGCAAGCGTCACTTCCAGG
+HWUSI-EAS1795_0092:3:1:12067:1919#0/1
hhhhgfhhhhhhhhhhhfh_chgachhdcfceh
@HWUSI-EAS1795_0092:3:1:12516:1922#0/1
GAACAAGTACGGCCTGCCCACCACGCGAAGATG
+HWUSI-EAS1795_0092:3:1:12516:1922#0/1
gggggggdffffgggcfggfggegggcgdafeg
@HWUSI-EAS1795_0092:3:1:13470:1924#0/1
TGGTCAAGGGTGTGGTAATCACCGAGCAGGAGC
+HWUSI-EAS1795_0092:3:1:13470:1924#0/1
ggggggffdfafcf_ffdffffggggefgcggc
@HWUSI-EAS1795_0092:3:1:13635:1922#0/1
GGGGATTCTAGCACAAACTCACTTGGTAATGAT
+HWUSI-EAS1795_0092:3:1:13635:1922#0/1
gggcggggfegacddeefacfdfff_affcd_a
@HWUSI-EAS1795_0092:3:1:13664:1925#0/1
ATATTCAACACACATGTGGGCATTGCCTATATT
+HWUSI-EAS1795_0092:3:1:13664:1925#0/1
hhhhhhghhhhhhfhghhhhffhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13838:1923#0/1
AGCCAAACAACTTGGCCAGCGTGAGCTCGTACC
+HWUSI-EAS1795_0092:3:1:13838:1923#0/1
gfggggggfgggggggggegggaggggggdggg
@HWUSI-EAS1795_0092:3:1:14196:1923#0/1
GTCGATTTCCACCGTTTACCGCTGGATGTTGGA
+HWUSI-EAS1795_0092:3:1:14196:1923#0/1
hhghhhhhhhhhhhhhhchhghehhehhhfhha
@HWUSI-EAS1795_0092:3:1:14269:1922#0/1
CGAGCTCAGGAAGAAGGTCATGCCTGCCGTGGT
+HWUSI-EAS1795_0092:3:1:14269:1922#0/1
gggggggfcdggc_cdfeffffgggcegggggg
@HWUSI-EAS1795_0092:3:1:14558:1921#0/1
CCCAAACCAGACTCAAAATCTGTCTGCATCAAA
+HWUSI-EAS1795_0092:3:1:14558:1921#0/1
hhhfhhhhhhhhhhhhhhghhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:15105:1921#0/1
CGGTCTTTCCTTCGCGACGCCTTCGGAACTTGA
+HWUSI-EAS1795_0092:3:1:15105:1921#0/1
\cY\]YZ__^\ZUXXY[VXYVV_]__TaZ_Yac
@HWUSI-EAS1795_0092:3:1:15211:1923#0/1
CGTCCTCGAAGAACGTGGCGATGAGGCACAAAC
+HWUSI-EAS1795_0092:3:1:15211:1923#0/1
gfggggfgffggggggggcggfccffdfefgeg
@HWUSI-EAS1795_0092:3:1:15999:1921#0/1
GTAAGCTTGTGGGTGTGCGTGTTCTTTTTGCGC
+HWUSI-EAS1795_0092:3:1:15999:1921#0/1
ggggggggggggfeefffffffggggggggggc
@HWUSI-EAS1795_0092:3:1:16456:1919#0/1
CGATAAAGCAGCTGCCATTAGCTGGCAGCAACA
+HWUSI-EAS1795_0092:3:1:16456:1919#0/1
hhhhhhhhhhhhefhhhhghhhhhcghghhhhh
@HWUSI-EAS1795_0092:3:1:16827:1928#0/1
GCGCACTGATCCACCATCACATGCAGCAGCTGG
+HWUSI-EAS1795_0092:3:1:16827:1928#0/1
gggggggggfggggggafffe[gggg_cdfff_
@HWUSI-EAS1795_0092:3:1:17580:1920#0/1
ATTAGGAAGCCATCCGGTAGGCGCTGTACCAGA
+HWUSI-EAS1795_0092:3:1:17580:1920#0/1
hhhhhhghhhhhhfhhdffhfhffdfdhhhhgg
@HWUSI-EAS1795_0092:3:1:17675:1921#0/1
CGTTACAATTGCAGTACAGAGCAGAAGTTCAGT
+HWUSI-EAS1795_0092:3:1:17675:1921#0/1
hhhhhhhghhhhhhhhhhfhhhhhhhhhhhgfh
@HWUSI-EAS1795_0092:3:1:18164:1924#0/1
CAGAGCGATGTGATGCGCTACTTGCTACGTATT
+HWUSI-EAS1795_0092:3:1:18164:1924#0/1
ggdgggggggaffdffacffffggggggggggg
@HWUSI-EAS1795_0092:3:1:18191:1919#0/1
TGCTATTCGTACAATTTTGTTGTTCCTCACACT
+HWUSI-EAS1795_0092:3:1:18191:1919#0/1
hhhhhhhhhhhhhdhghhhhhghhhhhhhhchh
@HWUSI-EAS1795_0092:3:1:19026:1926#0/1
CCTGACTATTGTGTTGGCATGGATTTATTGATT
+HWUSI-EAS1795_0092:3:1:19026:1926#0/1
daggggggggggggaggffggggggggggeggg
@HWUSI-EAS1795_0092:3:1:19389:1925#0/1
TTTCAGGACACTGCGAAGCCTCCACTGGTTGGC
+HWUSI-EAS1795_0092:3:1:19389:1925#0/1
gggggggfgfg]gggfgggggcfffffgggggg
@HWUSI-EAS1795_0092:3:1:19511:1919#0/1
GAGGGATTATTACACCAAATCCATCGGACACGG
+HWUSI-EAS1795_0092:3:1:19511:1919#0/1
hhhhhhhhhhhhgfhhhhhhhhfhhhhehaggh
@HWUSI-EAS1795_0092:3:1:19580:1924#0/1
TTTCATCAGCAGACGGTTGTGCTTGTTGGGCGA
+HWUSI-EAS1795_0092:3:1:19580:1924#0/1
gggggggfgggfggggggfaddgggggeggggg
@HWUSI-EAS1795_0092:3:1:19727:1919#0/1
GAAAAATAACAATACAGGACTCATATCCGAGGC
+HWUSI-EAS1795_0092:3:1:19727:1919#0/1
hghhghhhhhhhhhhhhhghhhghhhhhhhgeh
@HWUSI-EAS1795_0092:3:1:2383:1929#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:2383:1929#0/1
V[\Y\\\JYaa^a`aPZdddaaacdddffffYc
@HWUSI-EAS1795_0092:3:1:2486:1937#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:2486:1937#0/1
fchhgfhhhhhhhhhghhfghgghhhhhffhgh
@HWUSI-EAS1795_0092:3:1:3078:1931#0/1
AATAACTCTAACTCTCTCGACCAAATCCATGTA
+HWUSI-EAS1795_0092:3:1:3078:1931#0/1
gagafgagggaggfggeggaggdgggggfgggg
@HWUSI-EAS1795_0092:3:1:3698:1934#0/1
GCGAACGCCGGCGACTGGGGTGGCTACTACTGC
+HWUSI-EAS1795_0092:3:1:3698:1934#0/1
hhhhhhhhfggfdfhahhfhchghhefaffaeg
@HWUSI-EAS1795_0092:3:1:3810:1934#0/1
CGCGAGATGAACCACGTTTGGCTGATCAGCCAG
+HWUSI-EAS1795_0092:3:1:3810:1934#0/1
ggggcgggdgegcgagggggg[cfdecdffcfg
@HWUSI-EAS1795_0092:3:1:4508:1934#0/1
CGCATCCGCGTCAAGCTCGACGGCTCCCAGCTG
+HWUSI-EAS1795_0092:3:1:4508:1934#0/1
ffdcafdfffcffffaf[aY^W]^^^ZS[YOYZ
@HWUSI-EAS1795_0092:3:1:5069:1939#0/1
GTGGGCGCTGGTCCTGCATGCCGTGGGCGAAGG
+HWUSI-EAS1795_0092:3:1:5069:1939#0/1
hhhhhfhdhhhhhhhhhhhhghhhhhhfhhhhd
@HWUSI-EAS1795_0092:3:1:5183:1931#0/1
GTTGAGATAGACCTGTGACGGAGACGTCGCCGG
+HWUSI-EAS1795_0092:3:1:5183:1931#0/1
gggffgggdgggggffafgggccdddbBBBBBB
@HWUSI-EAS1795_0092:3:1:5764:1937#0/1
GTCGGTGCCATCGTACGAATTATTGTCCTCGTT
+HWUSI-EAS1795_0092:3:1:5764:1937#0/1
hhhhhhghhhhfgffhhcfghcfhfhhhhhghh
@HWUSI-EAS1795_0092:3:1:5841:1932#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5841:1932#0/1
]d_ffffgfagg_f_fffffdfaffffffff[c
@HWUSI-EAS1795_0092:3:1:5912:1929#0/1
GCTGGAACCACTTCATGGCATCCTCCTTGGTGA
+HWUSI-EAS1795_0092:3:1:5912:1929#0/1
hhhhhhghhhhhghhhhhhhghhhhfhhhhfhh
@HWUSI-EAS1795_0092:3:1:6383:1936#0/1
TAAGTTGTGAAAAATACATTTTAAACTTGATAA
+HWUSI-EAS1795_0092:3:1:6383:1936#0/1
hhhhhhghhhhhhhfhhhhhhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:6651:1934#0/1
CGCGCATGTACAATAATCTGGGCGCCATCGAAC
+HWUSI-EAS1795_0092:3:1:6651:1934#0/1
hh]hhhhhhghhhghhghfhhgfhhghhghhhe
@HWUSI-EAS1795_0092:3:1:6801:1940#0/1
CGGGCTTTTTGCAGAAAATTTCGGGAAAAAAAC
+HWUSI-EAS1795_0092:3:1:6801:1940#0/1
hhhhhghhhhfhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7186:1937#0/1
GGTGTGTTGTGATTGTAGTATACTCGATGCACG
+HWUSI-EAS1795_0092:3:1:7186:1937#0/1
aS`deaefaffaffcfffa^ffffffcgcfggg
@HWUSI-EAS1795_0092:3:1:7832:1930#0/1
ATAAAACAGAAAAGAAAACTCTTCCGATATCTC
+HWUSI-EAS1795_0092:3:1:7832:1930#0/1
acaacZ\__]ccXWWMXSXYZ_aaa[a_ffd_d
@HWUSI-EAS1795_0092:3:1:8044:1937#0/1
TTACAGGGCCTCGGATATGAGTCCTGTATTGTT
+HWUSI-EAS1795_0092:3:1:8044:1937#0/1
hhhhhhhhhhhhhhghhgfghhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:8144:1935#0/1
CGCCGTGGGCGTCTTGCTGCGGAATAGGCCGCT
+HWUSI-EAS1795_0092:3:1:8144:1935#0/1
hhhhhhhhhfhhhhhhhfhhhhcfdfcghhgce
@HWUSI-EAS1795_0092:3:1:8555:1936#0/1
GTAATAAATATTTTCTGAATGAGAGTAAGAAAA
+HWUSI-EAS1795_0092:3:1:8555:1936#0/1
_fff]fc__edec___YQZZ\QbZ]\`fdfa`_
@HWUSI-EAS1795_0092:3:1:8653:1935#0/1
CTTGAAGCGTTTGGCTAAGTCCGATCCTATGGT
+HWUSI-EAS1795_0092:3:1:8653:1935#0/1
hhhhhhhhghhhhhghhhchhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:9186:1932#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9186:1932#0/1
VSUTTRV^_^aaRW_]`cc_ac_cac[cXa\c\
@HWUSI-EAS1795_0092:3:1:9455:1937#0/1
CAAAAAGGCTCCACTCCAGAGTTTTGGATCCAT
+HWUSI-EAS1795_0092:3:1:9455:1937#0/1
hhhhhhhhhhhhhhhhhggghhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:9475:1932#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9475:1932#0/1
hhhghghhghhhghhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:9675:1939#0/1
ATTTGTTCGAATACGATGGCCGTGGTTCTCCTC
+HWUSI-EAS1795_0092:3:1:9675:1939#0/1
hhhhhhhhhhhhhhhghhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9848:1931#0/1
AACGGCAAGAAGCTGATGGCCTGCCGCATCGTC
+HWUSI-EAS1795_0092:3:1:9848:1931#0/1
hhhhhhhhghhhhhhhhhhhh_hhhhhhfhhhg
@HWUSI-EAS1795_0092:3:1:10143:1932#0/1
CCAGGAACCGCATGGACGCGTACAACATCATCA
+HWUSI-EAS1795_0092:3:1:10143:1932#0/1
hhhhhhhhhhhgfhhhheghchhhhghhahdhh
@HWUSI-EAS1795_0092:3:1:10193:1934#0/1
GCGAGATGGATCAGTTGTCCAGCAAGCTTAAGG
+HWUSI-EAS1795_0092:3:1:10193:1934#0/1
TZUXUYY^_aZ\\\[U\c^ca^accaa`YaY]c
@HWUSI-EAS1795_0092:3:1:10254:1938#0/1
CGCTCAGATAGTTCTTTCGTAATGCAAACCTCC
+HWUSI-EAS1795_0092:3:1:10254:1938#0/1
hhhhhhhhhhghhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10505:1929#0/1
GATTATTTCTCACGGCCAGCATTTGCGTGGAGC
+HWUSI-EAS1795_0092:3:1:10505:1929#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhfhhhhghh
@HWUSI-EAS1795_0092:3:1:10576:1934#0/1
CGGGCTTTCATCAGCAGACGGTTGTGCTTGTTG
+HWUSI-EAS1795_0092:3:1:10576:1934#0/1
gggggcggggggageggdfffdce[eefdccdd
@HWUSI-EAS1795_0092:3:1:11360:1939#0/1
TTTCGCTAAATTTGTTGATCTGAATTGGTTGCA
+HWUSI-EAS1795_0092:3:1:11360:1939#0/1
hhhhhhhhhhhhhhhhhehhhhhhhhhghhhhf
@HWUSI-EAS1795_0092:3:1:11479:1938#0/1
ACGGTGACGATTTCCCCCAGTCCCAAGAAGGCC
+HWUSI-EAS1795_0092:3:1:11479:1938#0/1
`eecdeaffcfcccffdc^ffffaad]e_ddec
@HWUSI-EAS1795_0092:3:1:11750:1932#0/1
TTCGGACACATTAAATGTGGAATTCTGTTGTGG
+HWUSI-EAS1795_0092:3:1:11750:1932#0/1
hhhhhhhghhhhhhghdhhhfghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:11768:1931#0/1
GTTTCAGAGGCAGTTGCTCCGAGTGGCACCGCA
+HWUSI-EAS1795_0092:3:1:11768:1931#0/1
gggggggggfgggdgggfffdffcffccffcfg
@HWUSI-EAS1795_0092:3:1:11883:1934#0/1
CTGACGCTGCTCTTTCTGTTCAGCACCTTTCCC
+HWUSI-EAS1795_0092:3:1:11883:1934#0/1
hhhhhhhhhhhhghhhhghhhhhhhhhhhhhdh
@HWUSI-EAS1795_0092:3:1:12072:1940#0/1
ATAAGCCAATGCATTTTCTAGCACCAACGAAAT
+HWUSI-EAS1795_0092:3:1:12072:1940#0/1
hhhhhhhhhhhghhhhhghghhhhhhhfhhhgh
@HWUSI-EAS1795_0092:3:1:13017:1937#0/1
CAGTGGAGTTGCCGATGAAGGTGGCGGACATCT
+HWUSI-EAS1795_0092:3:1:13017:1937#0/1
hhhhhhhhhhghhhhfhhhchbhhhhfhhchhh
@HWUSI-EAS1795_0092:3:1:13538:1936#0/1
TTCCACTGATTCACCTGACTCACTCACCCTCGC
+HWUSI-EAS1795_0092:3:1:13538:1936#0/1
hhhhhhhhhdhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:13610:1938#0/1
CGGCCATCAGTTGGCCCCAGCGGCATCCATTGA
+HWUSI-EAS1795_0092:3:1:13610:1938#0/1
hhhhhhhhhhghghhhhhghhhchhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13767:1934#0/1
CGCTGCCTATTTTTCTACTCAACCTTAATTCTA
+HWUSI-EAS1795_0092:3:1:13767:1934#0/1
hhhhhhhhghhhhhhhfhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14538:1931#0/1
GCGGTGTGTACAAAGGGCAGGGACGTAATCAAT
+HWUSI-EAS1795_0092:3:1:14538:1931#0/1
g_fffffggggggaggfggfgfdffffggfgg]
@HWUSI-EAS1795_0092:3:1:14704:1935#0/1
GAAATTTGCTGCAACGTCGACGGGAGTACGACA
+HWUSI-EAS1795_0092:3:1:14704:1935#0/1
ghhhhhhhhhhhhhhgghhggghhhhdhhhhhh
@HWUSI-EAS1795_0092:3:1:14842:1932#0/1
CGGACACGCCCTCGTCGCCGGTATCGATCGCTA
+HWUSI-EAS1795_0092:3:1:14842:1932#0/1
ggggggeggggcgfggdffffafefdadfffdg
@HWUSI-EAS1795_0092:3:1:15368:1938#0/1
GAATTTTCCACATTTCTTTGTTGATTTCTGGAA
+HWUSI-EAS1795_0092:3:1:15368:1938#0/1
_YcffffffdW_d[d]efccff_aRcdffff_g
@HWUSI-EAS1795_0092:3:1:15451:1940#0/1
GTTGGTTTGTCTGTCTGTGGGAAGCACTTGTGG
+HWUSI-EAS1795_0092:3:1:15451:1940#0/1
hhhhhghhghhhghhhghhhhhghhhghhghhh
@HWUSI-EAS1795_0092:3:1:15514:1930#0/1
CCATCAGGCTCAAGGCGGTTGTCATCGCGAAGT
+HWUSI-EAS1795_0092:3:1:15514:1930#0/1
ggdgggcggggggggggggacababd`cddfdb
@HWUSI-EAS1795_0092:3:1:16526:1936#0/1
TCCAAGTCCAAGATGGGCGACAAGGAGTAGGCG
+HWUSI-EAS1795_0092:3:1:16526:1936#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:16774:1930#0/1
GTGGAGAGCGCGGCAGCCGGTCCGGATGAGAGC
+HWUSI-EAS1795_0092:3:1:16774:1930#0/1
hhhhghhhhhhhhhhhgfahcdghhedfffdff
@HWUSI-EAS1795_0092:3:1:17021:1935#0/1
TGAAGAAGCGCACCAAGCACTTCATCCGCCACC
+HWUSI-EAS1795_0092:3:1:17021:1935#0/1
fggfgdggggWcgfcgcggggggdccgfffffg
@HWUSI-EAS1795_0092:3:1:17300:1937#0/1
CGCCCAGCCCATGGATAAGGGCAAGTACACCGA
+HWUSI-EAS1795_0092:3:1:17300:1937#0/1
hfhgghhhhhghhfgghhcdhhgfhghdhhhfc
@HWUSI-EAS1795_0092:3:1:17631:1930#0/1
TGTTGGCTTCTTGGTTGTCGTTGTGGTAGTGGG
+HWUSI-EAS1795_0092:3:1:17631:1930#0/1
hhhhhhhhhhhhhhhhghhhhhfhhfehhhfhh
@HWUSI-EAS1795_0092:3:1:17811:1935#0/1
CGATAAATTAAATCAATTATAATGGAAGCGATG
+HWUSI-EAS1795_0092:3:1:17811:1935#0/1
hhhhhhfhhhhghhhhhhfghhahhhhhhfhfh
@HWUSI-EAS1795_0092:3:1:18378:1940#0/1
CTTAGACTTCTTGGCGGCGTAAGCGGCAACTCG
+HWUSI-EAS1795_0092:3:1:18378:1940#0/1
hhhghhfhhhhhghfhhehgghcddd_db``bb
@HWUSI-EAS1795_0092:3:1:18570:1931#0/1
TTGAAGCAGTACGACTCGAGGCCGTTCTTGGCG
+HWUSI-EAS1795_0092:3:1:18570:1931#0/1
hhhhhhhhhhhhhhhghgffghhhhhhhhghgf
@HWUSI-EAS1795_0092:3:1:18673:1931#0/1
ATCAGCTTTCCGTACACCTCGTAGATCACATCA
+HWUSI-EAS1795_0092:3:1:18673:1931#0/1
aaaZ^\_Z`ZZWVXWTYacaPcSSV[S^^aca\
@HWUSI-EAS1795_0092:3:1:18722:1935#0/1
GTTTGTTGCTTCTGCGACTGTGTGTGTATGTAT
+HWUSI-EAS1795_0092:3:1:18722:1935#0/1
hhhhhhhhghhhhhhghhgghhhghgggghhff
@HWUSI-EAS1795_0092:3:1:18967:1930#0/1
GTGTGTGAGTGTGCAGGTCGATGGTGATGCTTG
+HWUSI-EAS1795_0092:3:1:18967:1930#0/1
gggggggcfffdfffffgggggffeffaffffg
@HWUSI-EAS1795_0092:3:1:19138:1939#0/1
GCTCCCTTGCGCTCCTTGGACTTCTTGTACTGC
+HWUSI-EAS1795_0092:3:1:19138:1939#0/1
]fdffccfff[_a`daaecdfedfacfffedad
@HWUSI-EAS1795_0092:3:1:1238:1951#0/1
GTCGCCTTTAGCAATGTGGAGGCTAGCGGAGTG
+HWUSI-EAS1795_0092:3:1:1238:1951#0/1
Rb`YdZVYY]a^ddb]fa^SWadYb[\W\I_Z_
@HWUSI-EAS1795_0092:3:1:3078:1952#0/1
AGCCCGGCTGGTAGCGCAGCATATCGTTTAGCA
+HWUSI-EAS1795_0092:3:1:3078:1952#0/1
gggffggggcgbfcfaa[da``ffeddgeeegg
@HWUSI-EAS1795_0092:3:1:3778:1952#0/1
CCACGGCCACCATGGCCATCATCATGCGGCACA
+HWUSI-EAS1795_0092:3:1:3778:1952#0/1
_R^^aaaffffac]ddd^Z__Ia]^`\X``b`f
@HWUSI-EAS1795_0092:3:1:4066:1948#0/1
CATGAACTTGCGGGTGCGGATGGTAGCGGTTGT
+HWUSI-EAS1795_0092:3:1:4066:1948#0/1
ggggfgfgggggggfggggfcgdgggcffffdb
@HWUSI-EAS1795_0092:3:1:4158:1945#0/1
CAGCAGTTTCATTGACTCACATAGTGCCGCTCT
+HWUSI-EAS1795_0092:3:1:4158:1945#0/1
baWfdffgggggggggggggggggggggggdgg
@HWUSI-EAS1795_0092:3:1:5121:1941#0/1
AATGAGAGTAAGAAAAGAAAGCGAGATGATCAC
+HWUSI-EAS1795_0092:3:1:5121:1941#0/1
hghhghghhhhhhhhhfhhhhhhhhghgghghh
@HWUSI-EAS1795_0092:3:1:5237:1943#0/1
GAAATTTTTATATATATTTTTCAAATTTAAATT
+HWUSI-EAS1795_0092:3:1:5237:1943#0/1
fahghhhhhfhhghhhhghhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:5483:1943#0/1
TTTCTGCCATTGTATTGCCCACGCACTCACACC
+HWUSI-EAS1795_0092:3:1:5483:1943#0/1
hhaghhhhhghhhhhhhfhhhhhdhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6233:1947#0/1
GAACAATTGGCCATTGGGCCCATCCACCTCGTT
+HWUSI-EAS1795_0092:3:1:6233:1947#0/1
hhhhhfhhghhhghhfhgchhghgfhghhhfhg
@HWUSI-EAS1795_0092:3:1:6677:1942#0/1
CCCGCTCCCCCGTTGTGGGACTGCCCACCATGC
+HWUSI-EAS1795_0092:3:1:6677:1942#0/1
ff[Q`V`YWY[Nd[d[^d[[d^[d^^^BBBBBB
@HWUSI-EAS1795_0092:3:1:6725:1942#0/1
GGGCCAGCAGCTTGCCCACCGTGAACACATCCT
+HWUSI-EAS1795_0092:3:1:6725:1942#0/1
hhhhhhhhhhhhhhhhhfhhhhghhhhhhghhh
@HWUSI-EAS1795_0092:3:1:7421:1951#0/1
CCCATGGCGTGTACTCAAAGCTTTTGAAGTACT
+HWUSI-EAS1795_0092:3:1:7421:1951#0/1
hghhghhhhhhhhghhghhghhhfhhhhfghhh
@HWUSI-EAS1795_0092:3:1:7460:1951#0/1
ATGTAGGTAAGGGAAGTCGGCAAATTAGATCCG
+HWUSI-EAS1795_0092:3:1:7460:1951#0/1
_caWb]^Q\\]V_KQW\RPLPS\_V]]PSW\VO
@HWUSI-EAS1795_0092:3:1:7871:1950#0/1
AAGAGGACCACACCCTGTTCGAGGTCAATCGCC
+HWUSI-EAS1795_0092:3:1:7871:1950#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8281:1946#0/1
GGACAGTGTCCCTGCAAGCCGCATACTCAAGGC
+HWUSI-EAS1795_0092:3:1:8281:1946#0/1
hhhhhhhhhhhhfhfhhhhhhhhhghhhhdhfh
@HWUSI-EAS1795_0092:3:1:8765:1951#0/1
CAGGGTATCCAGGAAAGCGTTTCACAGAGTGAG
+HWUSI-EAS1795_0092:3:1:8765:1951#0/1
hhhhhghhhhhhhhhhhhhhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:8816:1952#0/1
GCCACTGTGTACTGCTTTGTCGGATCTCCGTAT
+HWUSI-EAS1795_0092:3:1:8816:1952#0/1
Q\YZYYZRTQ[Vcabac\W_]__W\\_\\\ZY_
@HWUSI-EAS1795_0092:3:1:9271:1951#0/1
GTTTAATTGAAACTGAGTAATGGGAATTTCACA
+HWUSI-EAS1795_0092:3:1:9271:1951#0/1
hhgghhhghhffhhhhhhhhghhhhhhhheghg
@HWUSI-EAS1795_0092:3:1:9730:1950#0/1
ATCTACGCAACTCTGCCGCGCACCCAACGCGGC
+HWUSI-EAS1795_0092:3:1:9730:1950#0/1
hhhhhhghhhhhghfhghgghhhhhghhghg_h
@HWUSI-EAS1795_0092:3:1:10006:1947#0/1
GTGTGGATGTGCATCATCAAATCTCCGCCAGCA
+HWUSI-EAS1795_0092:3:1:10006:1947#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10900:1944#0/1
TTTTAATATGGGTCTTATCTTTCAATTGTTTAA
+HWUSI-EAS1795_0092:3:1:10900:1944#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:11513:1948#0/1
CGTGCCTAGAACTGGATCATCTGTCCCTTGCGC
+HWUSI-EAS1795_0092:3:1:11513:1948#0/1
hhhhhhhafdhhfghhhhhhhfhhhhgdgfhhh
@HWUSI-EAS1795_0092:3:1:12014:1951#0/1
GGTTGCAAAGCTTTTGGGCTCCGGGGGAAGTAT
+HWUSI-EAS1795_0092:3:1:12014:1951#0/1
ffaffffgeggcgfggggcfgcfffffdaffcf
@HWUSI-EAS1795_0092:3:1:12277:1943#0/1
GCCAGACTTCACTGCCCAATGCGGACACGGACA
+HWUSI-EAS1795_0092:3:1:12277:1943#0/1
hhhhhhhhhhhhhhhhhhhdhhhghghhhhhhh
@HWUSI-EAS1795_0092:3:1:12320:1946#0/1
CTCCGCCAATGTGACTGACCCGTCCTTGTTCTC
+HWUSI-EAS1795_0092:3:1:12320:1946#0/1
bVaea`a^a^c^fd``_TZZZVVY\\Z`b`dNb
@HWUSI-EAS1795_0092:3:1:12542:1949#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12542:1949#0/1
hhhhhhhhhhhhhhfhhehhgggchghgghghf
@HWUSI-EAS1795_0092:3:1:13283:1952#0/1
ACAAGTTCAACTACGAACGTTTTAACCGCAACA
+HWUSI-EAS1795_0092:3:1:13283:1952#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhdhhhh
@HWUSI-EAS1795_0092:3:1:15006:1944#0/1
GCAAATTATACTAGAACACACACACACACATCG
+HWUSI-EAS1795_0092:3:1:15006:1944#0/1
gaggfgggge_cfggfggdggcggffggcafgf
@HWUSI-EAS1795_0092:3:1:15494:1942#0/1
TTTCATTATTATATTTATTGGAGTTAATTTAAC
+HWUSI-EAS1795_0092:3:1:15494:1942#0/1
ghhhhhhghhghhfghghhccdfhfghhhhhhh
@HWUSI-EAS1795_0092:3:1:16123:1951#0/1
ATCTGCCGCAAGTGCTACGCCCGTCTGCATCCT
+HWUSI-EAS1795_0092:3:1:16123:1951#0/1
hghhgghhhhhghghhhhfhhgghhhhdfhhhf
@HWUSI-EAS1795_0092:3:1:16493:1947#0/1
TTTGTTGCTTGCTTATGAGAGGTGGAAAGACAT
+HWUSI-EAS1795_0092:3:1:16493:1947#0/1
afdccfcfffffgffef^cdde[fffeffcfdd
@HWUSI-EAS1795_0092:3:1:17139:1950#0/1
ATGCCATGAAACAAGTTCTCGAGATTATAAACA
+HWUSI-EAS1795_0092:3:1:17139:1950#0/1
cggggg]ggggffccffffffcgggggggggdg
@HWUSI-EAS1795_0092:3:1:17318:1943#0/1
CCTGGACAAGAACCAGCAGACCACCATTGAACA
+HWUSI-EAS1795_0092:3:1:17318:1943#0/1
hhhhhhhhghhfhhhghhghhhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:17922:1952#0/1
TGCCACTAAGCGTGGTATTGTCCGACTACGGAA
+HWUSI-EAS1795_0092:3:1:17922:1952#0/1
hhhhhhhhhgghhhhhhhhcghhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:18669:1949#0/1
TCTGTTTCTAGTAGTGTATTTTGTGTGTTCTAG
+HWUSI-EAS1795_0092:3:1:18669:1949#0/1
hhhhhhYfffffhhhhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19207:1942#0/1
GGGGGAGGCGGTGGCGGCGTCATCGAATGGGTA
+HWUSI-EAS1795_0092:3:1:19207:1942#0/1
gggggg_ffffcffced_f`fffffRfbfff`b
@HWUSI-EAS1795_0092:3:1:19345:1949#0/1
GCAAGAGCATCGACGACCTGATCAAGGAGGGTC
+HWUSI-EAS1795_0092:3:1:19345:1949#0/1
ggggggfggfggfegeggeggggggggdggggd
@HWUSI-EAS1795_0092:3:1:2427:1957#0/1
GCGTTTTGTTGCATTGTTTCGCATTTAATCGGT
+HWUSI-EAS1795_0092:3:1:2427:1957#0/1
gfcgggda]\\dffccfff]]ffcaff_ffffg
@HWUSI-EAS1795_0092:3:1:3853:1960#0/1
CCGGACACTTGACAATCTCCATGTGGGAGTGCC
+HWUSI-EAS1795_0092:3:1:3853:1960#0/1
deedefff\cffa^aacff_fdd[daY\aZa_^
@HWUSI-EAS1795_0092:3:1:3952:1953#0/1
CACACACACTCACGCCCGCGAGAAACTGGCTGC
+HWUSI-EAS1795_0092:3:1:3952:1953#0/1
LRXMYYYM_WP_SRTSR\TZWWVY[Y^ca_c[c
@HWUSI-EAS1795_0092:3:1:6086:1954#0/1
TATTCGCCACATTCAACCGCTTATTCGAAGAGA
+HWUSI-EAS1795_0092:3:1:6086:1954#0/1
hhhhhhhhhhhhhhffhhhhhhdhhhhc_gdda
@HWUSI-EAS1795_0092:3:1:6114:1955#0/1
GCGCTGCATACGATGCTCCATGCTGTCCAATGG
+HWUSI-EAS1795_0092:3:1:6114:1955#0/1
ggggggggcgggcWfffggfcacdfffgg[ggg
@HWUSI-EAS1795_0092:3:1:6244:1962#0/1
CCCTGGTCGAGATATTCAAATCTTTGTATTTTG
+HWUSI-EAS1795_0092:3:1:6244:1962#0/1
gggggggggfgf_dfffgfgeggggcgggggge
@HWUSI-EAS1795_0092:3:1:6904:1953#0/1
CGCGTGACAGCAGATAGGTGCAGTTTCCATTAA
+HWUSI-EAS1795_0092:3:1:6904:1953#0/1
hhhhhhhhhhhhhhfhhhfhhgghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7184:1962#0/1
CTCCGTTTTTGTTTGCAAATCATGTCTTGCAAG
+HWUSI-EAS1795_0092:3:1:7184:1962#0/1
ffffffafff]fge`fgffggggagggfffffg
@HWUSI-EAS1795_0092:3:1:7368:1955#0/1
TGGTGTTATACTACTATTGTGTTCGCTGCTGCT
+HWUSI-EAS1795_0092:3:1:7368:1955#0/1
ggggggggggggggg_ggcgggggggfggggfg
@HWUSI-EAS1795_0092:3:1:7440:1952#0/1
GGCGACTTGGACAGACACATCTGGTCGGACTCC
+HWUSI-EAS1795_0092:3:1:7440:1952#0/1
gggcfgggggggeggggfgfggggdggdggggg
@HWUSI-EAS1795_0092:3:1:8225:1952#0/1
AGAAACTGAAAAGTAAACAGTAAGATCAACAGT
+HWUSI-EAS1795_0092:3:1:8225:1952#0/1
hhhhhhhhghhhhghhhhhhhhhhhhhhhhfhg
@HWUSI-EAS1795_0092:3:1:8593:1953#0/1
TCAACAGCAGCAGCAGCAGTGGCCACATCTCTT
+HWUSI-EAS1795_0092:3:1:8593:1953#0/1
ggggggggggggggggggfgfggggggfggggg
@HWUSI-EAS1795_0092:3:1:8686:1960#0/1
CTGACTGCGCCCCAGGATTCAGCTACCAGAACT
+HWUSI-EAS1795_0092:3:1:8686:1960#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:9218:1962#0/1
CTTATGAATACATTTAATTATGTAGGTACTCTG
+HWUSI-EAS1795_0092:3:1:9218:1962#0/1
b^^`^YYYM[YHQS[M]_K\I`bb^bBBBBBBB
@HWUSI-EAS1795_0092:3:1:9583:1958#0/1
GTGGGCGTCTCCTCGATCTTGTTCTCCTGGCGA
+HWUSI-EAS1795_0092:3:1:9583:1958#0/1
dcdad^cddddccacaYY`aSbfffaf^dd^df
@HWUSI-EAS1795_0092:3:1:9623:1952#0/1
CGAGGTGTACGGAAATCACAAGTGGTTGATAAG
+HWUSI-EAS1795_0092:3:1:9623:1952#0/1
hhhhgghhhhhhhhhhhhhhhhchhhhhaghgg
@HWUSI-EAS1795_0092:3:1:9644:1961#0/1
CCTCAAGGAGATCCGCAAGCGCTCCGTCTTCCC
+HWUSI-EAS1795_0092:3:1:9644:1961#0/1
hhhhhhhhhghhhhgghhghhhfhhhhgfhhhh
@HWUSI-EAS1795_0092:3:1:10097:1961#0/1
CGTCCTTGAAGAGGAAGATGGCGCGGTTATCGT
+HWUSI-EAS1795_0092:3:1:10097:1961#0/1
hhhhhhhhfhgfddfffhhhggdffffghfhhh
@HWUSI-EAS1795_0092:3:1:10115:1957#0/1
CGAGCTTTTGCTGTCCCTGTGTGTACTGAACAC
+HWUSI-EAS1795_0092:3:1:10115:1957#0/1
ff]dcffcfffafcffffffacdfd]fggggfg
@HWUSI-EAS1795_0092:3:1:10267:1953#0/1
GCTCAATCAAACCTGCCAAATGCTCCGACCGCA
+HWUSI-EAS1795_0092:3:1:10267:1953#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:11287:1953#0/1
TAAAATATCACAATTTTTTAAAGATAGAAACCA
+HWUSI-EAS1795_0092:3:1:11287:1953#0/1
b^adee\`ccdf[eecefccffc_ffcfadfcc
@HWUSI-EAS1795_0092:3:1:11320:1953#0/1
AGGAACTGTTGCAGATCTTTGTATGAAGGAACG
+HWUSI-EAS1795_0092:3:1:11320:1953#0/1
hhhhhhhhhghhhhhhhhhhehfghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11652:1959#0/1
ATTATTGAGTGGTGTTGTTGGCTGCATTATGAT
+HWUSI-EAS1795_0092:3:1:11652:1959#0/1
dhhghhgdffffhhhhhhhhhhghgghhghghh
@HWUSI-EAS1795_0092:3:1:11779:1953#0/1
TCCGACGCGGGGAGCAGCCTTCTGCGTAACCTT
+HWUSI-EAS1795_0092:3:1:11779:1953#0/1
hhhhhhhhhhhh`ghhghhhhghhhhhhhhhff
@HWUSI-EAS1795_0092:3:1:11936:1957#0/1
GGTGTCCACTGCCGTGGTCGAGCCCTACAACTC
+HWUSI-EAS1795_0092:3:1:11936:1957#0/1
ffeffffggfgggggggeggdafgggegggggg
@HWUSI-EAS1795_0092:3:1:12121:1961#0/1
CGAGTGGAGCGACTGCATCGCCTTGATCACGTG
+HWUSI-EAS1795_0092:3:1:12121:1961#0/1
fdcfffaaaae``[ea`]bacbgdgfggggg]f
@HWUSI-EAS1795_0092:3:1:12176:1954#0/1
GATCGCGCTTGAAGAACATCCAAACCCGCCACA
+HWUSI-EAS1795_0092:3:1:12176:1954#0/1
ghggghhhhhghhgghchhhghhhhfhcfhehh
@HWUSI-EAS1795_0092:3:1:12743:1959#0/1
AAACAAAAGGCTATTGGATTGACGACGGAAATT
+HWUSI-EAS1795_0092:3:1:12743:1959#0/1
gggfgggegfgggdgfgcggc_fcfdffgfggg
@HWUSI-EAS1795_0092:3:1:12903:1963#0/1
ATCGACTGAAAATATGTCCGCTATTCTAAACCA
+HWUSI-EAS1795_0092:3:1:12903:1963#0/1
hhhhhghhhhhhghhghhhhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13225:1956#0/1
GCGTGCACAAGGTGCGCACCCGTGGTGGAAACA
+HWUSI-EAS1795_0092:3:1:13225:1956#0/1
hhhhghhhhhhhhhfhhhhhhhghhfhhfhfhh
@HWUSI-EAS1795_0092:3:1:13862:1955#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13862:1955#0/1
ggggggggggggdgaggggfgggcggggcgggf
@HWUSI-EAS1795_0092:3:1:14181:1959#0/1
CTTTATAGGAAGAAGCAGAGCGATGTGATGCGC
+HWUSI-EAS1795_0092:3:1:14181:1959#0/1
hhhhhhhhhhhhhhhhhhhghhhehhgghhhhg
@HWUSI-EAS1795_0092:3:1:14927:1956#0/1
GGAGGAGTCCGAGTCCGAGGATGACGACATGGG
+HWUSI-EAS1795_0092:3:1:14927:1956#0/1
hhhhhfhhhhhhhhhhhhhhffghfehhhghhh
@HWUSI-EAS1795_0092:3:1:15011:1963#0/1
ATCAAAGTCTTGTCATAGTCCATCACCAGCTGC
+HWUSI-EAS1795_0092:3:1:15011:1963#0/1
hhhhghhgghhhhhghhhhhhfhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:15049:1953#0/1
GCGAGAAGCGCACGCACGACACCCAGTCGGTGT
+HWUSI-EAS1795_0092:3:1:15049:1953#0/1
hahhffhhhgghghfhhghghhhhegdhhhdg`
@HWUSI-EAS1795_0092:3:1:15544:1962#0/1
TGACGGCAAGACCCTGATCGATGCCCTCGATGC
+HWUSI-EAS1795_0092:3:1:15544:1962#0/1
hhhhhggghaghhghhhghhgghhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:15711:1956#0/1
ATGACACCGTGATTGGAGGAACCCTGCCCCAGA
+HWUSI-EAS1795_0092:3:1:15711:1956#0/1
hhhhhhhhhhhfhhhhhhhhhhhhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:17777:1955#0/1
GCCCAAATCAATACCAACAGCAGGAGCTTTAGA
+HWUSI-EAS1795_0092:3:1:17777:1955#0/1
hhhhhhhhhhhhhhhhhhhhhfhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18646:1954#0/1
CGCGGACCAGGTTCTCCTTCTTGCGCAGGGCAA
+HWUSI-EAS1795_0092:3:1:18646:1954#0/1
gdgggggggegggfggggggggegggggfgggg
@HWUSI-EAS1795_0092:3:1:18738:1955#0/1
TCGGGGGCATCAATGATGGTCACGTAGTACTTG
+HWUSI-EAS1795_0092:3:1:18738:1955#0/1
gggggcggfgfggggggegggaffdfdecffeg
@HWUSI-EAS1795_0092:3:1:19016:1963#0/1
CAGAAATCGTTGCGACTTTGTGATGTCGAACAC
+HWUSI-EAS1795_0092:3:1:19016:1963#0/1
hhhdhhhhhhhhhhahghghhghfhhhghhhhh
@HWUSI-EAS1795_0092:3:1:19536:1961#0/1
CTGTTTCAGACTAAACGGAACGTCTCTCAGCAT
+HWUSI-EAS1795_0092:3:1:19536:1961#0/1
hhhhhghhfhghhaghhfhhhhhhhhhdchhhh
@HWUSI-EAS1795_0092:3:1:19750:1955#0/1
ACAGCATTCCTGCGTAGTACGAGAGGAACCGCA
+HWUSI-EAS1795_0092:3:1:19750:1955#0/1
ghhhhehhhhhhhhghhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:2127:1975#0/1
GTAAATTTGTTAAATATTTCCTAGACTGGACAA
+HWUSI-EAS1795_0092:3:1:2127:1975#0/1
hhhchhhhhhhhhhghhhhhhhhgfheffhhgh
@HWUSI-EAS1795_0092:3:1:2808:1964#0/1
CCGCTGAACCACTTTCATGCTTGGGATTGTGAA
+HWUSI-EAS1795_0092:3:1:2808:1964#0/1
hhhhgghhhhhhhhhhhhfhhhhhhhhhcgghh
@HWUSI-EAS1795_0092:3:1:4733:1970#0/1
GCTTTACGGACATCAAATTACCAGCAGCTTCCT
+HWUSI-EAS1795_0092:3:1:4733:1970#0/1
hhhhhehhhhhhhhhhhhhfhhhhghhgfhhhh
@HWUSI-EAS1795_0092:3:1:5576:1971#0/1
CTTACATATCCATATAAGTACGCACAGGTGGGC
+HWUSI-EAS1795_0092:3:1:5576:1971#0/1
hhhhhhhhghhhhhhghhhhhhghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:5740:1967#0/1
CGGTGGACTTCTGGATGTGGTAGGAGGAGCGGC
+HWUSI-EAS1795_0092:3:1:5740:1967#0/1
gggeggggggfgggffggggdafa_ff_f`ccW
@HWUSI-EAS1795_0092:3:1:6129:1974#0/1
ATCTTGGCGAGCAGCAGAACTTCGCCATTCGCA
+HWUSI-EAS1795_0092:3:1:6129:1974#0/1
hhhhhhhhhhhfhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6498:1968#0/1
GGAGCCACTGTCTTCACATCCCTGCACACCGCT
+HWUSI-EAS1795_0092:3:1:6498:1968#0/1
hghhhhhhhghghhhghghhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6829:1969#0/1
GGGTGCCTTGCTGTGTGGCATATGCTTTTGTAT
+HWUSI-EAS1795_0092:3:1:6829:1969#0/1
ggggggggggggfgfgaffKfffffffgggggg
@HWUSI-EAS1795_0092:3:1:6988:1965#0/1
CTGTTATTCTTCCAGCAGCCTCCGTCCGGATTA
+HWUSI-EAS1795_0092:3:1:6988:1965#0/1
hghhhhhhhhhhhhhhhhhhhhhhhhhghghhe
@HWUSI-EAS1795_0092:3:1:7139:1967#0/1
CAACACCACAAAATGCCAACAGTTACCACCTTC
+HWUSI-EAS1795_0092:3:1:7139:1967#0/1
gfgfgggggggggggfggeagfgeggaggdggg
@HWUSI-EAS1795_0092:3:1:7301:1972#0/1
TAACAACTCAGTCCTGCTTTCCCAGTTGCCATT
+HWUSI-EAS1795_0092:3:1:7301:1972#0/1
gdfffffggfggggffggggggggggggggggf
@HWUSI-EAS1795_0092:3:1:7488:1973#0/1
CTGGTGCCGCGAGGGCAACTCGATTCAAGTGCG
+HWUSI-EAS1795_0092:3:1:7488:1973#0/1
hhhhghhhhhhhfhhhhhhhhgghhhhhhbhhh
@HWUSI-EAS1795_0092:3:1:7580:1971#0/1
ACGTAACGCATGTTTAAGTCTTGGGTTCTTGAC
+HWUSI-EAS1795_0092:3:1:7580:1971#0/1
hhhghhhhhfghhhhfhfhghfghhhhhhhfch
@HWUSI-EAS1795_0092:3:1:7877:1974#0/1
CCCGAACCCAAATTGAAAAAAAAAACAAAAAAA
+HWUSI-EAS1795_0092:3:1:7877:1974#0/1
hhhhhhhhhhhhghhghhhhhghhhehhhhhhh
@HWUSI-EAS1795_0092:3:1:8068:1966#0/1
GCACAATCTTTCCAGCCACTTCGCTCAGAACCT
+HWUSI-EAS1795_0092:3:1:8068:1966#0/1
deadffcfacff^^eaeafffdffaffffcfff
@HWUSI-EAS1795_0092:3:1:9269:1976#0/1
GTTTAATTGAAACTGAGTAATGGGAATTTCACA
+HWUSI-EAS1795_0092:3:1:9269:1976#0/1
e[ffdcfff]cafffadbc]bffffcfffcffb
@HWUSI-EAS1795_0092:3:1:9858:1972#0/1
CTTATCCTTGGGATCCACCGTTTCCCAATTTAG
+HWUSI-EAS1795_0092:3:1:9858:1972#0/1
faffaadf]ff_fcfdf^aaaadddd[a\c^aZ
@HWUSI-EAS1795_0092:3:1:10335:1970#0/1
TCGATGATGACCTTAGCGGCCTTCTTCACCGTC
+HWUSI-EAS1795_0092:3:1:10335:1970#0/1
gfgfgcgegcfggggedggggggfggggggcge
@HWUSI-EAS1795_0092:3:1:10490:1965#0/1
CCTCGGTGTTTTTGCGCACACGGTAACGGGAGT
+HWUSI-EAS1795_0092:3:1:10490:1965#0/1
hhhhhhhhhghhhghhhhhhhhhhhhghhhhha
@HWUSI-EAS1795_0092:3:1:11067:1969#0/1
CTGCTTTCTGGAAAGGCTCCATATGCCAAATTA
+HWUSI-EAS1795_0092:3:1:11067:1969#0/1
hfhfghhhhehghghhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:11605:1971#0/1
GTCGAGGACATTCAGGACTGGCTGAAGAAGGAG
+HWUSI-EAS1795_0092:3:1:11605:1971#0/1
gfgggggggccggafg_fcdfaggfggggc_af
@HWUSI-EAS1795_0092:3:1:12183:1972#0/1
CCAACATCATAATGCAGCCAACAACACCACTCA
+HWUSI-EAS1795_0092:3:1:12183:1972#0/1
hhhhhhhhhhghhhhhhghhghhhhhhfhhhdh
@HWUSI-EAS1795_0092:3:1:12461:1975#0/1
TTCCTGGGCTTAACTCGACTTAGCGTGGCTGCT
+HWUSI-EAS1795_0092:3:1:12461:1975#0/1
ffacd[ae[ddefcdcfffcfaccfbfdaabf[
@HWUSI-EAS1795_0092:3:1:12847:1966#0/1
GGATTTCCAAAGGATATCGAACCGAGCGAGCGA
+HWUSI-EAS1795_0092:3:1:12847:1966#0/1
f_cffffcffdcfafffcdaffff_aa]fafdc
@HWUSI-EAS1795_0092:3:1:13006:1968#0/1
GGGAACGGCAGAAGAGCAAGAGATAAACCACGA
+HWUSI-EAS1795_0092:3:1:13006:1968#0/1
hhhhhhhghfhhhhhhhhhhghhhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:13260:1973#0/1
AACAAGCGCGTCCTCATGGAGTACATCCACAAG
+HWUSI-EAS1795_0092:3:1:13260:1973#0/1
caaacccc^\cc^S_^\a\_WZccc_cc^cccc
@HWUSI-EAS1795_0092:3:1:13335:1972#0/1
AGAACATGATCAAGGGAGTCACGTTTGGATTCC
+HWUSI-EAS1795_0092:3:1:13335:1972#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhhhhdghhh
@HWUSI-EAS1795_0092:3:1:13420:1970#0/1
GAACGTCGCTCGAACTTTTATTCAACGTGTTGG
+HWUSI-EAS1795_0092:3:1:13420:1970#0/1
hhhghhhhhhhhhhhhhhhehhchgghhhghgh
@HWUSI-EAS1795_0092:3:1:13553:1966#0/1
GCGCGGAGAAACCGGACAACGCGGTGACTACGG
+HWUSI-EAS1795_0092:3:1:13553:1966#0/1
hahhhhehhhhhhhhhhhhghhhhhhhhffhhh
@HWUSI-EAS1795_0092:3:1:13880:1974#0/1
TAGACACCATAGCTGATTATTTTGAGCAAAGAC
+HWUSI-EAS1795_0092:3:1:13880:1974#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhchh
@HWUSI-EAS1795_0092:3:1:13965:1969#0/1
CATGTAACGACCGCCCAGCAGCAGCATCATACA
+HWUSI-EAS1795_0092:3:1:13965:1969#0/1
aa\_^aaadacdfffdcf_d[]da[aa^Ua^^Z
@HWUSI-EAS1795_0092:3:1:14125:1975#0/1
GCAAAAAATAGAAGCGCCCAGCAGTGGTGGTGC
+HWUSI-EAS1795_0092:3:1:14125:1975#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhfdffbff
@HWUSI-EAS1795_0092:3:1:14338:1973#0/1
TGCCGATCTTGTTGGCAATGTCCAGGGCGTCGT
+HWUSI-EAS1795_0092:3:1:14338:1973#0/1
hhhhhhhhhhfhhhhhhhghhhhhhhfehgghh
@HWUSI-EAS1795_0092:3:1:14413:1969#0/1
GCTGCAGCTTCTTCTTGGAGAGCTTCTTCTTGG
+HWUSI-EAS1795_0092:3:1:14413:1969#0/1
^cca\ddcadffffff_f]ffdffdffccd[da
@HWUSI-EAS1795_0092:3:1:15051:1973#0/1
TGATGATGGCGGATACTTATCTTTGTCCCCCGG
+HWUSI-EAS1795_0092:3:1:15051:1973#0/1
gggfggggggggf_faffddQfff]ffgggfgf
@HWUSI-EAS1795_0092:3:1:15462:1971#0/1
TTTAGGTATCAGAATCGGGTGCTTGGCGTTATA
+HWUSI-EAS1795_0092:3:1:15462:1971#0/1
hhhhhhhhhhhhghhhhhhghdehfhdhhhghh
@HWUSI-EAS1795_0092:3:1:15733:1971#0/1
GGGTTTTCTAGTTTAATGTTAATACTAGTTAAT
+HWUSI-EAS1795_0092:3:1:15733:1971#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:17380:1969#0/1
TGGAGAAGTGGGTCTGGCCATTACCCAGGCAAT
+HWUSI-EAS1795_0092:3:1:17380:1969#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:17948:1970#0/1
CTCCGGAGTTCGTCGGCAAGAGCTATTCCAGCG
+HWUSI-EAS1795_0092:3:1:17948:1970#0/1
hghhhhhhhhhhhhhhhhhchhhghhhhhhghh
@HWUSI-EAS1795_0092:3:1:18077:1972#0/1
CCAACCAGCTGGCTGACAAGGAGGAGTACGAGC
+HWUSI-EAS1795_0092:3:1:18077:1972#0/1
hhgfhhgghhhhhhghhhhfgahf]hccffaff
@HWUSI-EAS1795_0092:3:1:18272:1966#0/1
AACGGCGGAGCACGAGCGACAACATGCGTCGGC
+HWUSI-EAS1795_0092:3:1:18272:1966#0/1
gfgggggfRdacfcc]abaWdbad`dd_c__fb
@HWUSI-EAS1795_0092:3:1:18907:1965#0/1
TGGTGGGTTCACTTTCCAGGTGGCTCTCCCTCG
+HWUSI-EAS1795_0092:3:1:18907:1965#0/1
ggebcc`fffcfaaccccfdbdfaWfcefdbfg
@HWUSI-EAS1795_0092:3:1:19399:1971#0/1
TTGATATCAACCACAAGTACGATCGCAAGGTTC
+HWUSI-EAS1795_0092:3:1:19399:1971#0/1
ggggcggaggggfggggggggadffffgdgggg
@HWUSI-EAS1795_0092:3:1:19626:1972#0/1
GAGTCCGGACTTAGGCCATACTGCTTGCATGTG
+HWUSI-EAS1795_0092:3:1:19626:1972#0/1
ccccaccccW[cBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2294:1979#0/1
ATGGCATCCGCCTGTGCCTGCGTCTGATCGGCA
+HWUSI-EAS1795_0092:3:1:2294:1979#0/1
gegggggafcafcfffdggggggggggaffcff
@HWUSI-EAS1795_0092:3:1:2464:1979#0/1
GTTTGCCTCGCCGCAGTGCTTGGGCTATAAAAA
+HWUSI-EAS1795_0092:3:1:2464:1979#0/1
adcffffgggfgffgfgggggcfgfgggggggc
@HWUSI-EAS1795_0092:3:1:2740:1980#0/1
TAACAGCAGGGTTTCGGAGGTCAGACCAAGCCC
+HWUSI-EAS1795_0092:3:1:2740:1980#0/1
ghhhhhhgfhhhhhhhhhhhhhghhghhhehhg
@HWUSI-EAS1795_0092:3:1:3093:1982#0/1
GAAAAGAGCGAAGAAAGGGGAAGAACGCATAAA
+HWUSI-EAS1795_0092:3:1:3093:1982#0/1
ff_ffa`cf_f_d[aY\fffdadfccfggg_g`
@HWUSI-EAS1795_0092:3:1:3613:1979#0/1
AAGTTTCTTAACAAAGTGCGCCTTCTTCGGCTG
+HWUSI-EAS1795_0092:3:1:3613:1979#0/1
hhhhhhhhhhghhhhhhghhhhhhhhhhhehhh
@HWUSI-EAS1795_0092:3:1:3709:1983#0/1
CCCCAGTCAAACTCCCTACCTGGCAATGTCCTT
+HWUSI-EAS1795_0092:3:1:3709:1983#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3876:1987#0/1
GTGAACAAGAAGATGATATAAATAAAGCCGCTG
+HWUSI-EAS1795_0092:3:1:3876:1987#0/1
hhhghhhhhhhhhhhhhhfhhhhhhhhhghhfh
@HWUSI-EAS1795_0092:3:1:4579:1977#0/1
GTTTGCTAAGGGAAAGAAGCCCGAATAAACTGT
+HWUSI-EAS1795_0092:3:1:4579:1977#0/1
gegggggdffffcggaafgegggcgggfggfgg
@HWUSI-EAS1795_0092:3:1:5035:1985#0/1
TGGGGGTATTGGGAGGAGTGCAGGGCAAACATG
+HWUSI-EAS1795_0092:3:1:5035:1985#0/1
agffffeceddeddfc]d\d_afffcffgccgg
@HWUSI-EAS1795_0092:3:1:5432:1987#0/1
CCCTCATCCACTTCTCGTACTTGTCCAGGTCTG
+HWUSI-EAS1795_0092:3:1:5432:1987#0/1
hahhghhhhhhfhehhhhhhghhghhhhhehhh
@HWUSI-EAS1795_0092:3:1:5705:1981#0/1
CCGGGACCAGCGTAACGTACAAGGATTGGGTCT
+HWUSI-EAS1795_0092:3:1:5705:1981#0/1
gggfggggfggdeeafc`d]dabWRdbfffWe_
@HWUSI-EAS1795_0092:3:1:5754:1983#0/1
GGAGAAAATATCGACACAACAGTATATGTCATG
+HWUSI-EAS1795_0092:3:1:5754:1983#0/1
gggggggggfgggffgagggggfggggggfggg
@HWUSI-EAS1795_0092:3:1:6160:1979#0/1
TCAAAGTCGATGGGTATTCCGTTTCGGCGCCCT
+HWUSI-EAS1795_0092:3:1:6160:1979#0/1
hhhhchghhhghhhgghhdhghghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6810:1982#0/1
CTTGTTGTTTACTATTACCCCGGCATTGTCCTC
+HWUSI-EAS1795_0092:3:1:6810:1982#0/1
hhhghhhhhhhhhhhhhhhhhgghhhghhhhhh
@HWUSI-EAS1795_0092:3:1:7285:1987#0/1
CTGCAGTACGAGGAGTTTAATCCGTTCACAATC
+HWUSI-EAS1795_0092:3:1:7285:1987#0/1
hhhhhhhghhhhhghhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:7511:1984#0/1
GCACCCTTGAAACCCTTACCCTTGGTCACGCCA
+HWUSI-EAS1795_0092:3:1:7511:1984#0/1
hghhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:7827:1986#0/1
CTTCGGCGTTTGTCTATACGAACACGCAGCCAT
+HWUSI-EAS1795_0092:3:1:7827:1986#0/1
hhhhhhhhhhghhhhhhhhhhhhghghhghdgh
@HWUSI-EAS1795_0092:3:1:8167:1987#0/1
GCCTGCTGTTGAACTTTGGGAGGACTGAATAAT
+HWUSI-EAS1795_0092:3:1:8167:1987#0/1
hhhhhhhghhhhhhhhhghhghhhehhhhhhhh
@HWUSI-EAS1795_0092:3:1:8187:1983#0/1
CTGTCTGACTGGATCCCGTCGCGGATGCAATGC
+HWUSI-EAS1795_0092:3:1:8187:1983#0/1
hhhhhhhghhhhghhhhhhhfgghcdhfhhahh
@HWUSI-EAS1795_0092:3:1:8407:1983#0/1
AGACTATCGAAATGCGCTTTTTCCATCATGGTG
+HWUSI-EAS1795_0092:3:1:8407:1983#0/1
hhhhhhhhfhhhhhhhhhhhhfghgfghhhhhh
@HWUSI-EAS1795_0092:3:1:9059:1987#0/1
AAAATTTTCAGTGGGCAGGTTAGACTTTATATA
+HWUSI-EAS1795_0092:3:1:9059:1987#0/1
d_cfcff^\Z_ZYaaa^fYdfaa`babffffdf
@HWUSI-EAS1795_0092:3:1:9812:1986#0/1
TGCTTGTTCTCGTCCCGAGCTAAGGCCATTTGT
+HWUSI-EAS1795_0092:3:1:9812:1986#0/1
gggfeggggcgadffaaeacaffffffcgggdc
@HWUSI-EAS1795_0092:3:1:10299:1979#0/1
GTGTACAAAGCATTATGTACATTAAACATCCTA
+HWUSI-EAS1795_0092:3:1:10299:1979#0/1
hghhhhhhfgfhhghhhgghehhhhghfhhfhc
@HWUSI-EAS1795_0092:3:1:10348:1981#0/1
TGCGAAACGGGCGCGTGAGAAAAACAAAGTTGT
+HWUSI-EAS1795_0092:3:1:10348:1981#0/1
gghggghhhghfhfhhhghfhhhhghhcggfhf
@HWUSI-EAS1795_0092:3:1:10381:1986#0/1
CTTCGTTGGCTTAGTTTCCTGGCTTATATCCTG
+HWUSI-EAS1795_0092:3:1:10381:1986#0/1
hhhgghhhhhghf]fhhhghfhfhhhfhghhhg
@HWUSI-EAS1795_0092:3:1:10844:1981#0/1
ATTACATTCCCCACATACAAATGTCCGGAAACC
+HWUSI-EAS1795_0092:3:1:10844:1981#0/1
hfhhhhghhhhhhghghhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11043:1977#0/1
CCCAGACAATACTTTCGACTCCGATGACTCGGA
+HWUSI-EAS1795_0092:3:1:11043:1977#0/1
ff_Z]cda]]`b\\``S`Z`a`BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:11549:1976#0/1
CCTCCGTGTCCGTCCTCGTGGCAAAGAAGGCGA
+HWUSI-EAS1795_0092:3:1:11549:1976#0/1
hhhhgfhhhhhhhhhdhfhhhhhghhhehchhh
@HWUSI-EAS1795_0092:3:1:12128:1981#0/1
TCGCGGAGAAGGTGGTTATCGCAACGACGGACC
+HWUSI-EAS1795_0092:3:1:12128:1981#0/1
hhhhhhgfffffddfffcfffffhhhhhhhhch
@HWUSI-EAS1795_0092:3:1:12355:1976#0/1
AAGACTCCTTGTGGTGAGGGTTCCAAGACCTGG
+HWUSI-EAS1795_0092:3:1:12355:1976#0/1
eggfggggggggfffedfffefgggggggeggg
@HWUSI-EAS1795_0092:3:1:12430:1984#0/1
CGACCTTAGAGGCGTTCAGGCATAATCCAACGG
+HWUSI-EAS1795_0092:3:1:12430:1984#0/1
gggggggffgggggggeggg]gfggfggggggc
@HWUSI-EAS1795_0092:3:1:12532:1978#0/1
CGGCCTGTTGAGAAGTTTGCGTGTCCCCACCAT
+HWUSI-EAS1795_0092:3:1:12532:1978#0/1
hhhhhhhhhhghhhghhhhgcghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12713:1977#0/1
AACAAAAGTACACGACGCTTTGACCACACAAAG
+HWUSI-EAS1795_0092:3:1:12713:1977#0/1
hhhhghhhhhhhhhhhghhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12929:1986#0/1
GCGTTGATGTGCAGGAACTTTGGATATGAAGCA
+HWUSI-EAS1795_0092:3:1:12929:1986#0/1
hhhhhffhhfhhhhhfhhhghhhghghghhhha
@HWUSI-EAS1795_0092:3:1:12954:1984#0/1
CGCTTGATCTCCGCGTCCACGGCTTCAATGGTG
+HWUSI-EAS1795_0092:3:1:12954:1984#0/1
hhhhhghhhhhhghghhhhhhhghhhhhfhhfc
@HWUSI-EAS1795_0092:3:1:13376:1986#0/1
CAGCAGTAACATCAGCAGCAGCGGAAGCGGCAG
+HWUSI-EAS1795_0092:3:1:13376:1986#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhghhgh
@HWUSI-EAS1795_0092:3:1:13496:1984#0/1
AACAATACAGGACTCATATCCGAGGCCCTGTAA
+HWUSI-EAS1795_0092:3:1:13496:1984#0/1
hhhhhhhhhhhhhhhhhghhhgghhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:13617:1984#0/1
CGGACACTGACTCGTGACGCTTCTGCTTCAGTT
+HWUSI-EAS1795_0092:3:1:13617:1984#0/1
ghhhghhhhhhhhhhhhhhhhhfhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:13931:1977#0/1
GGGATGTCCAAGCCCATAAAGCCGGACAGACAG
+HWUSI-EAS1795_0092:3:1:13931:1977#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14098:1984#0/1
TTCCGGTTCTTCCGTTCTTTATCGTATGAACTC
+HWUSI-EAS1795_0092:3:1:14098:1984#0/1
gcggegcfffffggggfgggfgggggaegggfe
@HWUSI-EAS1795_0092:3:1:14524:1985#0/1
GTCAGTTCAAAGTTACGATAAATGGCTGATTTC
+HWUSI-EAS1795_0092:3:1:14524:1985#0/1
hhhfhhhhhhhdghfghcahhfaffcfhhhghe
@HWUSI-EAS1795_0092:3:1:14699:1982#0/1
AATCATTAGTCTTTTAATTGAAGGCTGGAATGA
+HWUSI-EAS1795_0092:3:1:14699:1982#0/1
ggcggggggggggfgggggcgggegggefcffc
@HWUSI-EAS1795_0092:3:1:14861:1983#0/1
CGCAGTGCGTGCACTTGTGGTATTCCTTCGGAT
+HWUSI-EAS1795_0092:3:1:14861:1983#0/1
hhfhdhdffhahcffhhhhhhfhaghgggghgf
@HWUSI-EAS1795_0092:3:1:15211:1983#0/1
GGAGTTTTCAAAATGACATTAATTCATAGGGGT
+HWUSI-EAS1795_0092:3:1:15211:1983#0/1
ff_fffffefffgeggggggggfff_fcffff`
@HWUSI-EAS1795_0092:3:1:15374:1987#0/1
CCACCCAGTACACAAAGTTCCGCCCGTTTTTGG
+HWUSI-EAS1795_0092:3:1:15374:1987#0/1
hhhhhhhhhhhhhghhhhhhhghhhhhhhhhga
@HWUSI-EAS1795_0092:3:1:16018:1980#0/1
GGGTAACGCTGACGGCAAGACCCTGATCGATGC
+HWUSI-EAS1795_0092:3:1:16018:1980#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:16162:1982#0/1
TTTCATTAAAGCCAACGCACGTTGAAGATCGCG
+HWUSI-EAS1795_0092:3:1:16162:1982#0/1
hhhhhhhhhhhhhhhhghghhhhghhdhhhhhg
@HWUSI-EAS1795_0092:3:1:16380:1982#0/1
GTATTATTGAGTGGTGTTGTTGGCTGCATTATG
+HWUSI-EAS1795_0092:3:1:16380:1982#0/1
hhhhhhhhghhhfhhehhchhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16626:1986#0/1
TTGATGGGCCGTCTGCGTCACTCCCAGGTGCGT
+HWUSI-EAS1795_0092:3:1:16626:1986#0/1
ffd][]adaddadWad_d]d[d`a`]^]XbZbO
@HWUSI-EAS1795_0092:3:1:16779:1983#0/1
TGTATGTTGAGGGCGACGAACTTTTCGATAAAT
+HWUSI-EAS1795_0092:3:1:16779:1983#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:17663:1983#0/1
TGCTGCGTCGCTGGCTGGTAGAGGAGAAGGGTG
+HWUSI-EAS1795_0092:3:1:17663:1983#0/1
gggggggggggggggfgfdff]ffbdbffffWf
@HWUSI-EAS1795_0092:3:1:17761:1984#0/1
ACGGCTTCATGCCATCCAAGGCTGCTCTCTACA
+HWUSI-EAS1795_0092:3:1:17761:1984#0/1
gggfgaggeafggcggggcfg_affdffee]df
@HWUSI-EAS1795_0092:3:1:18132:1979#0/1
GATCTATCGCCTGAACGACAACATGGTCTGCTC
+HWUSI-EAS1795_0092:3:1:18132:1979#0/1
hhhhhhhhhhhhhhhhhhfhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18183:1982#0/1
GGATTGTATTTTTTGTCGAACTCCTTCTTGATG
+HWUSI-EAS1795_0092:3:1:18183:1982#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19022:1987#0/1
CTCGTATGCAGATTACTTGTCGCCCTTGTAGTC
+HWUSI-EAS1795_0092:3:1:19022:1987#0/1
hhhghhhhghhhhghhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:1448:1999#0/1
GGGGAATGATGATGGATGATGTTGGATGATGAT
+HWUSI-EAS1795_0092:3:1:1448:1999#0/1
W]QLS_aVY[Y^_X\daaccaffa]a\aadYcB
@HWUSI-EAS1795_0092:3:1:1764:1991#0/1
GCCGACTTGTTGTTGCACGGAATGGCAATGTCG
+HWUSI-EAS1795_0092:3:1:1764:1991#0/1
_fdcfdffcfedhgghghddaf^cffffhhhee
@HWUSI-EAS1795_0092:3:1:2565:1991#0/1
GATGACACCGCCAAGGACATGGCTGTGATGATG
+HWUSI-EAS1795_0092:3:1:2565:1991#0/1
hhdhhhhhghhhhhhchfgehhhhhbhfaacW]
@HWUSI-EAS1795_0092:3:1:3591:1988#0/1
GCTGATCAGAACGAGCGCGCCTTCCAAAAACAA
+HWUSI-EAS1795_0092:3:1:3591:1988#0/1
dcggggggggggggdfggggfggggggffffb\
@HWUSI-EAS1795_0092:3:1:3687:1992#0/1
CTGGAGGATGTACTCTTTTGTAAGGAAGCTGCT
+HWUSI-EAS1795_0092:3:1:3687:1992#0/1
hhhgghhhhfhhhhhhhhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4360:1998#0/1
GCCACCGCCATCCGTGGTGCCATCATTCTGGCC
+HWUSI-EAS1795_0092:3:1:4360:1998#0/1
hhhhhhhhhhfhhhhhhhahhaghhhghggghg
@HWUSI-EAS1795_0092:3:1:4589:1994#0/1
CGCCGTGGTTGCTCATGTTGCTGTTGTTCTGGT
+HWUSI-EAS1795_0092:3:1:4589:1994#0/1
ffffafa_ddea[WadWffcaacbdbefafcff
@HWUSI-EAS1795_0092:3:1:5492:1995#0/1
TAGAGATTTAATGCGAGAAGTGCTTATAGTAAT
+HWUSI-EAS1795_0092:3:1:5492:1995#0/1
fdfafffggdgegggcfcc_ccfffff]fdadf
@HWUSI-EAS1795_0092:3:1:6236:1994#0/1
GGAATACCTGCAGGCATTCGCCGCCAGCAAGAA
+HWUSI-EAS1795_0092:3:1:6236:1994#0/1
hghhhhhhhhhhhhhhhhhhhhghhhgfghghh
@HWUSI-EAS1795_0092:3:1:6274:1992#0/1
GCGGAGCAAGTTTTCGCAGTCAGTCGACATATA
+HWUSI-EAS1795_0092:3:1:6274:1992#0/1
ggggggggggdggggggdggggggggggggfgf
@HWUSI-EAS1795_0092:3:1:6333:1991#0/1
CGCTGCGAAAGTACCCAGTACTGGCTCATCTTA
+HWUSI-EAS1795_0092:3:1:6333:1991#0/1
hhhhghhhhhedhhhhhcghhhfhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:6630:1994#0/1
CACGAAGGACACGATGATATAGGCATCAAACTC
+HWUSI-EAS1795_0092:3:1:6630:1994#0/1
hhhhhhhhhhhfhhgghdfeffhhhhhhhchgf
@HWUSI-EAS1795_0092:3:1:6850:1989#0/1
CCACGCTCTCCCTTGCTGCCAGCTGGTCCAATG
+HWUSI-EAS1795_0092:3:1:6850:1989#0/1
ggggggggggggggfggfgggffdffdgdgggg
@HWUSI-EAS1795_0092:3:1:7003:1991#0/1
GGAAAAGTCAGGGACAAGCTGAACAACCAGGTG
+HWUSI-EAS1795_0092:3:1:7003:1991#0/1
ghhhhghhhhhhhcfhhghhhfhhghhfghhhh
@HWUSI-EAS1795_0092:3:1:7034:1996#0/1
GTGAGATCTCGCTTGATTTCCGCCGCCTTCATC
+HWUSI-EAS1795_0092:3:1:7034:1996#0/1
hhhfghfhhhhhhhghhhhhhhfhdhhhghghh
@HWUSI-EAS1795_0092:3:1:7551:1995#0/1
GGGTGGTGTGCATTCTGGGAAGTGTTAACTGAT
+HWUSI-EAS1795_0092:3:1:7551:1995#0/1
hhhfhhhghghhfhhhghhcfggfhdhhhcahh
@HWUSI-EAS1795_0092:3:1:7669:1990#0/1
GCGGAGGAGGGATGCAGCGAGATATAAGGGAAG
+HWUSI-EAS1795_0092:3:1:7669:1990#0/1
hhhhhhhhhhhhhhhhhgghghghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8043:1999#0/1
TAAAGGATTTAAAGTGTACTCATTCCAATTACA
+HWUSI-EAS1795_0092:3:1:8043:1999#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8069:1997#0/1
CAAGAACGTAATGAAGGACTTCTCCAAGTTACC
+HWUSI-EAS1795_0092:3:1:8069:1997#0/1
ghhhhhhhhhhhhhhgghhhhhhhhhchhhghh
@HWUSI-EAS1795_0092:3:1:8210:1992#0/1
CCCAGCTCCTGGAAGGCACGCTGCTCGGCCATC
+HWUSI-EAS1795_0092:3:1:8210:1992#0/1
hhhghhhhhhhghhchfhhhhhfeghhhhhhhh
@HWUSI-EAS1795_0092:3:1:8376:1991#0/1
GTTGAAGGTGGCCCAGTACGCCGCCCAACTGGA
+HWUSI-EAS1795_0092:3:1:8376:1991#0/1
hhhhghhhhhhhhhhghhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8737:1996#0/1
TCGGTGGAGACCACCTCCTCATCGGTGTAGCCC
+HWUSI-EAS1795_0092:3:1:8737:1996#0/1
fcafcfd[ffcfgggg_f]c_fcgggcedddfg
@HWUSI-EAS1795_0092:3:1:8848:1997#0/1
AACCACGCCAAAGCCCACTACCACAACGACAAC
+HWUSI-EAS1795_0092:3:1:8848:1997#0/1
hhhhhhhhhhhhhhhhhhhhgghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9220:1989#0/1
TGGCCATTATAGATCATATCCCTCAATTTATTA
+HWUSI-EAS1795_0092:3:1:9220:1989#0/1
ggggggggggggggggdfggfgfggfgggfggg
@HWUSI-EAS1795_0092:3:1:9406:1992#0/1
GTGAGACCGTCCTGCTGGTCAAAGCCGCTGATC
+HWUSI-EAS1795_0092:3:1:9406:1992#0/1
hhhhhhhhhhhhhhhhghhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:9780:1996#0/1
GCCGGCTGGTTGAACCAGGTCTTCACATGCCGC
+HWUSI-EAS1795_0092:3:1:9780:1996#0/1
gggfgggggggdgffgfgfggcgggggeggggg
@HWUSI-EAS1795_0092:3:1:10034:1999#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:10034:1999#0/1
hhhhhhhhhhhhhhhhhhfhhghhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:10317:1993#0/1
CGCTGCGCGAGAAGCTCGTGGGCAACATCACCT
+HWUSI-EAS1795_0092:3:1:10317:1993#0/1
hhhhhhhhhhehhhhhhhghggehhhhhghhhg
@HWUSI-EAS1795_0092:3:1:10520:1989#0/1
AGCAGACCCAAGCCAAGGTGGACGAGGTGGTCG
+HWUSI-EAS1795_0092:3:1:10520:1989#0/1
hhhhhghhhhhhhhhhhfdhhhffcffbffeff
@HWUSI-EAS1795_0092:3:1:10840:1998#0/1
ATCACCAGTGCTCGGAAGATCTTGTCAAGCACT
+HWUSI-EAS1795_0092:3:1:10840:1998#0/1
ccRcc[]YWY_WV\\Waac_VcBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:11521:1990#0/1
GGATTTCATCAAGAACATGATCACTGGTACCTC
+HWUSI-EAS1795_0092:3:1:11521:1990#0/1
hhhghhhhhhhhhfhghhhhhhhhhhhhghfhh
@HWUSI-EAS1795_0092:3:1:11769:1991#0/1
CCGTGGGTGAACCGCCTCCTGGTCTACAACGTC
+HWUSI-EAS1795_0092:3:1:11769:1991#0/1
fgffcfffffffffdffggfga]ffffgggggg
@HWUSI-EAS1795_0092:3:1:11913:1997#0/1
TCTGGAGTGATTTTGTAGGCTCTCTAGCTCAAC
+HWUSI-EAS1795_0092:3:1:11913:1997#0/1
ggfffafV_V\\^\\WX]f[a[^\Y[afafff_
@HWUSI-EAS1795_0092:3:1:12152:1998#0/1
CGGCCAGAAGGTAAGCAGCCACGTAACGCATGT
+HWUSI-EAS1795_0092:3:1:12152:1998#0/1
hhhghhhhhhhhhhhhfhfhhfhhhhhhhfheh
@HWUSI-EAS1795_0092:3:1:12574:1995#0/1
CTAAATAGTCCTCCCTTGCCCTTCTACTCCGCA
+HWUSI-EAS1795_0092:3:1:12574:1995#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12608:1990#0/1
GCGGCCTGTTGATCTTGCTCATGAACAAACGCT
+HWUSI-EAS1795_0092:3:1:12608:1990#0/1
gggggggggggeggggggggggafgggggggfg
@HWUSI-EAS1795_0092:3:1:12663:1992#0/1
GTCAGCGAGTCTGAGGTCGAAAGTCCGGAGCTA
+HWUSI-EAS1795_0092:3:1:12663:1992#0/1
b]\\X_\O_VZZ\[aYX^]^^aW^accZMaXYT
@HWUSI-EAS1795_0092:3:1:12706:1999#0/1
GGAAGAAAAGCCAATCTAAACCGCCAAGATGGG
+HWUSI-EAS1795_0092:3:1:12706:1999#0/1
hfghhgghhhhhhhhfeghhhhehhffgedhhh
@HWUSI-EAS1795_0092:3:1:13509:1998#0/1
CGGCCAAAGTCTGGCTCTGGCTGATGATGGCGC
+HWUSI-EAS1795_0092:3:1:13509:1998#0/1
fffdfffcadfdgfgdgefgggf_ggg_efdef
@HWUSI-EAS1795_0092:3:1:13709:1990#0/1
CGAAAATGCAACTTCGATCGGGGCATATAAAAC
+HWUSI-EAS1795_0092:3:1:13709:1990#0/1
hhhhhghhhhhhhhhgfhghfghhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14272:1989#0/1
TGTCAGCGAATCGCTGAGTCTTTGTATCTTGGC
+HWUSI-EAS1795_0092:3:1:14272:1989#0/1
gggefgggggeggcfgcggggfgfgcggggcgf
@HWUSI-EAS1795_0092:3:1:14834:1990#0/1
GGAAAGCTCACTTGGAGCAGCCGCAGGCGGATT
+HWUSI-EAS1795_0092:3:1:14834:1990#0/1
ggggggggfgggggegfggg_gdfaffedfWaf
@HWUSI-EAS1795_0092:3:1:14996:1994#0/1
CACCGGCACATAGGTCACGTAAGTGTACAGCTT
+HWUSI-EAS1795_0092:3:1:14996:1994#0/1
hhhhhhhghhhhhhhhghghhgghhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:15230:1994#0/1
GTCGGCGCGGACTAACAGTTGGATCTTTTCGGA
+HWUSI-EAS1795_0092:3:1:15230:1994#0/1
ggggfggffSecffaffggggggggggfggggg
@HWUSI-EAS1795_0092:3:1:15343:1991#0/1
GTCAAGTTCCGAAGGCGTCGCGAAGGAAAGACC
+HWUSI-EAS1795_0092:3:1:15343:1991#0/1
hhhhhghhhhhghhhfhhhhghhghghhhfhhf
@HWUSI-EAS1795_0092:3:1:15443:1990#0/1
CTTTCCCAAGGACTTGAGACCCTTACAGAGGAT
+HWUSI-EAS1795_0092:3:1:15443:1990#0/1
gcgfgdggcggWcffcdfgfgcgfgggfdgggg
@HWUSI-EAS1795_0092:3:1:15614:1998#0/1
TGTATTTATAAATGTGTTTGTGGTCATAGATTA
+HWUSI-EAS1795_0092:3:1:15614:1998#0/1
hhhhhhhghhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:16308:1999#0/1
CAATATTGACAGTCAGTCGCACAATAATTTTTA
+HWUSI-EAS1795_0092:3:1:16308:1999#0/1
fffffafaWeedbdabdfefcfcf]c`faffff
@HWUSI-EAS1795_0092:3:1:17040:1990#0/1
GTCGCCATACCGATGTGAAACCTTGGTGTCGGC
+HWUSI-EAS1795_0092:3:1:17040:1990#0/1
a`adacadcccdfafdfffdcccadd]Z_^a^`
@HWUSI-EAS1795_0092:3:1:17557:1988#0/1
GTGTGGTGTTGTGGTGGTGTTGCTGCTGCAGCT
+HWUSI-EAS1795_0092:3:1:17557:1988#0/1
ggggggggggggffffffffffggggggggggg
@HWUSI-EAS1795_0092:3:1:17721:1991#0/1
AGGACCTGCTCACCTCGACCATTAGCACAAATG
+HWUSI-EAS1795_0092:3:1:17721:1991#0/1
hhhhhhhhhhhhhhghhhhhhghhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:18452:1999#0/1
TAGGAATTCTGTTGATTAAATAAGTAGCAGTTA
+HWUSI-EAS1795_0092:3:1:18452:1999#0/1
fafcf^[ffffffgefgggffaccfdaaaeeeg
@HWUSI-EAS1795_0092:3:1:18741:1990#0/1
CTGGGCTTCTTGACAACCATTTTCAAGCGGTTT
+HWUSI-EAS1795_0092:3:1:18741:1990#0/1
hhhhhghhhahfghhhghhfhhhhhghehcggh
@HWUSI-EAS1795_0092:3:1:19276:1991#0/1
CTTCGATATTCGTTCGCAGATGGGCTTCACTGT
+HWUSI-EAS1795_0092:3:1:19276:1991#0/1
ggggggggfgggfgggffgfgggggggggdggd
@HWUSI-EAS1795_0092:3:1:19400:1996#0/1
CACCTGGACCGCCGAACTTCTTGGGCTCGCAGC
+HWUSI-EAS1795_0092:3:1:19400:1996#0/1
hhhhhghghhcfhhhhhhgghhfheh[hhhggh
@HWUSI-EAS1795_0092:3:1:19752:1992#0/1
GTTTCCCGACTACGGTAAACTGGAGGTGGCCCT
+HWUSI-EAS1795_0092:3:1:19752:1992#0/1
hhhhhhhhhhhhhhahhhhhhhhghhdhgghhh
@HWUSI-EAS1795_0092:3:1:19791:1998#0/1
GGAAAGACCTTTATTTTTGCCGACTGCCATGTT
+HWUSI-EAS1795_0092:3:1:19791:1998#0/1
gcggegggfagggggggggfggggggggggggf
@HWUSI-EAS1795_0092:3:1:1613:2009#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:1613:2009#0/1
KVWZ__ZSM\YSVVVQOaaaa^Y^\Z^\YaaVc
@HWUSI-EAS1795_0092:3:1:1704:2008#0/1
GAGACGCATCTGCTGGCCTTCGAGTTGTACTAC
+HWUSI-EAS1795_0092:3:1:1704:2008#0/1
hehhhhhhhgfhgahhhhgfhghghhfhhfhhf
@HWUSI-EAS1795_0092:3:1:2164:2004#0/1
CGCCGAGATATTGTAGCCTACCCGAGGGACCAC
+HWUSI-EAS1795_0092:3:1:2164:2004#0/1
ggggggagdgg]a`d`eggggggggcecggggg
@HWUSI-EAS1795_0092:3:1:2912:2002#0/1
CGCCCACTCTCTTTCTCTCTCCGCTAGTGCTAG
+HWUSI-EAS1795_0092:3:1:2912:2002#0/1
hghhhgfhhhhhhhhhhghghhahehhhghhfh
@HWUSI-EAS1795_0092:3:1:3553:2006#0/1
GTGGTTACCCGCCTTGAGCCACAGACTCTTCCC
+HWUSI-EAS1795_0092:3:1:3553:2006#0/1
_affffdgeggdfcf]ffffffgddggfggggg
@HWUSI-EAS1795_0092:3:1:3807:2009#0/1
GTTGGACTTCAGGGTTAGACTCGCCAGCGAAGA
+HWUSI-EAS1795_0092:3:1:3807:2009#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4061:2003#0/1
CTGCTTTATCTGATTTTGGCGACGCTGAGGAAT
+HWUSI-EAS1795_0092:3:1:4061:2003#0/1
ggggggfdcfffggggggggggggfggdfcffd
@HWUSI-EAS1795_0092:3:1:4287:2006#0/1
GCTAAGTTGTGTGTCCGGATACTGGGTGCATAC
+HWUSI-EAS1795_0092:3:1:4287:2006#0/1
ee\^cacYeeeefffffffcYdfffdWfdaeff
@HWUSI-EAS1795_0092:3:1:4519:2004#0/1
CTTGACCTCGCGGGAGGTGAAGCTGTAACCTTG
+HWUSI-EAS1795_0092:3:1:4519:2004#0/1
gggaggggggggdfWfccfaffeffdfgggdag
@HWUSI-EAS1795_0092:3:1:4860:2011#0/1
CGGTCGTCTTGCAGCAAACCCAATTTGTCTCGT
+HWUSI-EAS1795_0092:3:1:4860:2011#0/1
hhhhhhhhhhfhhhhhhhhhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:4877:2003#0/1
CTTGGAGTCACCGGCAACGTAGCCACGACGCAG
+HWUSI-EAS1795_0092:3:1:4877:2003#0/1
hhgehghhhhghhghhhhhhhhhhhhghhhhhf
@HWUSI-EAS1795_0092:3:1:5344:2000#0/1
GTGCGGGCCAAACGGCCGCGATCACCGGTCTTC
+HWUSI-EAS1795_0092:3:1:5344:2000#0/1
hhhhhhhhhhhhhhhhhghhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6094:2004#0/1
GGCCTTCAAGTACCTGGGCTGGGCATGCTTCCC
+HWUSI-EAS1795_0092:3:1:6094:2004#0/1
ec]ddfbZY]M\XW]__d`bfdfff[f^[\_^f
@HWUSI-EAS1795_0092:3:1:6710:2000#0/1
TTGGGATGCCACCGATAGTGAGGCTGAGCCAGA
+HWUSI-EAS1795_0092:3:1:6710:2000#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:6789:2003#0/1
CGTTAACGACATCTCTCTGCAGGATTACATCTC
+HWUSI-EAS1795_0092:3:1:6789:2003#0/1
hhhhhhhhhghhhhhhhhhhhhhfhhdhhhhhh
@HWUSI-EAS1795_0092:3:1:6815:2006#0/1
GACGACTCGAAGTCGTGGTGGCTGCTGTCCGTA
+HWUSI-EAS1795_0092:3:1:6815:2006#0/1
ccffgcggfgfggggffffd_]bf`b]`aad\\
@HWUSI-EAS1795_0092:3:1:6949:2008#0/1
GCTTTTCATCCGCTAGTGTGTGCTTTTTGTTTT
+HWUSI-EAS1795_0092:3:1:6949:2008#0/1
Ycc^^caf^fffa[daddf]f[Ybaa`WNUUU_
@HWUSI-EAS1795_0092:3:1:7319:2002#0/1
CGAAGAATGAGAATGGTTGTTTTCGCGGTGTGT
+HWUSI-EAS1795_0092:3:1:7319:2002#0/1
hhghhhhhfhhhhhhhhhfhhhhhghhfeggff
@HWUSI-EAS1795_0092:3:1:7489:2000#0/1
GGGTCTTTCCAGTTCTGGAATAATTTGCTGGGC
+HWUSI-EAS1795_0092:3:1:7489:2000#0/1
ghgghhhhhhghhghhffghhhhhhhhcfhhhh
@HWUSI-EAS1795_0092:3:1:8325:2008#0/1
CCTCGCGATCGCCTGAGCAGCAACCTCATCGAC
+HWUSI-EAS1795_0092:3:1:8325:2008#0/1
hhhhhhhhhhhhhhhhghhehhhhhhgghhhhh
@HWUSI-EAS1795_0092:3:1:8545:2007#0/1
CAGGCATCGTCCTAGTCTATAAGCCGGGCACAA
+HWUSI-EAS1795_0092:3:1:8545:2007#0/1
hhhghhhhhhhhhhhhhhhehhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8569:2010#0/1
GGTAAATTGTTTGGAGAACTGTTACTGTATGGT
+HWUSI-EAS1795_0092:3:1:8569:2010#0/1
hhhhhhhgfhhhhhdfghhhefhhhhghghhgf
@HWUSI-EAS1795_0092:3:1:9242:2001#0/1
GGTTATTCGGCAGCGCAAACCGTTCAGGAGGAG
+HWUSI-EAS1795_0092:3:1:9242:2001#0/1
aed\edeafdffgggagafcdf_fff_eade`f
@HWUSI-EAS1795_0092:3:1:9722:2003#0/1
TGCTGCTGCGCCTGCTGCTGCAAATGCTGTTGT
+HWUSI-EAS1795_0092:3:1:9722:2003#0/1
a_cadc^fffff`fcccffaffceb^a]]\]\a
@HWUSI-EAS1795_0092:3:1:10160:2000#0/1
CATCGGGGGTGACCTTGTACATGGCGGCGAGCT
+HWUSI-EAS1795_0092:3:1:10160:2000#0/1
gggggggggcggggggggfgg_fffffggaga`
@HWUSI-EAS1795_0092:3:1:10217:2002#0/1
GATTACTAGATGATGTTTCCAAAGAGTCGTGTT
+HWUSI-EAS1795_0092:3:1:10217:2002#0/1
hghhhhhfhhhhhhhhhhhghfghhghhhhfgh
@HWUSI-EAS1795_0092:3:1:10244:2008#0/1
AAACAACCACAAACCCAACCACACAATCAACCA
+HWUSI-EAS1795_0092:3:1:10244:2008#0/1
hhhghfhhhhhhhhhfhhhghhhhhghgheheh
@HWUSI-EAS1795_0092:3:1:10279:2005#0/1
CAGCTTATGAAATGATGTGAACTTTTGCACAGG
+HWUSI-EAS1795_0092:3:1:10279:2005#0/1
hhhhhhhhhhhhhghgggghhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10358:2000#0/1
GTTTTTCTGGGTTTTCCCCGTATCCTCGCAGCA
+HWUSI-EAS1795_0092:3:1:10358:2000#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:10947:2000#0/1
GACACACCCCTAGTATTCCGCACAACCGCGAGC
+HWUSI-EAS1795_0092:3:1:10947:2000#0/1
hehhhfhhhhhfhhhhhhhhhfhhhhhhhhhha
@HWUSI-EAS1795_0092:3:1:11138:2003#0/1
TGTGTCCTCTTCGCATTTTAACGCGGTAATCGC
+HWUSI-EAS1795_0092:3:1:11138:2003#0/1
hhhhhhhReeeehhhhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:11540:2000#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11540:2000#0/1
hhgghhhhhhhhehghhhhhhhhhhghcghhdh
@HWUSI-EAS1795_0092:3:1:11932:2006#0/1
CCGATACAAAGCAAAAGTGTCTAACCAAGTACT
+HWUSI-EAS1795_0092:3:1:11932:2006#0/1
hhhghhhghhhhhhhghhhhhhhhhghhhahhh
@HWUSI-EAS1795_0092:3:1:12726:2004#0/1
CGGGAGTAGTGCTCCGGCCAGTCCCTCCCCTGA
+HWUSI-EAS1795_0092:3:1:12726:2004#0/1
hhhhhhhhhhhhghhhhhhhhhhhhchhhhhhh
@HWUSI-EAS1795_0092:3:1:12834:2005#0/1
CGGGAGCTTGTCAATCGGCCAACCAATGCGAAG
+HWUSI-EAS1795_0092:3:1:12834:2005#0/1
ccc_I_PYSUWY]]M]]c_caBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13128:2000#0/1
GAAGTAAATAAAGCTAAAATTCAATTATGGACG
+HWUSI-EAS1795_0092:3:1:13128:2000#0/1
aYTZ\_WGSKQOOVUVVc\aacaccS]^a`L^a
@HWUSI-EAS1795_0092:3:1:13238:2006#0/1
CGCCATGTCAAACTCTGAGGTAAGCAGCTCAAA
+HWUSI-EAS1795_0092:3:1:13238:2006#0/1
hhhhhhhgffhhhghhgfhh_hhhhghgghhhh
@HWUSI-EAS1795_0092:3:1:13777:2006#0/1
CTTCTTCTTGGTGATACCGGGCTTGACCTTGCG
+HWUSI-EAS1795_0092:3:1:13777:2006#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:14012:2007#0/1
AACAACGTGACAAGTAGAACCAATGTTATCATC
+HWUSI-EAS1795_0092:3:1:14012:2007#0/1
ggddfffcfffffff_fcdffdfcfffggffcf
@HWUSI-EAS1795_0092:3:1:14225:2009#0/1
GAGAAAATCTCCATACATCCAAAATGGTCAACT
+HWUSI-EAS1795_0092:3:1:14225:2009#0/1
hfhhhhhhhhhhhhhhhhhhhhhhhhgcfhdhh
@HWUSI-EAS1795_0092:3:1:14575:2009#0/1
CTTGTATCCCACTGAAGAAGTCTGATCCCGTCG
+HWUSI-EAS1795_0092:3:1:14575:2009#0/1
hhhhhghhhhShhhhheghfhhhhehhhhhghh
@HWUSI-EAS1795_0092:3:1:15156:2005#0/1
GTGGGCGAATTTGGCTCTCCTGCCCACAAGGGC
+HWUSI-EAS1795_0092:3:1:15156:2005#0/1
hhhghhghhghfQUGV[S[[PXhhagghgggch
@HWUSI-EAS1795_0092:3:1:15383:2003#0/1
ATCAGAACATCATCATCTACGCGCTATACAAAT
+HWUSI-EAS1795_0092:3:1:15383:2003#0/1
fafafaffcffacdd\^fdf_fae[[ebade]c
@HWUSI-EAS1795_0092:3:1:15938:2006#0/1
GGCAGATCTTCTCGAGATCAGAAGAGTTGTGCT
+HWUSI-EAS1795_0092:3:1:15938:2006#0/1
gcegfgdgagg_afWfcccdfddfWffaf_fdc
@HWUSI-EAS1795_0092:3:1:16151:2009#0/1
TGGCTCTGAAGGTCAGCAACAAGTGCCAGGCAT
+HWUSI-EAS1795_0092:3:1:16151:2009#0/1
gefgggggeggggcggfgfgg_fccffffcffg
@HWUSI-EAS1795_0092:3:1:16820:2000#0/1
TACACGTACTGCTCCATCTGGAAGTTGACGTTC
+HWUSI-EAS1795_0092:3:1:16820:2000#0/1
e\fffafaffcaceaac_^\UZdceeef\afd^
@HWUSI-EAS1795_0092:3:1:16869:2004#0/1
AGCATCTTAAAAATGCATTTATCGCCTATAAAT
+HWUSI-EAS1795_0092:3:1:16869:2004#0/1
fhghhhhhhhhehhhhhhhhfhhhhgchhhhgh
@HWUSI-EAS1795_0092:3:1:17252:2011#0/1
GGGTAAACGCCGAAAGCGGAAGCGATGGTTCGC
+HWUSI-EAS1795_0092:3:1:17252:2011#0/1
hhhghhghhhhhhhhfhfhhfdghg_hhhhhag
@HWUSI-EAS1795_0092:3:1:18343:2001#0/1
GTTCAGCACGATGACCTGGGCGGTGAAGTCGGC
+HWUSI-EAS1795_0092:3:1:18343:2001#0/1
hhhhhhhhhfhhghhhhhhhhhhghhhhhfhhh
@HWUSI-EAS1795_0092:3:1:18589:2004#0/1
GCAGAGTATCCAGGAAAGCGTTTCACAGAGTGA
+HWUSI-EAS1795_0092:3:1:18589:2004#0/1
fadffffggfgdge_gggcgggefcffgaefgc
@HWUSI-EAS1795_0092:3:1:18969:2009#0/1
GTCAAGGCTAAGATCCAGGATAAGGAGGGCATT
+HWUSI-EAS1795_0092:3:1:18969:2009#0/1
hhhghhghhhhhhhhhhhhhghhhfhhhghhhf
@HWUSI-EAS1795_0092:3:1:1356:2013#0/1
CATTGCCACCCGTTTGGCCTATGGAACAGCTCT
+HWUSI-EAS1795_0092:3:1:1356:2013#0/1
[cfcaaWYdR_Zdddc`ff\facYcdc[dcdaB
@HWUSI-EAS1795_0092:3:1:1916:2021#0/1
TGCCAACGACGCCGTTTCAGTTAATGCCAGCAT
+HWUSI-EAS1795_0092:3:1:1916:2021#0/1
dggggggadaeaadeeebdcceec^ecfdffff
@HWUSI-EAS1795_0092:3:1:2404:2017#0/1
CAGAAGCTGGTCCAAGTCGACACCGCGGTAGGT
+HWUSI-EAS1795_0092:3:1:2404:2017#0/1
ffff\__dadcddc^[dff[ffffcffdW[dcf
@HWUSI-EAS1795_0092:3:1:4463:2022#0/1
AGATAACAGAACCAAGCGACGCCCAAAAAGTCG
+HWUSI-EAS1795_0092:3:1:4463:2022#0/1
hhhhhhhccdQc___\]hhhghhhhhhhghehh
@HWUSI-EAS1795_0092:3:1:4596:2020#0/1
TGCATATATCGAGGGTACACTGTACCTATAAGT
+HWUSI-EAS1795_0092:3:1:4596:2020#0/1
gggggggcffffgdaggfffffgggdgggfggg
@HWUSI-EAS1795_0092:3:1:5111:2020#0/1
GCAGGTTGTAGCCCTTCTTCAAGGTGGACGGCT
+HWUSI-EAS1795_0092:3:1:5111:2020#0/1
hhhhhhhhhhhhhhhhhhhgghhfhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:5132:2017#0/1
CGGATCTAATTTGCCGACTTCCCTTACCTACAT
+HWUSI-EAS1795_0092:3:1:5132:2017#0/1
dda[^eedf_ccfcdf^faaffaccffgggcg^
@HWUSI-EAS1795_0092:3:1:5248:2021#0/1
GTTTCCTTCCTCCAAAACATCTTGATCGACGTT
+HWUSI-EAS1795_0092:3:1:5248:2021#0/1
hhhhhhhhhhghhhhhhhhhgheghhhfhghhh
@HWUSI-EAS1795_0092:3:1:5489:2021#0/1
GGATGATGACGAGAACTGGTCCACCGCCGACGT
+HWUSI-EAS1795_0092:3:1:5489:2021#0/1
hhhhhdghhhhhgfhhghhhhehhhhahhghhe
@HWUSI-EAS1795_0092:3:1:5564:2014#0/1
GAAAGAAGCAAGTGCGTGTGTTTTTAAACCGAA
+HWUSI-EAS1795_0092:3:1:5564:2014#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6058:2015#0/1
GAAAAATGCATTTAATCGCCCTCTCCTTAATAG
+HWUSI-EAS1795_0092:3:1:6058:2015#0/1
hhhhhhhhghhhhhhfhhhhhghhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6228:2021#0/1
ATTGATTCTAGGCTTTGTCATTGTATTAAATAA
+HWUSI-EAS1795_0092:3:1:6228:2021#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:6464:2022#0/1
TCTGGCGAACATTTTGGATGTTGGATGGTTATT
+HWUSI-EAS1795_0092:3:1:6464:2022#0/1
gffffffcdfaffdfffbffgfffccfdggegg
@HWUSI-EAS1795_0092:3:1:6835:2022#0/1
AGGATGTGCTGGAACTTCTCTGGGATGACGAGC
+HWUSI-EAS1795_0092:3:1:6835:2022#0/1
hhghhhhghhhghhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:6876:2013#0/1
GTTGGCGAGGATGAGGATGCCGACAAGAAGGAC
+HWUSI-EAS1795_0092:3:1:6876:2013#0/1
fhhfhhhhhhhhghghghhhhhhghhfhghhhh
@HWUSI-EAS1795_0092:3:1:7316:2022#0/1
CTTGGCTCCGGCAATGATACCAGCCTTCGACAC
+HWUSI-EAS1795_0092:3:1:7316:2022#0/1
ggdfggggggggfgggfggggfgggggggggfg
@HWUSI-EAS1795_0092:3:1:7946:2020#0/1
CCTCTCCCCAGCCCACCAACTTCACCGAGTGGA
+HWUSI-EAS1795_0092:3:1:7946:2020#0/1
gggcgcgfccafcfffcggg]_cebb^f`cc`e
@HWUSI-EAS1795_0092:3:1:8122:2018#0/1
ACAAAGGGCAGGGACGTAATCAATGCGAGTTAA
+HWUSI-EAS1795_0092:3:1:8122:2018#0/1
aaacc_caXba_YPZ\acccc_caccaS^a\\c
@HWUSI-EAS1795_0092:3:1:8517:2023#0/1
GTTTGCGTGCATAATCTTCGCAGTGTTCATTTA
+HWUSI-EAS1795_0092:3:1:8517:2023#0/1
ghghghhhhhhghhfhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:8742:2013#0/1
CTGGACGGCAGCTTGTTCCTCGGACTGGTATTT
+HWUSI-EAS1795_0092:3:1:8742:2013#0/1
ggggggggggggggfggggfggggegggggggg
@HWUSI-EAS1795_0092:3:1:8783:2019#0/1
GGCCTCTCGAGCAGCCACAGGCATGTTGGAGGT
+HWUSI-EAS1795_0092:3:1:8783:2019#0/1
ggggggadfdfecgggfg[gccgggggeeWedS
@HWUSI-EAS1795_0092:3:1:8816:2019#0/1
CCCAAGTCATCGTCACACAGCCACATACAGAGG
+HWUSI-EAS1795_0092:3:1:8816:2019#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:9094:2019#0/1
GCAGACCTTGAAGACCCTGCGCCAGGGCAAGGC
+HWUSI-EAS1795_0092:3:1:9094:2019#0/1
f_df_f]fc^fddaccefcffddfaffa_ffW]
@HWUSI-EAS1795_0092:3:1:9251:2017#0/1
GCGAGAAAAAAAGTGAAGAAAAGCAAAGACTTA
+HWUSI-EAS1795_0092:3:1:9251:2017#0/1
gggggcgggggfgegggacfffgfgggfgfggg
@HWUSI-EAS1795_0092:3:1:9414:2011#0/1
GATATATTCTGCAGCTTCTGGCCGGTCAGGAGT
+HWUSI-EAS1795_0092:3:1:9414:2011#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9678:2016#0/1
TCTATTTCCATAATTCTGGCAGCTCTTTGACGC
+HWUSI-EAS1795_0092:3:1:9678:2016#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10226:2021#0/1
GGAAGTAGAGGTCTCGTCCAGCCGGAGGAGAGG
+HWUSI-EAS1795_0092:3:1:10226:2021#0/1
ghhhhghhfdhehhhhhhhhhgchhhgghgghh
@HWUSI-EAS1795_0092:3:1:10806:2013#0/1
TGCACACGGCGGGTCTTGGCGGCAGGGATCGAG
+HWUSI-EAS1795_0092:3:1:10806:2013#0/1
^a\cccccccdc\Zaaca`R]`^BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12420:2021#0/1
GCTGATATTCCCTCCTAGACCTGCTCCACTCAT
+HWUSI-EAS1795_0092:3:1:12420:2021#0/1
ggggggggggggegggggggggggggeggdfgg
@HWUSI-EAS1795_0092:3:1:12456:2020#0/1
GGACGGACCAATATATCGGTATTTGTGTTTATA
+HWUSI-EAS1795_0092:3:1:12456:2020#0/1
fafeefacdddefafcffddafdaffcfffcfd
@HWUSI-EAS1795_0092:3:1:13525:2012#0/1
AAAACATAAATCATCTGAAAATGTACACAGTAT
+HWUSI-EAS1795_0092:3:1:13525:2012#0/1
fddffcfffefffdfffffgggfgdgggcgfeg
@HWUSI-EAS1795_0092:3:1:13619:2015#0/1
CCGCTGCTCTCTAGTGGTTTCCGTATGATTTCG
+HWUSI-EAS1795_0092:3:1:13619:2015#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:14437:2015#0/1
CACCAAGGGCAAGAAGTAGCTGGTTTGCTTCCA
+HWUSI-EAS1795_0092:3:1:14437:2015#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhheg
@HWUSI-EAS1795_0092:3:1:14786:2016#0/1
TGTAAACTATATGTACAGATGCTGGTCCAGGGA
+HWUSI-EAS1795_0092:3:1:14786:2016#0/1
fhhhhghhhShgdhhhgafhhfhhghhhhhhgg
@HWUSI-EAS1795_0092:3:1:15229:2016#0/1
CGACGCCCGCACAAGCAAGATGAAACAGAACCC
+HWUSI-EAS1795_0092:3:1:15229:2016#0/1
ddWbdd[ddY]cd_ddd_fccffffcffcdcf_
@HWUSI-EAS1795_0092:3:1:15457:2016#0/1
CGCTGAACCACTTTCATGCTTGGGATTGTGAAC
+HWUSI-EAS1795_0092:3:1:15457:2016#0/1
hhhhhhhhhghhhhhghhhhhghhhhghhghhh
@HWUSI-EAS1795_0092:3:1:15514:2013#0/1
CCAGAGGTGAGCAGGCAAGAGATACGACATGGT
+HWUSI-EAS1795_0092:3:1:15514:2013#0/1
gagggggggfgfgggggggd_aggggggagggg
@HWUSI-EAS1795_0092:3:1:16537:2012#0/1
GCTTGTCAGCTCTATGCAGCTTATTGAGACAGC
+HWUSI-EAS1795_0092:3:1:16537:2012#0/1
hhhhghhhhhhhhhhhhhhghhghhhhghhhgg
@HWUSI-EAS1795_0092:3:1:16752:2011#0/1
CTGTGCTTCTGCTGTCTAAAGATGAAGACGCCT
+HWUSI-EAS1795_0092:3:1:16752:2011#0/1
hhhhghhhhhghhhhhhhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16784:2022#0/1
GTTTAAATAAAGAATTCGGCAAAAATAATATTC
+HWUSI-EAS1795_0092:3:1:16784:2022#0/1
hhhhhhhfffffN^^bbfffffhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:17630:2016#0/1
TCCAGACCTTGACGGTGCGATCCCAGCCGCAGG
+HWUSI-EAS1795_0092:3:1:17630:2016#0/1
hggghghhhhhhhhhgfhgffhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17733:2014#0/1
AAGATGATGGACACCAACGGCGAACTGGGCGAG
+HWUSI-EAS1795_0092:3:1:17733:2014#0/1
hhhhffhhfhhhhhhhhhhhhhhhcehggfhch
@HWUSI-EAS1795_0092:3:1:18366:2017#0/1
CGGAGTAGTAGCCACCGGGCGAAACCTGATCCG
+HWUSI-EAS1795_0092:3:1:18366:2017#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18636:2011#0/1
CGAAAAAATACCTTGTCTATGCGGCGCCCAAGG
+HWUSI-EAS1795_0092:3:1:18636:2011#0/1
dfaffffg`gggggfggggg_aacddf^Z\\af
@HWUSI-EAS1795_0092:3:1:18659:2016#0/1
TTCGAAATCGAGTGATTCAAGCGATCCACAGAA
+HWUSI-EAS1795_0092:3:1:18659:2016#0/1
hhhhhhhhhhheghhfhghhhhhfhhhghfhhg
@HWUSI-EAS1795_0092:3:1:19069:2016#0/1
CGTGATTGCTGGCAATCATGAGCTCAGCTTCGA
+HWUSI-EAS1795_0092:3:1:19069:2016#0/1
fffggfgff]ffdfcffgeggfffffeeceff_
@HWUSI-EAS1795_0092:3:1:19273:2012#0/1
GCCGGTCTTCTTGTCCTTCTTAGCCTTCAGACG
+HWUSI-EAS1795_0092:3:1:19273:2012#0/1
gggfgggffadffafffffcffggggfdffffg
@HWUSI-EAS1795_0092:3:1:19596:2019#0/1
CGCAAATCATTTTCACGGAAATCGGATGATAGG
+HWUSI-EAS1795_0092:3:1:19596:2019#0/1
hhhehhggchhhgghhhhhhhhghhdahdchhh
@HWUSI-EAS1795_0092:3:1:1555:2027#0/1
GGAAGGAAGGGTTCTTGCTGTTATTGCTTGCCG
+HWUSI-EAS1795_0092:3:1:1555:2027#0/1
_fffccafdeffgggeggegggafffefggggg
@HWUSI-EAS1795_0092:3:1:2431:2030#0/1
CTGCTTTATCTGATTTTGGCGACGCTGAGGAAT
+HWUSI-EAS1795_0092:3:1:2431:2030#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhff
@HWUSI-EAS1795_0092:3:1:2861:2028#0/1
ATCAACCACAAGAAACCCTGAACCAAGACAACC
+HWUSI-EAS1795_0092:3:1:2861:2028#0/1
ehghhhhhgghhfhhhhghghhhfhhggchhhh
@HWUSI-EAS1795_0092:3:1:3357:2027#0/1
TGGGTGACCTTGTGTGTAGGGTCGTTACGAATT
+HWUSI-EAS1795_0092:3:1:3357:2027#0/1
fgfghghfhhhehhhfhcffffhhhhhacafff
@HWUSI-EAS1795_0092:3:1:3596:2033#0/1
AAGCTATCGAGTGAGATGTCACTATTAAGCCAT
+HWUSI-EAS1795_0092:3:1:3596:2033#0/1
cff[affffcfaWdcdd[daa[fdfffaf_afc
@HWUSI-EAS1795_0092:3:1:4101:2026#0/1
GGCCGCTCACACCCACCCACACATGCACAACAA
+HWUSI-EAS1795_0092:3:1:4101:2026#0/1
ffdfffffffafggggffcdfafdaffgggffg
@HWUSI-EAS1795_0092:3:1:4155:2023#0/1
CCAAGATGTATATCCCACACCGGGCTATATGGA
+HWUSI-EAS1795_0092:3:1:4155:2023#0/1
hhhhhhhhhhhghghhchhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:4305:2027#0/1
GCCGTTCAAATTTTAAGTCTGTTCGACTTTTAA
+HWUSI-EAS1795_0092:3:1:4305:2027#0/1
gfggggggggggfffffggcggggggagggfgg
@HWUSI-EAS1795_0092:3:1:4515:2033#0/1
ACCAAATATGGACTGCAGACGTTCGTTGACTAC
+HWUSI-EAS1795_0092:3:1:4515:2033#0/1
eccdceef^afcfffffacfffggcfgccfffg
@HWUSI-EAS1795_0092:3:1:5157:2032#0/1
CAACAACAGCAGCAGCAACACCAGCAACACGAA
+HWUSI-EAS1795_0092:3:1:5157:2032#0/1
hhghhhhhhghhhhhhhhghhhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:5749:2031#0/1
CTTATTTTTAATTTGAGTTGCCCGAGTCAAAAA
+HWUSI-EAS1795_0092:3:1:5749:2031#0/1
ggggggggggggafff\cfaffgacggfffffg
@HWUSI-EAS1795_0092:3:1:6449:2032#0/1
CGTCGCAGAGGGCATTCTGCAATCGGGATCCAG
+HWUSI-EAS1795_0092:3:1:6449:2032#0/1
hhhhhhfhhffhhhgdgghhhhfhghgghhhgh
@HWUSI-EAS1795_0092:3:1:6768:2030#0/1
GTTCCATACGAGGGCGATGAACTGGGCGTAGAG
+HWUSI-EAS1795_0092:3:1:6768:2030#0/1
ggggggfgggegggggaffffffggfgggcgcf
@HWUSI-EAS1795_0092:3:1:6789:2029#0/1
CTTCAGCAGAGCTTTGCCATCTTTGTCCTTGTC
+HWUSI-EAS1795_0092:3:1:6789:2029#0/1
hhhhhgfhhhhhhhhgfffgghhhfhhhhhghh
@HWUSI-EAS1795_0092:3:1:6893:2023#0/1
TCTTCAGCTGCAAATGTCCCTCCGACTTGCGAT
+HWUSI-EAS1795_0092:3:1:6893:2023#0/1
gfgggdgggggdggggggggcggggcggggggg
@HWUSI-EAS1795_0092:3:1:7006:2034#0/1
GACGTAATCAATGCGAGTTAATGACTCACACTT
+HWUSI-EAS1795_0092:3:1:7006:2034#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7221:2032#0/1
GAGAACTACTACTTCCTCTACAGCATCGAGGAG
+HWUSI-EAS1795_0092:3:1:7221:2032#0/1
aggfgggcfgggfgggeggggfgggfggggggg
@HWUSI-EAS1795_0092:3:1:7244:2027#0/1
GAATACGCGGTTGGCAATCGAACGCAACAGTAG
+HWUSI-EAS1795_0092:3:1:7244:2027#0/1
hhhhhhhhghhhhhhhhhhffhfhhhfcehdgh
@HWUSI-EAS1795_0092:3:1:7673:2031#0/1
CGACAACAGAGTGCGTCGCCGCTTCAAGGGACA
+HWUSI-EAS1795_0092:3:1:7673:2031#0/1
hhhhhhhhghghhhhhghhhehccfffggaghh
@HWUSI-EAS1795_0092:3:1:8148:2024#0/1
GGCGGAGGGCAGCCTGTGTCAGGTCCTTGCGGT
+HWUSI-EAS1795_0092:3:1:8148:2024#0/1
hfhhhhhfhfhhhhfhhhhhhhhhhhhhffhfe
@HWUSI-EAS1795_0092:3:1:8179:2025#0/1
GGCGTTTCATGTGGTTGTTGTTTTAGCTAAGTG
+HWUSI-EAS1795_0092:3:1:8179:2025#0/1
ggggggggggggggggeggaggggggggggdgg
@HWUSI-EAS1795_0092:3:1:8356:2028#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8356:2028#0/1
fgggggggggggfffffggggggggggBBBBBB
@HWUSI-EAS1795_0092:3:1:8443:2027#0/1
ATCCCGATGAGGCTGTGGCCTACGGTGCTGCCG
+HWUSI-EAS1795_0092:3:1:8443:2027#0/1
hhhghhfhhhghhhhhfhhhhghehgghghhhh
@HWUSI-EAS1795_0092:3:1:8965:2032#0/1
GGCCCTTGTCCGTGCACTCGAAAGACTCTGAAA
+HWUSI-EAS1795_0092:3:1:8965:2032#0/1
gfgagggagggggggggdfdffggggggggdff
@HWUSI-EAS1795_0092:3:1:9959:2028#0/1
GCTGTTGCTGGTATTATTGAGTGGTGTTGTTGG
+HWUSI-EAS1795_0092:3:1:9959:2028#0/1
ggfcgf]fffffffffcecaeaffcffafffcg
@HWUSI-EAS1795_0092:3:1:10438:2028#0/1
GTTTAAATGAGGGGAATTGATGGATAGTGTTGG
+HWUSI-EAS1795_0092:3:1:10438:2028#0/1
gggggggggggggggcgggggcfffffgfgdgg
@HWUSI-EAS1795_0092:3:1:10528:2023#0/1
CAGGGGTTCATCGCAAAGCGGACATATCTTGTC
+HWUSI-EAS1795_0092:3:1:10528:2023#0/1
hhhhhhhfhhhhhhhhhghhhhfhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12203:2024#0/1
CTGAAACCAGGTACAAGATACCACTTGCTAAGA
+HWUSI-EAS1795_0092:3:1:12203:2024#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhfhffh
@HWUSI-EAS1795_0092:3:1:12470:2033#0/1
CACAGTTATCCAAGTAACTGTTAACGATCTAAG
+HWUSI-EAS1795_0092:3:1:12470:2033#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:12813:2024#0/1
GGGTGCGGATGGTAGCGGTTGTACCGGACATTT
+HWUSI-EAS1795_0092:3:1:12813:2024#0/1
gggggggggfggggggggggdgdffffgfgggg
@HWUSI-EAS1795_0092:3:1:12961:2029#0/1
GCTCGATGCAGCCCAGCATCTCCTGGATGGTCT
+HWUSI-EAS1795_0092:3:1:12961:2029#0/1
hhhhhhhhhhhhhhghhhghhhhhfghehhghe
@HWUSI-EAS1795_0092:3:1:13085:2025#0/1
CGAGAGGACAACGAGAAGATCGAGAGGCTGGAG
+HWUSI-EAS1795_0092:3:1:13085:2025#0/1
hhhhhhhhhhhhhhehhgfhhhghghhgghhaf
@HWUSI-EAS1795_0092:3:1:13266:2030#0/1
TTCGGTACAGATAAATACAATTTAAATGCTTTG
+HWUSI-EAS1795_0092:3:1:13266:2030#0/1
hhhhhhhhhhhhhhhhhhghfhhhhgfhhhhgc
@HWUSI-EAS1795_0092:3:1:13484:2025#0/1
TTTTTGTCAAATTCGATCGACATTCCTGCCTCT
+HWUSI-EAS1795_0092:3:1:13484:2025#0/1
hhhhhhhhhhhhhghhhhghfhfhhhhfhhhgh
@HWUSI-EAS1795_0092:3:1:13680:2033#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13680:2033#0/1
gggcggggggef_ffffgggggggggggggged
@HWUSI-EAS1795_0092:3:1:14003:2030#0/1
GGGTGGTGTGCATTCTGGGAAGTGTTAACTGAT
+HWUSI-EAS1795_0092:3:1:14003:2030#0/1
fhhhhhhhhehfhhhhhhhfhhhhhehhhgghh
@HWUSI-EAS1795_0092:3:1:14058:2026#0/1
TTTTTCCACGACTCAACCTAGCGATTTTCCAAG
+HWUSI-EAS1795_0092:3:1:14058:2026#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhgghhhh
@HWUSI-EAS1795_0092:3:1:14092:2027#0/1
CAACAGGCAGAAGGACATCATCGATGGCAAGTA
+HWUSI-EAS1795_0092:3:1:14092:2027#0/1
hhhhghhhhhhhhhhhhhhhfhhhhhhhhfchh
@HWUSI-EAS1795_0092:3:1:14249:2029#0/1
CCCCATTAAAATTTACGAAGACAATCAAGGCTG
+HWUSI-EAS1795_0092:3:1:14249:2029#0/1
hhhhhhhhhhhhhghhhggfhhhhhhhghhhah
@HWUSI-EAS1795_0092:3:1:14409:2033#0/1
CAAGACTTACATAAACTTAAAAAGTTAGACTTA
+HWUSI-EAS1795_0092:3:1:14409:2033#0/1
ggggggggggggdffffggggeggggggcgggg
@HWUSI-EAS1795_0092:3:1:14759:2028#0/1
GAGCAGAGTAATTTTGTTTAGTTTTCGGATTGA
+HWUSI-EAS1795_0092:3:1:14759:2028#0/1
hhhhhhgghhhhhhhdhhhhdhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15787:2029#0/1
TGGCACCACACCTTCTACAATGAGCTGCGTGTG
+HWUSI-EAS1795_0092:3:1:15787:2029#0/1
hhhhhhhhhhhhhhghhggghghhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16176:2026#0/1
CCCATACCTACCTTTTTTGTAAACAAGTGAACA
+HWUSI-EAS1795_0092:3:1:16176:2026#0/1
hhhgfahhhhfhhfhhhhgg_chhhchhchhhf
@HWUSI-EAS1795_0092:3:1:16316:2028#0/1
GCGTTGGCCAGCTTGCACAGGATGACGCCATCC
+HWUSI-EAS1795_0092:3:1:16316:2028#0/1
fYeddddggdggfW]afcacfdX]a]`aabbbf
@HWUSI-EAS1795_0092:3:1:16490:2024#0/1
TTCCTCCTCCTCCCCTCTGCCTCTGGATTTTCC
+HWUSI-EAS1795_0092:3:1:16490:2024#0/1
agfffcedggfeggg]ccffffgfcgggegggg
@HWUSI-EAS1795_0092:3:1:16826:2033#0/1
TGAGCACTCGGATTTCTGTGAGTATGAGATCCT
+HWUSI-EAS1795_0092:3:1:16826:2033#0/1
gdgggfgggggggggegcffdffggcggagggg
@HWUSI-EAS1795_0092:3:1:17283:2034#0/1
CGTCCAACCATTCATTCCAGCCTTCAATTAAAA
+HWUSI-EAS1795_0092:3:1:17283:2034#0/1
ggggggggfWgggggggggggggggggggggfg
@HWUSI-EAS1795_0092:3:1:17370:2026#0/1
CGGCGATTTTGAGGGCGAACTCGTAGGCGGAGC
+HWUSI-EAS1795_0092:3:1:17370:2026#0/1
c]^SaYaUX[YPa_aaaf[f^fWT__BBBBBBB
@HWUSI-EAS1795_0092:3:1:17603:2033#0/1
AAATCAGTGGCAAGAGTTTTACCACCTTTGATG
+HWUSI-EAS1795_0092:3:1:17603:2033#0/1
dggggggf_aaccafffaf[fffca]aff[]fa
@HWUSI-EAS1795_0092:3:1:17684:2023#0/1
AGGTGCTCCAGAAGAAGTTCGACGACTTCAACG
+HWUSI-EAS1795_0092:3:1:17684:2023#0/1
ghgghhhghhfhhghhghhhhghhfghchhghh
@HWUSI-EAS1795_0092:3:1:17970:2031#0/1
ATTGAATCCAGCAAGATGCGCACTGAGCTTGAG
+HWUSI-EAS1795_0092:3:1:17970:2031#0/1
ggggggggggggggffgggggggggggggdfgg
@HWUSI-EAS1795_0092:3:1:18226:2025#0/1
CTCGCCAGTAAGCAGCCAGCACGGTCTGCTCCG
+HWUSI-EAS1795_0092:3:1:18226:2025#0/1
ffeffffd]da]\aaa^ccYcc``]a`\ccccf
@HWUSI-EAS1795_0092:3:1:18926:2027#0/1
GAACCTTCAAGTCTTCACGCAGATCTCCGCTCT
+HWUSI-EAS1795_0092:3:1:18926:2027#0/1
fggggggggggffgggggggfgggggggggggg
@HWUSI-EAS1795_0092:3:1:19539:2023#0/1
CTGGGAATACTCGTTGGCTACGACCTTGTAGCC
+HWUSI-EAS1795_0092:3:1:19539:2023#0/1
_QZZZ`Zaa^aaa^addd[]^dfccf`^^d]df
@HWUSI-EAS1795_0092:3:1:1190:2044#0/1
TTTCGCCCAGGAAAACTGCTCACTTTTTGCTAA
+HWUSI-EAS1795_0092:3:1:1190:2044#0/1
ffafdafggecgfdcffffffcffcffgf]gef
@HWUSI-EAS1795_0092:3:1:1819:2041#0/1
GCGGATTGCAGGGACCACCAGGTGCAAGCGGAT
+HWUSI-EAS1795_0092:3:1:1819:2041#0/1
f_fcWff_cddcdRafffcffffdcffc[cacf
@HWUSI-EAS1795_0092:3:1:2591:2042#0/1
GTGTAAGCCAGGTTGGTTTCTATCTTTAAAAAA
+HWUSI-EAS1795_0092:3:1:2591:2042#0/1
Z_]^ba^cffc]fffaffffcacfffffffffc
@HWUSI-EAS1795_0092:3:1:2738:2042#0/1
CTGGGAGCTCACTGCTGGACTGCGGCCCGTAGC
+HWUSI-EAS1795_0092:3:1:2738:2042#0/1
ggggfggegggggeggcggggeggggfggdggf
@HWUSI-EAS1795_0092:3:1:3376:2044#0/1
CCAAAACAACAGCAAAACAAACCCCCTAAGCAT
+HWUSI-EAS1795_0092:3:1:3376:2044#0/1
c]ffff[cccfffadfc[____ffcf]dbb]bf
@HWUSI-EAS1795_0092:3:1:3437:2039#0/1
CTATTCTAGAGATAGCTAGTCCACTGCCAGGTA
+HWUSI-EAS1795_0092:3:1:3437:2039#0/1
hhhhhhhhghhhhhhhhhehhhhhhhhhhhhch
@HWUSI-EAS1795_0092:3:1:3872:2039#0/1
CGCTGCTCCAGCCGCCGAGTCCAAGAAGGAGGA
+HWUSI-EAS1795_0092:3:1:3872:2039#0/1
hhhhhfhhhghhhgghfghghhghhgghechhe
@HWUSI-EAS1795_0092:3:1:4214:2035#0/1
CAGACTCCAAGCGAATTAACGCGCACATCCACA
+HWUSI-EAS1795_0092:3:1:4214:2035#0/1
cJccR_X\a^^acaca_XWU\Pc]]]VQTZNOa
@HWUSI-EAS1795_0092:3:1:4439:2045#0/1
CGATGATCTCGGCAAGAAGAGCATCGAGAATGA
+HWUSI-EAS1795_0092:3:1:4439:2045#0/1
hhhhhghhhgghhghedhhcghhhhhgehhhhf
@HWUSI-EAS1795_0092:3:1:4459:2043#0/1
GCAGCAGCAGCAGCAGGCCGGTAGTGCGGCCCC
+HWUSI-EAS1795_0092:3:1:4459:2043#0/1
`]c^_c^dcd``ZT``a`a`d`aaZaI^BBBBB
@HWUSI-EAS1795_0092:3:1:4491:2039#0/1
GCGCGACTCGCCTGCCGAATACTCTGAGCCCGT
+HWUSI-EAS1795_0092:3:1:4491:2039#0/1
ggggfgggggcdgggcgdf_ffeegfafffac`
@HWUSI-EAS1795_0092:3:1:4536:2039#0/1
TGGTTGACGACGCAGTTTTAAAATTGATGATAC
+HWUSI-EAS1795_0092:3:1:4536:2039#0/1
f\`c`dcUZZPZ\^[^affffffadcfffffaf
@HWUSI-EAS1795_0092:3:1:4772:2044#0/1
GTTTAACTCTTAAAGGCTTATAAAAAATCCACG
+HWUSI-EAS1795_0092:3:1:4772:2044#0/1
hhhhhhhhhfhhhhhhhhhghhhghhhhgdhhh
@HWUSI-EAS1795_0092:3:1:5044:2045#0/1
CAACAACAACAAGATCAACTGGCCACTGGAGGA
+HWUSI-EAS1795_0092:3:1:5044:2045#0/1
hhhhhhhghhhhhfhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:5807:2036#0/1
CCACAGAAGGCTTGATGAACAAGGGCGTGGTGC
+HWUSI-EAS1795_0092:3:1:5807:2036#0/1
hhhhhhhhhhhhhhfhgfhhhghhhhhhhhggf
@HWUSI-EAS1795_0092:3:1:6210:2046#0/1
ATAAAGAATTCGGCAAAAATAATATTCGCCTGT
+HWUSI-EAS1795_0092:3:1:6210:2046#0/1
hhghhhdhhhhhhhhhhhghhhghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:6671:2046#0/1
CGGCAGCAGGCGTGGAGGCAGCCTTCTTGGCCG
+HWUSI-EAS1795_0092:3:1:6671:2046#0/1
fcfcfffgggagf]f_cadedafff]cgggfeX
@HWUSI-EAS1795_0092:3:1:6920:2035#0/1
TTCTATAGTTTTATTTCTTCAAAAAAAGAATGT
+HWUSI-EAS1795_0092:3:1:6920:2035#0/1
ggggggfgggggagggggggggggggggfgggg
@HWUSI-EAS1795_0092:3:1:8070:2042#0/1
TGCACACCAAGGGGGAGCACGAAGATTACATCC
+HWUSI-EAS1795_0092:3:1:8070:2042#0/1
gggdggfggdgdWcfcfffWcff[fffdcfff[
@HWUSI-EAS1795_0092:3:1:8658:2036#0/1
CGGTCAGATCGGCCTTGCCAATGGACTGAATGT
+HWUSI-EAS1795_0092:3:1:8658:2036#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:8999:2035#0/1
TCTTCGCCCCTGCTAACATCACCACTGAGGTCA
+HWUSI-EAS1795_0092:3:1:8999:2035#0/1
hhhhhhhhhhhhhhhhghhhhghhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9040:2036#0/1
GGAAGTGCACGTTGGTGCGGATCTTGCGGGCAC
+HWUSI-EAS1795_0092:3:1:9040:2036#0/1
ggggggfgffggfdfaffffafggggggggggg
@HWUSI-EAS1795_0092:3:1:9442:2040#0/1
GAAGCGTCCCTTCACGTCGTAGACCAGACGGAA
+HWUSI-EAS1795_0092:3:1:9442:2040#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:9483:2041#0/1
GTCAGTACGGGATAGCACAGTGGGTGAGCAGGT
+HWUSI-EAS1795_0092:3:1:9483:2041#0/1
hhhhhhhhhhhghghhhhhhghhhehhhhhhhg
@HWUSI-EAS1795_0092:3:1:9978:2043#0/1
CCCTACGCCGCTATGTTGGCCGCTCAGGATGTG
+HWUSI-EAS1795_0092:3:1:9978:2043#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:10095:2040#0/1
GCCGCTTGCATGTCAAAGTTTATCGACTTCTGA
+HWUSI-EAS1795_0092:3:1:10095:2040#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:10914:2035#0/1
CCCAAGCATGAAAGTGGTTCAGCGGTTTACCCG
+HWUSI-EAS1795_0092:3:1:10914:2035#0/1
hhhhhhhhhghhhcgfhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11879:2042#0/1
CCGTGATGATGAAGCATGGCTATATCGGCGAAT
+HWUSI-EAS1795_0092:3:1:11879:2042#0/1
hhhhhfhhghhghhhhhhhhhgfhhghhhghhh
@HWUSI-EAS1795_0092:3:1:12237:2042#0/1
CCGGTGCACTTATCCTTCTTCCATTTCTCGTCA
+HWUSI-EAS1795_0092:3:1:12237:2042#0/1
fggggggggggggggcggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:12313:2038#0/1
GGCGAATGTAAACTAGATTTGGGACATGGGTGT
+HWUSI-EAS1795_0092:3:1:12313:2038#0/1
hhfhhhghhghhhhhghfhdgggghfhhhhchc
@HWUSI-EAS1795_0092:3:1:12334:2044#0/1
ATGTGGTGTCCACCACTGAGCTGCCGGAGATCA
+HWUSI-EAS1795_0092:3:1:12334:2044#0/1
ggfdafffffffgggggdggegggggeffffff
@HWUSI-EAS1795_0092:3:1:12834:2042#0/1
AAGTAATCATCTCTGCCCAGCCCAGCTCCGCTC
+HWUSI-EAS1795_0092:3:1:12834:2042#0/1
afffffffcffff\dfffd^ffffeeffa\dcf
@HWUSI-EAS1795_0092:3:1:12926:2035#0/1
CCAGTTTCAAGCCAGCAACGGACTGTATTATAT
+HWUSI-EAS1795_0092:3:1:12926:2035#0/1
gaffadfdffffggagggdggdaadfcggggfg
@HWUSI-EAS1795_0092:3:1:13033:2037#0/1
CGTATGTGGCCAGCGGGAAGACATGATCGGCGG
+HWUSI-EAS1795_0092:3:1:13033:2037#0/1
gggggggggggggggggggcgdggggggggggg
@HWUSI-EAS1795_0092:3:1:13386:2038#0/1
TCTGCTGTTTCACTTTCCCTACTCTCATTCGGG
+HWUSI-EAS1795_0092:3:1:13386:2038#0/1
hhhcghhhhhhhhhhhhhhgfghghhhhfhhhg
@HWUSI-EAS1795_0092:3:1:13476:2042#0/1
GGGGATTGCTGCGGCGACATCCGGTAGCTGTTG
+HWUSI-EAS1795_0092:3:1:13476:2042#0/1
gdffc_ggc_dffafcdfdWd]aaW^^_dddd_
@HWUSI-EAS1795_0092:3:1:13859:2040#0/1
GGGTGCTGCTGTTGTGGTGATCGACTGCTATGG
+HWUSI-EAS1795_0092:3:1:13859:2040#0/1
hhhghhhhhhhhhghhhhgghhhhfhhghhdhf
@HWUSI-EAS1795_0092:3:1:14041:2044#0/1
ATTGACCGCGGAGTACTGAAGGACTTTCTGGAG
+HWUSI-EAS1795_0092:3:1:14041:2044#0/1
hhhhfhhhghhhhghhhhdhhhhhhhhhhhgeh
@HWUSI-EAS1795_0092:3:1:14071:2039#0/1
CACCGACTGGGTGTCGTGCGTGCGCTTCTCGCC
+HWUSI-EAS1795_0092:3:1:14071:2039#0/1
fffffffbWdd]ddd[W^a^^^`bdbd]db^df
@HWUSI-EAS1795_0092:3:1:14177:2036#0/1
CACAGTCAATGATGTCCCCGAAGCGGCAGAAGT
+HWUSI-EAS1795_0092:3:1:14177:2036#0/1
hhhghhhhhhhchhhhhhhhhhhghhhghhhab
@HWUSI-EAS1795_0092:3:1:14533:2040#0/1
CATCTGGCCAATGTGCATCAGTTGTGGTCAGCA
+HWUSI-EAS1795_0092:3:1:14533:2040#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhgfhh
@HWUSI-EAS1795_0092:3:1:14655:2036#0/1
GCCGTTCTCCTTTAGCCATGCGCGACTCCAGAT
+HWUSI-EAS1795_0092:3:1:14655:2036#0/1
hfhhhhhhhhhhhhhhhhhgfghhhhfhhhhgg
@HWUSI-EAS1795_0092:3:1:14973:2041#0/1
GGAAGCCTCTCCCGATCCAGAGAGCTACCGTTC
+HWUSI-EAS1795_0092:3:1:14973:2041#0/1
fgggfcffg_gggggcggdeggacfffggcgag
@HWUSI-EAS1795_0092:3:1:14993:2036#0/1
CGCCGGATGGCTTCTCCTTTTTCTCCTTCTTCA
+HWUSI-EAS1795_0092:3:1:14993:2036#0/1
hhhhhhhhhhhfhhhhhhhhhhchegghghhhf
@HWUSI-EAS1795_0092:3:1:15043:2043#0/1
GAAGCACGGATCCTTGTTGAATTACTTGCGACG
+HWUSI-EAS1795_0092:3:1:15043:2043#0/1
hhhhhhhhhhhhghhghhhchhghfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15334:2045#0/1
CGAGAAGCGAGATGTCCTTTTTGATGAGTCTGG
+HWUSI-EAS1795_0092:3:1:15334:2045#0/1
hhhhghhhhfgghgghhhhhhhdhhfghhghhh
@HWUSI-EAS1795_0092:3:1:16436:2045#0/1
GCAGAGTATCCAGGAAAGCGTTTCACAGAGTGA
+HWUSI-EAS1795_0092:3:1:16436:2045#0/1
hhhhhhhhhhhhhhhgghgdhhhhhhghhfghh
@HWUSI-EAS1795_0092:3:1:16701:2041#0/1
TGTGTATACATTTCACATTTAAGCCTAGAGAAC
+HWUSI-EAS1795_0092:3:1:16701:2041#0/1
hhhhhhhgfhhhhfffchhhhffhfghhhhhfg
@HWUSI-EAS1795_0092:3:1:17201:2037#0/1
GTAAGCGCTAGGCCGAAATACAAAATTAATTAC
+HWUSI-EAS1795_0092:3:1:17201:2037#0/1
fffffffffff_facffZTZM_bbZ^ZaYaUYP
@HWUSI-EAS1795_0092:3:1:17558:2036#0/1
GTTCGCTGGTATATCGGCTGGGGCAGGGTTTGG
+HWUSI-EAS1795_0092:3:1:17558:2036#0/1
ggggcgggggfggagggffffBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18130:2040#0/1
GAAACTTTGTACATTTGCATTGAGCCTGACGCG
+HWUSI-EAS1795_0092:3:1:18130:2040#0/1
hhhhhhhhghhfhhghghhhhfhhhhfhhghhh
@HWUSI-EAS1795_0092:3:1:18256:2038#0/1
CCAACTCGTACGCCATCAAGAAGAAGGATGAGT
+HWUSI-EAS1795_0092:3:1:18256:2038#0/1
hhhhhhhhhhhhhhhhhhhghhfhhhhhgehhf
@HWUSI-EAS1795_0092:3:1:18685:2044#0/1
CTCGTTTATGACATGAGGGGTTGTTTGCTATGC
+HWUSI-EAS1795_0092:3:1:18685:2044#0/1
hhhhhhhhfhghhhfhhhhhghdhhhhhhhhdh
@HWUSI-EAS1795_0092:3:1:18794:2038#0/1
CTGGTCAAAGGGGGTGTTCCCAATGAAGAACAT
+HWUSI-EAS1795_0092:3:1:18794:2038#0/1
ccaccca_c^aYZ_SXYcccaYaababa_ccaO
@HWUSI-EAS1795_0092:3:1:18860:2042#0/1
AATACAGCCGTTTCGAGAAGCGTCACCGCAACA
+HWUSI-EAS1795_0092:3:1:18860:2042#0/1
hhhhhhhhhhhhhhhgghhdhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18926:2045#0/1
AACAAGAAGTACAAGCCCCTGGATCTGCGCAAG
+HWUSI-EAS1795_0092:3:1:18926:2045#0/1
gggggggffeffgggggggfgggggggggggdd
@HWUSI-EAS1795_0092:3:1:19197:2041#0/1
GGTGTCGTCTCACTGGGTGGCTGTGTTCAAATT
+HWUSI-EAS1795_0092:3:1:19197:2041#0/1
ZYW__X_adacddccdc`c``dYaaacdaaccf
@HWUSI-EAS1795_0092:3:1:19244:2043#0/1
GGGGAAGTGGATGAGGAGTGGATGCATAAATGC
+HWUSI-EAS1795_0092:3:1:19244:2043#0/1
cdYdddd]dd[d`]baSaa\aaffdff]_faf\
@HWUSI-EAS1795_0092:3:1:19446:2035#0/1
CTTAAACAGAGTCTGGACTGGAGCCCTTGAATC
+HWUSI-EAS1795_0092:3:1:19446:2035#0/1
fff[ffffa[bbffffdadddcffdaf_ccfcb
@HWUSI-EAS1795_0092:3:1:1358:2052#0/1
AGTTCCGAAGGCGTCGCGAAGGAAAGACCGATT
+HWUSI-EAS1795_0092:3:1:1358:2052#0/1
fdfc^ddffdfdcffcffcdcc\ffdcfYdfad
@HWUSI-EAS1795_0092:3:1:1910:2055#0/1
TGATCCTCAACGAGGTTCTAGGCTCCGCGTAGA
+HWUSI-EAS1795_0092:3:1:1910:2055#0/1
YVLLSSJWOH_K^ZLcO^^^SN\_O_BBBBBBB
@HWUSI-EAS1795_0092:3:1:1957:2056#0/1
CTAAAATATATATACAGCGATCAACTGAAGAGT
+HWUSI-EAS1795_0092:3:1:1957:2056#0/1
Z\Z\__\_Zceef\cacfdffcdfdffc\f\cf
@HWUSI-EAS1795_0092:3:1:2015:2047#0/1
GCTTCATCCGATAAGCCAACTCTGCTCTGCGTA
+HWUSI-EAS1795_0092:3:1:2015:2047#0/1
fhhhhfhhhghghhhhhfhhghegfhhhhhhgh
@HWUSI-EAS1795_0092:3:1:2085:2048#0/1
TCAGTGGTGGCCAGCATAGCCGGAATGTTGTGG
+HWUSI-EAS1795_0092:3:1:2085:2048#0/1
ffgggcg]fffdffff]fffffff]cffffffg
@HWUSI-EAS1795_0092:3:1:2847:2053#0/1
CAGACCTCCGCCGTTTCTTTTTTTTTCTGCGTT
+HWUSI-EAS1795_0092:3:1:2847:2053#0/1
ff_fafdfeffaffaf[fcfcfffffVWQ^Y^f
@HWUSI-EAS1795_0092:3:1:3220:2053#0/1
TGATGGTGTGCAGGTGGTTCCGCTCTTTTCATC
+HWUSI-EAS1795_0092:3:1:3220:2053#0/1
hhhhhhhhhhhghhchhhhhhghhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:3577:2048#0/1
GGGTCAGGGAGCCAAGAAGAGCTTCAAGAAGTA
+HWUSI-EAS1795_0092:3:1:3577:2048#0/1
cgggg_gggggfggeggadfffgggggggcggf
@HWUSI-EAS1795_0092:3:1:3646:2051#0/1
ATCGTAACACGAAGGCAATGTGATCAGTAGATG
+HWUSI-EAS1795_0092:3:1:3646:2051#0/1
cfcffccfffc]fc]f_fffdcWaacc]fdf_f
@HWUSI-EAS1795_0092:3:1:3783:2056#0/1
GAAAAAGGGAAATTTGAGTAAGGCGAAGAAAGC
+HWUSI-EAS1795_0092:3:1:3783:2056#0/1
hhhhhfhhhhhhhhhghhhhghhhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:4037:2049#0/1
AGGAACGCAGTGGCGGCGTGCGGATGCGGCGGG
+HWUSI-EAS1795_0092:3:1:4037:2049#0/1
ggggggggggggggggecd_adecbeead_bdb
@HWUSI-EAS1795_0092:3:1:4090:2047#0/1
GGGCAAGAAGTAGCTGGTTTGCTTCCACTCAAC
+HWUSI-EAS1795_0092:3:1:4090:2047#0/1
ggggggggggfggffggggggfggggggggggg
@HWUSI-EAS1795_0092:3:1:4471:2057#0/1
CGGCGTTATGTTCATGGTCTTCTGCAGGTTTGT
+HWUSI-EAS1795_0092:3:1:4471:2057#0/1
\cZ]`b]ZKZYWVVZ`aZZTZZ^aa]daaaa^B
@HWUSI-EAS1795_0092:3:1:4882:2049#0/1
GAGTGTGCGAGGTGAACGAGATGCGGCCCTGTG
+HWUSI-EAS1795_0092:3:1:4882:2049#0/1
gfgggggffffffdfffggggaggggcffafff
@HWUSI-EAS1795_0092:3:1:5537:2049#0/1
CTGGAACTTCTTTCGATGGCGTTTTCGTACAAC
+HWUSI-EAS1795_0092:3:1:5537:2049#0/1
fhhhdhhhhhfhhhheghhfghfhhfghhgfhg
@HWUSI-EAS1795_0092:3:1:6775:2049#0/1
CCAACAGCAGCAGTACGGAAACGGACAGCAGCC
+HWUSI-EAS1795_0092:3:1:6775:2049#0/1
_ffc_f]]ffffbbcc[NN\\\b^dd]dfffa[
@HWUSI-EAS1795_0092:3:1:6796:2053#0/1
TTTAGCCAGCGTATCGATTTGCATTTGTGCGAC
+HWUSI-EAS1795_0092:3:1:6796:2053#0/1
hhhhhhhhhhggghhhhhhhhhhhhhghhhghg
@HWUSI-EAS1795_0092:3:1:6958:2051#0/1
CGCTGCTGCTGTTGCTGGTATTATTGAGTGGTG
+HWUSI-EAS1795_0092:3:1:6958:2051#0/1
gggggfgggfcggfggfffffffffcfffffce
@HWUSI-EAS1795_0092:3:1:7247:2047#0/1
CAAGAAGCAGAACGTCGAGCTGGCCAAGTCGCA
+HWUSI-EAS1795_0092:3:1:7247:2047#0/1
hhhhhhhfhffhhhhffahhffhhhhhhhghhf
@HWUSI-EAS1795_0092:3:1:7424:2049#0/1
ATTTACATATTACCCTTTGCTCTGTCGTGTTGT
+HWUSI-EAS1795_0092:3:1:7424:2049#0/1
d[cdf]fffaffffdfffWffdf_cffcffff`
@HWUSI-EAS1795_0092:3:1:7533:2050#0/1
GTAACCGGTGGCCTACATCTCATAAATCCCTCA
+HWUSI-EAS1795_0092:3:1:7533:2050#0/1
fddfcffaggefgcgcgaffcfaffffgggggg
@HWUSI-EAS1795_0092:3:1:8087:2048#0/1
CGCCGGCGGAGAGGAAATCAATAAGACGTCCGG
+HWUSI-EAS1795_0092:3:1:8087:2048#0/1
hhhhhfhghggfhgghhahghhhhhhahhhhgh
@HWUSI-EAS1795_0092:3:1:8209:2054#0/1
CTGGGGCAGCATCCTTAACTACAACTACTAAAG
+HWUSI-EAS1795_0092:3:1:8209:2054#0/1
gggggdgggggggggggggggggggggeggegg
@HWUSI-EAS1795_0092:3:1:8809:2055#0/1
GGCGAATTAGGTGTGTATTTTCATTTGTTTATA
+HWUSI-EAS1795_0092:3:1:8809:2055#0/1
hhhhhhhhhhhh_ffffhhhhhehggfhhgggf
@HWUSI-EAS1795_0092:3:1:9139:2053#0/1
GGAATATCAGGTTATCCTGAAGAAGGTCGACAT
+HWUSI-EAS1795_0092:3:1:9139:2053#0/1
ggggagedffd_fffffggg_adb^Rbgdcgfg
@HWUSI-EAS1795_0092:3:1:9194:2050#0/1
CTATTATGGCGTCTTTATTATTTGTATTTATAA
+HWUSI-EAS1795_0092:3:1:9194:2050#0/1
hhghhhhhhhghhghhghhfhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9267:2048#0/1
CGGCCACGCTCTTGAGTGTCTCAAACCGGGTGC
+HWUSI-EAS1795_0092:3:1:9267:2048#0/1
hhhhhhhhhdhhhhhfghhhghhfhhhhhhchh
@HWUSI-EAS1795_0092:3:1:9307:2052#0/1
GTTTGATGGCACATGTAAACTAAGTGTATGAGG
+HWUSI-EAS1795_0092:3:1:9307:2052#0/1
hgfhhhhhghhhhfhhhhhhhfghhhghchhhh
@HWUSI-EAS1795_0092:3:1:9679:2050#0/1
GGCATCTGGGTGAGCTTCGAGGATCCCGATACT
+HWUSI-EAS1795_0092:3:1:9679:2050#0/1
g_gfggggggggggfggdgagffafffdffcfa
@HWUSI-EAS1795_0092:3:1:10029:2053#0/1
AGGCCTCCTACCCGACCAAGACGTTCGTGAAGA
+HWUSI-EAS1795_0092:3:1:10029:2053#0/1
hhhhhhhhhhhhhhhhhhhfhfhhhhhhhhfch
@HWUSI-EAS1795_0092:3:1:10083:2058#0/1
AAGCTATCGACACCACTAGCTTGGCGCCCCTTG
+HWUSI-EAS1795_0092:3:1:10083:2058#0/1
hehhghhhhhfhhhffghdaghghhfhhegbeh
@HWUSI-EAS1795_0092:3:1:10234:2053#0/1
GAGGAGTTCAACGTCGAGCCTGTTGATGACGGC
+HWUSI-EAS1795_0092:3:1:10234:2053#0/1
hhhhhhhhhhhhghhhfhhhhhgfhhfhhghfh
@HWUSI-EAS1795_0092:3:1:11377:2053#0/1
TGGACAGCGTGATCTGGACCGTATTGCTAACCA
+HWUSI-EAS1795_0092:3:1:11377:2053#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhghhhhfh
@HWUSI-EAS1795_0092:3:1:12387:2056#0/1
GTGAGCAGCTGCATCTGTGGTGCCCGTTATAAG
+HWUSI-EAS1795_0092:3:1:12387:2056#0/1
ggfacaffccdffdf]ffafcfggcgd_[ffcg
@HWUSI-EAS1795_0092:3:1:13166:2046#0/1
TAACAATGTACGGATCCGCGTGAACCTCCTCCA
+HWUSI-EAS1795_0092:3:1:13166:2046#0/1
hhhhhhhghhhhhhghhhhhhghhhghhhhhgh
@HWUSI-EAS1795_0092:3:1:14689:2054#0/1
GACGAATTGTACAAAACGCTAGTGTGTTGTTTG
+HWUSI-EAS1795_0092:3:1:14689:2054#0/1
gggffgggfeagf_fc`cffcfY\[\\gggg``
@HWUSI-EAS1795_0092:3:1:14899:2054#0/1
CTTCGAGGGCGATGACTTCTCCGAGACCCTGAC
+HWUSI-EAS1795_0092:3:1:14899:2054#0/1
ggdcafafdaf_df^f\afcffcdfdd_f[f[f
@HWUSI-EAS1795_0092:3:1:15100:2057#0/1
GCTGGACTCCCCATCCGGAAGAGGGGTACGGCG
+HWUSI-EAS1795_0092:3:1:15100:2057#0/1
fcd_a\ffccffgggggc]facfcc`edfddc]
@HWUSI-EAS1795_0092:3:1:15252:2047#0/1
GCCAGCGTGAGCTCGTACCGCTACAGCGGCATC
+HWUSI-EAS1795_0092:3:1:15252:2047#0/1
ggfggfcf_fddggfggggggdgfgg_gdfggg
@HWUSI-EAS1795_0092:3:1:15519:2052#0/1
CGTCACTGGATCTTCGGTTCTAGGGACACTTTG
+HWUSI-EAS1795_0092:3:1:15519:2052#0/1
hhhhhhhhhhhhhhhhhhhdhhhgfhhhfhhhh
@HWUSI-EAS1795_0092:3:1:15550:2057#0/1
GCTGGATCTTCTCGACGTAGACGACGAACTTCT
+HWUSI-EAS1795_0092:3:1:15550:2057#0/1
hhhhhhhhhhhhhhfhhafdffghchhhghhhh
@HWUSI-EAS1795_0092:3:1:15718:2049#0/1
GCCAGGTAGGGAGTTTGACTGGGGCGGTACATC
+HWUSI-EAS1795_0092:3:1:15718:2049#0/1
gfggggdfccfbfffffggd_gf]dcc\caccg
@HWUSI-EAS1795_0092:3:1:15779:2055#0/1
CGGCAATCGGGCCATGCTCTGGGCGGTATTTCA
+HWUSI-EAS1795_0092:3:1:15779:2055#0/1
gggggggcgggggfegfeggegffffbgggggc
@HWUSI-EAS1795_0092:3:1:15898:2053#0/1
AATACAACTCAATCAAGATGCCTTGCCCATGCG
+HWUSI-EAS1795_0092:3:1:15898:2053#0/1
hhghhghhfhhhhhhhhgfaghhfhhhfgdhhh
@HWUSI-EAS1795_0092:3:1:15941:2055#0/1
GTTTAATGAAATATTTGCACCGCGTCTTATCCT
+HWUSI-EAS1795_0092:3:1:15941:2055#0/1
ggfhhchfhhhdhghghhhhghhhhhhgfgghh
@HWUSI-EAS1795_0092:3:1:16163:2050#0/1
ATCAGGCTTATAAATACCTTGGTATTACCCTCG
+HWUSI-EAS1795_0092:3:1:16163:2050#0/1
fhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16657:2052#0/1
GTTCGATCTCCTCACACTTGCTGGCCAATGCTA
+HWUSI-EAS1795_0092:3:1:16657:2052#0/1
hhhhhhhhhhhhhfhhhhhhhhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:16794:2051#0/1
GGGAGTTAGAAGTTTGGAAAAGTACTGGGCAAG
+HWUSI-EAS1795_0092:3:1:16794:2051#0/1
hhhehhhhhhhhhhhhhhhhhhhhhhhhfehgh
@HWUSI-EAS1795_0092:3:1:17496:2055#0/1
AAATTTTAAGTCTGTTCGACTTTTAAATTCTTA
+HWUSI-EAS1795_0092:3:1:17496:2055#0/1
cacccaccacccR^^`\SS^Z^cacacccac_W
@HWUSI-EAS1795_0092:3:1:17648:2057#0/1
GATCTTTTGGACACAACGGTCTCTGCTCGGAAG
+HWUSI-EAS1795_0092:3:1:17648:2057#0/1
ffcffdfc`ffcfcffffdaf[eadd^fdffcf
@HWUSI-EAS1795_0092:3:1:18884:2049#0/1
GTCGAAAAGCCTATCAGGCGCACCAGAGGATCT
+HWUSI-EAS1795_0092:3:1:18884:2049#0/1
hhhhhhhhhfhhhhghfhhhhhhhhhfhhg]hf
@HWUSI-EAS1795_0092:3:1:19398:2056#0/1
CATTTCGAAAAATGGGTTAATGGTTGTCAAAAA
+HWUSI-EAS1795_0092:3:1:19398:2056#0/1
hhhhhhhhhhhghhhghhghhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19590:2057#0/1
CCACTGACCAGCTCGTTGGCTGTTCTCAGCAGC
+HWUSI-EAS1795_0092:3:1:19590:2057#0/1
ffffffcfffffaffef``d[bccccfgggbgd
@HWUSI-EAS1795_0092:3:1:19725:2047#0/1
CGCGAGTCCGGCTAGATTGGTAGACTCCATATG
+HWUSI-EAS1795_0092:3:1:19725:2047#0/1
hghhhhhhhghhhhghggeheddeheghhhhgh
@HWUSI-EAS1795_0092:3:1:1587:2067#0/1
TGTTGGGATCCGGGTCGGGTACCATCTCTCTAG
+HWUSI-EAS1795_0092:3:1:1587:2067#0/1
ggegggfadffffffafffcfaffeffffffff
@HWUSI-EAS1795_0092:3:1:1609:2069#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:1609:2069#0/1
ffX\Sa\ZZHVZVYG\\PYVa\dce\aMYWWLa
@HWUSI-EAS1795_0092:3:1:2331:2063#0/1
GCGTCTGCCCCTGCAGGATGTGTACAAAATTGG
+HWUSI-EAS1795_0092:3:1:2331:2063#0/1
ggggggfdffffggggf__]ffgggggggggee
@HWUSI-EAS1795_0092:3:1:2682:2063#0/1
CACATTTGATAGTTACTAATGAATATTATTGTT
+HWUSI-EAS1795_0092:3:1:2682:2063#0/1
hhhhhhhhhhghhhhhhhhhhghhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:3422:2059#0/1
GCCGGAGTAGCCATCCTCGGCGAGTTCGCGAGT
+HWUSI-EAS1795_0092:3:1:3422:2059#0/1
ggfgfgffggggfgfggcffff`d[a`\Z[Z\[
@HWUSI-EAS1795_0092:3:1:3944:2068#0/1
CTTGCCAACCACTTGCCGAAGGCTAATCCAACT
+HWUSI-EAS1795_0092:3:1:3944:2068#0/1
gggfgggggggggggggggggggggfgggggfg
@HWUSI-EAS1795_0092:3:1:4370:2068#0/1
GAAGCAACTCCAGCAGATCGATGGCACCCTGTC
+HWUSI-EAS1795_0092:3:1:4370:2068#0/1
hhggghhhghhhhahggahhhhcgdhhhcfhfh
@HWUSI-EAS1795_0092:3:1:4898:2061#0/1
CTGGCATCGTTTATGGTTAGAACTAGGGCGGTA
+HWUSI-EAS1795_0092:3:1:4898:2061#0/1
hhhghhhhhhhhhhfehhdfghfgghhhhhhhg
@HWUSI-EAS1795_0092:3:1:5557:2058#0/1
GCGGTTCAAAAGACGAGGCACTGCCGGCATTAC
+HWUSI-EAS1795_0092:3:1:5557:2058#0/1
hfhhhhhgggheghhhcghhfhhchhghghfhh
@HWUSI-EAS1795_0092:3:1:5670:2059#0/1
GGCGAAGGGTCCGGTGACCAGCAGGAGTCCGGA
+HWUSI-EAS1795_0092:3:1:5670:2059#0/1
hhhhfhfhhhfhhhfhdhhfhhhhffghfhhhc
@HWUSI-EAS1795_0092:3:1:5851:2060#0/1
CTGGTGCATCTGGGACTTTCGGTGTTTGCCACT
+HWUSI-EAS1795_0092:3:1:5851:2060#0/1
gggggccgggfggfgggggggfdffffgdgggg
@HWUSI-EAS1795_0092:3:1:6041:2066#0/1
CGGGGCATTGCCGATGTTGATCAGCTCCACATC
+HWUSI-EAS1795_0092:3:1:6041:2066#0/1
hghhhhdhfdhfhf[hhhgchhghdghghgdgg
@HWUSI-EAS1795_0092:3:1:7395:2060#0/1
TCGATGTTGGATTAAGATATAATTTTGGGTGTA
+HWUSI-EAS1795_0092:3:1:7395:2060#0/1
hhhfgfhhhhhhhhhhhfhfhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:7619:2068#0/1
GCCGTCGGTGATATTCCCGGTGTGCGCTTCAAG
+HWUSI-EAS1795_0092:3:1:7619:2068#0/1
gggggggfdeecfff`ffefafcffdfggdegf
@HWUSI-EAS1795_0092:3:1:9126:2066#0/1
GTTGTTTTATTGTATTTCTTGCAGTTGCCATTG
+HWUSI-EAS1795_0092:3:1:9126:2066#0/1
hhhhhhhhhhhfhhghhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:9176:2070#0/1
GGCAGCGCAGGCTGAGATTGAGGAGGCCATGAC
+HWUSI-EAS1795_0092:3:1:9176:2070#0/1
ccccc_cccac[]aVaVS\\W\c[cccc]cccc
@HWUSI-EAS1795_0092:3:1:9764:2059#0/1
CAAAAGGCAGTTTAGCCGATACATCAAGTTGGG
+HWUSI-EAS1795_0092:3:1:9764:2059#0/1
hhhhhhhhhghhhhhhhhhahfhhhhgghhhhh
@HWUSI-EAS1795_0092:3:1:9958:2067#0/1
CAACAACGCCATACACTCGTCTACAAAATTGAC
+HWUSI-EAS1795_0092:3:1:9958:2067#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10204:2061#0/1
CGCATGGTCAACGAGGCCGAGAAGTACCGCAAC
+HWUSI-EAS1795_0092:3:1:10204:2061#0/1
hhhhhhhhhhhhhghfhhhchhhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:10307:2067#0/1
TCTCAGTGCAACTAAAGGCCTAAATAGCCCATA
+HWUSI-EAS1795_0092:3:1:10307:2067#0/1
hhghhhhhhhhhhhghhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10432:2059#0/1
CAACGCCCGTCTGGCGCTGGTGATGAAGTCCGG
+HWUSI-EAS1795_0092:3:1:10432:2059#0/1
hhhhhhhhhhhhhhhhhhhhghehhhhhfhhfh
@HWUSI-EAS1795_0092:3:1:10537:2060#0/1
CTTACACTGCCAGATTAGAGTCAAGCTCAAAAG
+HWUSI-EAS1795_0092:3:1:10537:2060#0/1
ggggdggggfggggcgdaffffgcgfgggfggg
@HWUSI-EAS1795_0092:3:1:10807:2059#0/1
GGAAAGGACACCATGACCTCTGTGGGCTTGGTG
+HWUSI-EAS1795_0092:3:1:10807:2059#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:11072:2068#0/1
TGGCGCTGAGCTCCGTGATGTGTCCAGCGACCA
+HWUSI-EAS1795_0092:3:1:11072:2068#0/1
hcghhhfhhhhhhhhhhfdhhghhhgfhdehhg
@HWUSI-EAS1795_0092:3:1:11159:2066#0/1
GAACTTTTTCCAGCTGATGTAAGGCCACGCAAT
+HWUSI-EAS1795_0092:3:1:11159:2066#0/1
hhhhhhhhhhhghhhhhgghghhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:11205:2065#0/1
CACGGGTACAATTATAAAATATAATTCTTGGAG
+HWUSI-EAS1795_0092:3:1:11205:2065#0/1
aaWZ__WaWc\c[Wdddd_V__a\`X\dcd]ac
@HWUSI-EAS1795_0092:3:1:11352:2058#0/1
CTTTTTCACATCGATTTTGGCCACATCCTGGGC
+HWUSI-EAS1795_0092:3:1:11352:2058#0/1
hhhhhhhghhhhhhhhhhfhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11819:2064#0/1
ATTATGGTTAAAGTTTGTTTTTAAAGTTTACAT
+HWUSI-EAS1795_0092:3:1:11819:2064#0/1
hhhhhhhhhhhhhhhhghhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:12015:2060#0/1
GAAGAACTACTCCACTCCCAAGAAAATCAAGCA
+HWUSI-EAS1795_0092:3:1:12015:2060#0/1
hhhhhhhhhhhhhhhhhhhhhghhhehfhhhhh
@HWUSI-EAS1795_0092:3:1:12604:2060#0/1
GCAAGCATCCCGGAGGTCGCGGTAACGCTGGTG
+HWUSI-EAS1795_0092:3:1:12604:2060#0/1
ggggggggggggggggfffcffgggfgddcadf
@HWUSI-EAS1795_0092:3:1:12823:2062#0/1
CATGAACTTGGTGTGGCGGGGTTGGGTGTTTTT
+HWUSI-EAS1795_0092:3:1:12823:2062#0/1
fffffffffffffffffffcO`BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13142:2062#0/1
AAAATTCTTGCGTGAAACCGAATCAATAGAAAA
+HWUSI-EAS1795_0092:3:1:13142:2062#0/1
hhhhhghhhfhhhhhhhhhhhhghhhhhghhhh
@HWUSI-EAS1795_0092:3:1:13181:2060#0/1
CGGCGATTATTTAGAAAGTTAATGACTTATAAC
+HWUSI-EAS1795_0092:3:1:13181:2060#0/1
ffffcffdRad`VZ]``[^aaaU[[\\ccfaf^
@HWUSI-EAS1795_0092:3:1:13311:2059#0/1
CGGCGCACAAAGAGCGATGCGAACGGAGTGTTC
+HWUSI-EAS1795_0092:3:1:13311:2059#0/1
hhehhghhhhhhhhffhhhghghhhhghehhhg
@HWUSI-EAS1795_0092:3:1:13929:2068#0/1
AAACGCCAATGTCAAATTTTCTTCAGATAATGT
+HWUSI-EAS1795_0092:3:1:13929:2068#0/1
hhhhdhhhhhgghhgfhhhhhhghghhhhgheh
@HWUSI-EAS1795_0092:3:1:14096:2062#0/1
CGCCAACATGGGTTTCGCTACTCTCTGGTACTC
+HWUSI-EAS1795_0092:3:1:14096:2062#0/1
ggggcegcffffggggdgggggggggfggggeg
@HWUSI-EAS1795_0092:3:1:14779:2062#0/1
TCTGCGTGTCGTTGTTGTTGTTGAGTGGAAGCA
+HWUSI-EAS1795_0092:3:1:14779:2062#0/1
cf_f[fdTSEPSV[[RMaa]bbWaaadcfcWdd
@HWUSI-EAS1795_0092:3:1:14848:2060#0/1
AGCTGATCGAGCAGAAGAAGGCCCAACTGGTGG
+HWUSI-EAS1795_0092:3:1:14848:2060#0/1
ghhhhhhhhhhhhhhhghhhhhhghhhhhhdhd
@HWUSI-EAS1795_0092:3:1:15059:2065#0/1
AGAAGAAGAAGAAGAAGACCGGACGCGCCAAGC
+HWUSI-EAS1795_0092:3:1:15059:2065#0/1
hhhhhhhhhfhhhffhahhhfadhhWahhgcgh
@HWUSI-EAS1795_0092:3:1:15418:2060#0/1
TCTCCTCATCGTCATCATCCTCGTCCTCATCGT
+HWUSI-EAS1795_0092:3:1:15418:2060#0/1
cfffffffffffcffffcdccbcea[eee]ee]
@HWUSI-EAS1795_0092:3:1:15761:2068#0/1
AGGAAATGATACACGTTCCATTTAATCAAGTAA
+HWUSI-EAS1795_0092:3:1:15761:2068#0/1
hhhhghhhhfhhghhhhhhhhhhhghhhhgghh
@HWUSI-EAS1795_0092:3:1:15823:2065#0/1
GTTTTTTAGAAGACATTTGCCTACGATTTTGGT
+HWUSI-EAS1795_0092:3:1:15823:2065#0/1
a`^a\\\_addd]ZbbbVVXU_cfcfffdaac^
@HWUSI-EAS1795_0092:3:1:16240:2059#0/1
GGAACGGGACTCGCGCTTCGAGACGGACCGCGA
+HWUSI-EAS1795_0092:3:1:16240:2059#0/1
gdfafffgfcfgcYeaefffdfgggcff[afaa
@HWUSI-EAS1795_0092:3:1:16407:2065#0/1
GTTTCATATTATTGTGGTTCATTTTGTTGTGGT
+HWUSI-EAS1795_0092:3:1:16407:2065#0/1
hhhghhhhhhfhhghghhhhhhhhhghhhhffh
@HWUSI-EAS1795_0092:3:1:16723:2059#0/1
CACTACTGCACCAAGCCCACAAAGAAGAGGTGA
+HWUSI-EAS1795_0092:3:1:16723:2059#0/1
hhhhhhhhffhhhhhhhfadhhhhhhhhhhdgf
@HWUSI-EAS1795_0092:3:1:17397:2059#0/1
GTTCCATCAAGTGGAAATGCGCAGGACGACGAG
+HWUSI-EAS1795_0092:3:1:17397:2059#0/1
hhhhhhhhhhhhhgegghhffgghdhededhhg
@HWUSI-EAS1795_0092:3:1:17534:2063#0/1
TGGGCATCAGTGAGCAGATCTCAGCCCAGTTGA
+HWUSI-EAS1795_0092:3:1:17534:2063#0/1
hdghhdhhhdhchhhhhhhhhghhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:17944:2067#0/1
GAAATTTTCTTTTGAATTAAACTACAATGTCCA
+HWUSI-EAS1795_0092:3:1:17944:2067#0/1
ggfafffgdg`f_fffacgggggggggggfggg
@HWUSI-EAS1795_0092:3:1:18320:2066#0/1
CGGCGCGGAGCACCAAGCGGCCGATGCGGCCAA
+HWUSI-EAS1795_0092:3:1:18320:2066#0/1
hedhhhghhhhhhhhhahffghghahhcdfdde
@HWUSI-EAS1795_0092:3:1:18490:2062#0/1
CTGGGTCTGCTTGGTCGGGATGGTGGTGTTGCG
+HWUSI-EAS1795_0092:3:1:18490:2062#0/1
hhhhhhhhhhhhhhhhhhhhghhhhggghgghh
@HWUSI-EAS1795_0092:3:1:1072:2073#0/1
GGAACTTCCATCTGCGTCGCCAGCACAAGTTCA
+HWUSI-EAS1795_0092:3:1:1072:2073#0/1
fafcfffffdffdffff^\aaYac\aaffd^f]
@HWUSI-EAS1795_0092:3:1:1648:2079#0/1
GCGAGTTATTAAAAACAATATTCGAGGCTTAGC
+HWUSI-EAS1795_0092:3:1:1648:2079#0/1
]acfcfdgddfggacce_cfafdacdfcfacfc
@HWUSI-EAS1795_0092:3:1:2370:2075#0/1
GCAAAGGTGAGCGCGGAGAAACCGGACAACGCG
+HWUSI-EAS1795_0092:3:1:2370:2075#0/1
hhhhhhhhhhhhhhhhhchhhhhhfghhhhghh
@HWUSI-EAS1795_0092:3:1:2832:2078#0/1
TGATGCTTGATGTTTGGTGAGTTCTATCCTACA
+HWUSI-EAS1795_0092:3:1:2832:2078#0/1
gggfagfgggcffaacYaffcffffffggdgge
@HWUSI-EAS1795_0092:3:1:3266:2076#0/1
GCATCATGTCCAACAGCAGCAGCAGTCGCAACA
+HWUSI-EAS1795_0092:3:1:3266:2076#0/1
[affff]fccffcbdbdW````ffcac\]X`]c
@HWUSI-EAS1795_0092:3:1:3967:2081#0/1
CGTTAACCCACAATCACACTATATGCAATAAGG
+HWUSI-EAS1795_0092:3:1:3967:2081#0/1
hhhhhhhhhhhgghhfghhheehhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:4198:2071#0/1
CAACAACAGCAGCAGCAGCAGCAACCACAGCAG
+HWUSI-EAS1795_0092:3:1:4198:2071#0/1
hhhfhhhhhfghhfhhfhhgfhhhhghhhhehg
@HWUSI-EAS1795_0092:3:1:4293:2071#0/1
GGATGTGCTGGGACCAGGACAGCTGCTGGGGCA
+HWUSI-EAS1795_0092:3:1:4293:2071#0/1
hhhhghhhhghhhfhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4657:2073#0/1
CGCACTATAGACAGACGGGGTATCTGGATGCAT
+HWUSI-EAS1795_0092:3:1:4657:2073#0/1
cc]_cc_cccc_^aPaBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4735:2076#0/1
GTTTGTCAAGCCTCATAGCCGGCAGTTCGAACG
+HWUSI-EAS1795_0092:3:1:4735:2076#0/1
hhhhfhhhhhhhggcgfhhhhehhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:4787:2071#0/1
CAGGCAGATATTCGATCTCGCAGCGGTTATAGA
+HWUSI-EAS1795_0092:3:1:4787:2071#0/1
hghhhhhghhhhhhhhhhhhfhhfhhhgchfah
@HWUSI-EAS1795_0092:3:1:4809:2081#0/1
ATCACCTGAATGAAAGTAAGGGATCAGGCAACC
+HWUSI-EAS1795_0092:3:1:4809:2081#0/1
hhhhghghhhghchgfhghhhhhdfehhahhhh
@HWUSI-EAS1795_0092:3:1:4944:2080#0/1
GGGTTGTAGCCGATCTTCTTGATGTAAGAGGAC
+HWUSI-EAS1795_0092:3:1:4944:2080#0/1
gggggfggggdfggcggggfgggggcgegggee
@HWUSI-EAS1795_0092:3:1:5344:2075#0/1
CCGACTGACCACTTGGTCCTCCTCCGTCGGTCG
+HWUSI-EAS1795_0092:3:1:5344:2075#0/1
ggggggedggggggcaggffegfgffgggagff
@HWUSI-EAS1795_0092:3:1:6067:2080#0/1
CCCGGTTTGAACTCAGATCATGTAAGAATTTAA
+HWUSI-EAS1795_0092:3:1:6067:2080#0/1
hhhhhhhhhgfhhhhhfhhhhhghfhhehhhhh
@HWUSI-EAS1795_0092:3:1:6100:2076#0/1
TGGAAAACGCCAACATGGGTTTCGCTACTCTCT
+HWUSI-EAS1795_0092:3:1:6100:2076#0/1
ggfgggcggggggfgggggcgggfgggggggge
@HWUSI-EAS1795_0092:3:1:7758:2075#0/1
GAGGTACCAAGTCAAGTTCCGAAGGCGTCGCGA
+HWUSI-EAS1795_0092:3:1:7758:2075#0/1
hhhhhghhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8103:2078#0/1
AAAAAAAAACGGAAATTTCGTAGAGCAGCAAAG
+HWUSI-EAS1795_0092:3:1:8103:2078#0/1
hhhhhhhhhhhhghhhhhhghhhhhfhhhhhgg
@HWUSI-EAS1795_0092:3:1:8507:2073#0/1
TCTCACTAAATCTCTTTTCATCGCCCAAGAATA
+HWUSI-EAS1795_0092:3:1:8507:2073#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:8585:2081#0/1
CAAGAAGTTGATCGACAAGTTGACGTTTTGGGC
+HWUSI-EAS1795_0092:3:1:8585:2081#0/1
ghhhhhhhhdhhhhgh[hhfhahhhhghchhfh
@HWUSI-EAS1795_0092:3:1:9100:2076#0/1
GGCTTCTTCACCATTGACTCCAACATCTGAGTG
+HWUSI-EAS1795_0092:3:1:9100:2076#0/1
hghhhhhhhhhghhhfhhhhhhhhhhhhhhhgf
@HWUSI-EAS1795_0092:3:1:9597:2072#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9597:2072#0/1
hghhhhhhhhhahhhhhhhhhhehhhhhahggg
@HWUSI-EAS1795_0092:3:1:9801:2079#0/1
GCCGATCTGCAGTTCCACCGTCTCGAGGAAGCC
+HWUSI-EAS1795_0092:3:1:9801:2079#0/1
f[fff[f`Qdd`cfdf_ccffBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:9897:2077#0/1
GTTTTCTTTTCTTCTTGGTATTTATTTATTGTT
+HWUSI-EAS1795_0092:3:1:9897:2077#0/1
hhhhhhhhhhhhhhhhghgfhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:9991:2072#0/1
CGCAAAAGTTCGTTGCAATGCCTGGGGCGATTG
+HWUSI-EAS1795_0092:3:1:9991:2072#0/1
ggggggfgggggcfdafgdgggggg_dfgggee
@HWUSI-EAS1795_0092:3:1:10227:2081#0/1
TGGCGGATGGCGTAGATCTGGGCTACATGACCA
+HWUSI-EAS1795_0092:3:1:10227:2081#0/1
feggfggggacggg]ag[fffa__c_acdfffg
@HWUSI-EAS1795_0092:3:1:10244:2075#0/1
ATCTGAAGCCGGTCCGGTCCGATGGTGGAGACT
+HWUSI-EAS1795_0092:3:1:10244:2075#0/1
hhhhghhghhfhhhhghghhggghhhfheffhh
@HWUSI-EAS1795_0092:3:1:10325:2079#0/1
TCCAGGATAAGGAGGGCATTCCCCCAGATCAGC
+HWUSI-EAS1795_0092:3:1:10325:2079#0/1
ccffffcfddffcfdfIeceeeadffdfc_aff
@HWUSI-EAS1795_0092:3:1:10360:2072#0/1
CGGCTGATAGGATAACTAAAATCAAAAATAGTA
+HWUSI-EAS1795_0092:3:1:10360:2072#0/1
gggggfggggcdgfgfgcfffffdfdffffffg
@HWUSI-EAS1795_0092:3:1:10388:2071#0/1
TGAACGCATGCTAAACAAGGAGGAGCTAAAGAG
+HWUSI-EAS1795_0092:3:1:10388:2071#0/1
ghhhhhhhhhhhhhhhhhhehhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10623:2076#0/1
TAGGGCTTTCATCAGCAGACGGTTGTGCTTGTT
+HWUSI-EAS1795_0092:3:1:10623:2076#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhf
@HWUSI-EAS1795_0092:3:1:10775:2075#0/1
GCTTGGCGGACTCCTTGAAGGGTGTGATATTCC
+HWUSI-EAS1795_0092:3:1:10775:2075#0/1
hhhhfhhhhhhhhhhhYfffffdhhhgff[fff
@HWUSI-EAS1795_0092:3:1:11085:2082#0/1
TCTTCACATCTGCCTGTTGTTCAACGCAATCGC
+HWUSI-EAS1795_0092:3:1:11085:2082#0/1
hhhhhhhhhhhchhhehhfhhhhhghhhfhhhh
@HWUSI-EAS1795_0092:3:1:11670:2073#0/1
GGCGCCCGTTCGTTCCAGTCCTCCTGATCCTCC
+HWUSI-EAS1795_0092:3:1:11670:2073#0/1
fcgggggggggfggggaggggggggggggcggc
@HWUSI-EAS1795_0092:3:1:12282:2070#0/1
AAGCAGTTAATTATATATACAAAGTGTGTGTAC
+HWUSI-EAS1795_0092:3:1:12282:2070#0/1
gggdggggg\gggggggggggggfgfgffddfg
@HWUSI-EAS1795_0092:3:1:12814:2079#0/1
TGTGGAGCGAGTATGTGGATCAGAACTCACTGG
+HWUSI-EAS1795_0092:3:1:12814:2079#0/1
gdggaggggggggggagggegggggggfggggg
@HWUSI-EAS1795_0092:3:1:12841:2079#0/1
CCTTTTTGTAATTGTCCAAGTATTATTAATTTT
+HWUSI-EAS1795_0092:3:1:12841:2079#0/1
gcfggggggegcggggdgdggafgfgggggggg
@HWUSI-EAS1795_0092:3:1:13431:2078#0/1
TGGTGGCCTTCTCGGCGGCCTTGGTGACCTTGC
+HWUSI-EAS1795_0092:3:1:13431:2078#0/1
hhfhgghhhhhghhghcfahfhafaddhhfhfh
@HWUSI-EAS1795_0092:3:1:13602:2079#0/1
CTAAGAATATGTTCAGCAATATATTGGTGGTGA
+HWUSI-EAS1795_0092:3:1:13602:2079#0/1
hhhhhhhhhhhhhhhhhhhgghfhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:13885:2081#0/1
CGGCGACGTAGCGTACGATGATGAGTTTTTGGG
+HWUSI-EAS1795_0092:3:1:13885:2081#0/1
gcfgggggggggfcfafdfffcggggcfgageg
@HWUSI-EAS1795_0092:3:1:13959:2075#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13959:2075#0/1
gggdgfgcf^fd_cfcfdaeacccfffc]ffcc
@HWUSI-EAS1795_0092:3:1:15259:2077#0/1
GCGGAAGAAGACCAGGAAGCTGCGTGGTCATGT
+HWUSI-EAS1795_0092:3:1:15259:2077#0/1
hhhhhhhhhhhhfhhghghhhhegggfhhghhh
@HWUSI-EAS1795_0092:3:1:16119:2077#0/1
CGTGGCCCGACAGTATCCGCAGACGCGGACTGA
+HWUSI-EAS1795_0092:3:1:16119:2077#0/1
ggfggggfggggggcggggggcggdggddfdfc
@HWUSI-EAS1795_0092:3:1:17116:2070#0/1
GTACACTAAAGATATCCAATATCTGTCGTGCTG
+HWUSI-EAS1795_0092:3:1:17116:2070#0/1
hghhhhhhhghghhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:17259:2081#0/1
GGGGAACTTGATGCGGTACTTGGTCAGATGCAG
+HWUSI-EAS1795_0092:3:1:17259:2081#0/1
ggggggfeggggggggcgggggggfggggggag
@HWUSI-EAS1795_0092:3:1:18028:2075#0/1
CCTCAATAGCTTGCCGGTGTCGGGATCGATCAC
+HWUSI-EAS1795_0092:3:1:18028:2075#0/1
hhhhghhhhhhhfhhhhgfhhfehggghadgdh
@HWUSI-EAS1795_0092:3:1:19445:2077#0/1
GTGGAGAAGACCCCGGGTCCCTATGTCAAGGAG
+HWUSI-EAS1795_0092:3:1:19445:2077#0/1
ghhahhhfffffhhhfhgghhhdffddf_ffch
@HWUSI-EAS1795_0092:3:1:1835:2086#0/1
CCTCGTCTGCATTTAGCATTCGTATCCGTCGAA
+HWUSI-EAS1795_0092:3:1:1835:2086#0/1
gggdgggggggcggfgegcgfgggfgggcgggg
@HWUSI-EAS1795_0092:3:1:4193:2091#0/1
CTCTACTAGGAATTCTGTTGATTAAATAAGTAG
+HWUSI-EAS1795_0092:3:1:4193:2091#0/1
ggedgggfgggggggggggfgggeggggggfgf
@HWUSI-EAS1795_0092:3:1:4685:2084#0/1
CTAACACACCAACAACAACAGCAAAATGGCCAA
+HWUSI-EAS1795_0092:3:1:4685:2084#0/1
hhghehhhghhhhhhhhhhhhhhhhhfhgghhh
@HWUSI-EAS1795_0092:3:1:4756:2089#0/1
CCGATGTCATTACCGATTATGTTAAGATCATCG
+HWUSI-EAS1795_0092:3:1:4756:2089#0/1
cgggfdggggggdggcgfcgcgff]_afcfffg
@HWUSI-EAS1795_0092:3:1:4866:2092#0/1
TGTAAGCCAGGTTGGTTTCTATCTTTAAAAAAT
+HWUSI-EAS1795_0092:3:1:4866:2092#0/1
hhhhghhhhhhhhghhhhghfgfhhhhhfhhgh
@HWUSI-EAS1795_0092:3:1:5782:2088#0/1
CGTCAATCCAATAGCCTTTTGTTTTTTATTTGG
+HWUSI-EAS1795_0092:3:1:5782:2088#0/1
hhhhghhhhhhfhhhhhhhhghhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:6539:2083#0/1
GCAGGCACGGCAGCATCGGGAGCCTTGGCCATA
+HWUSI-EAS1795_0092:3:1:6539:2083#0/1
hhhhhchhhhhhhhhhhchhgfhdhgachhggg
@HWUSI-EAS1795_0092:3:1:6920:2089#0/1
GGGGGATCTTGTACTCGGTCTCGGGCGTCTCGT
+HWUSI-EAS1795_0092:3:1:6920:2089#0/1
hhhhgghhhhhhhhhhghhhfhhhgggghhhfh
@HWUSI-EAS1795_0092:3:1:7009:2086#0/1
GACGAGGATGCCAGTTGCAGTGATTCATTCACT
+HWUSI-EAS1795_0092:3:1:7009:2086#0/1
hhhhhhhhhfhhhhhhhhhgghhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:8519:2091#0/1
CCTGGACAGTGGTTAGCGTCTTGCGACCGTTCC
+HWUSI-EAS1795_0092:3:1:8519:2091#0/1
hhhhhhhhhhhhhhggfggfhhcffdehfghfh
@HWUSI-EAS1795_0092:3:1:8662:2087#0/1
CGAAAAGATCGGCGTTCGTCACGGCCATCTCAC
+HWUSI-EAS1795_0092:3:1:8662:2087#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:9157:2091#0/1
GCCGTCTCCAGCGAGCGGATGATGTCCGAATCT
+HWUSI-EAS1795_0092:3:1:9157:2091#0/1
gfc_adffff][a[cccffff[Wcaaaa_cffU
@HWUSI-EAS1795_0092:3:1:9489:2092#0/1
GGACAGCAACAATTCAAGATAAACCATTTCGAT
+HWUSI-EAS1795_0092:3:1:9489:2092#0/1
hghhfhhhhhhhhghhhfhhhhhhcghhhhhah
@HWUSI-EAS1795_0092:3:1:10077:2088#0/1
TTTGAAATGGTCTTTCATTTATGGTTTGCTCAT
+HWUSI-EAS1795_0092:3:1:10077:2088#0/1
hhhhhghhhhhhhhhhhhhhhgfhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10178:2082#0/1
GGGGATATGAGGGCGCCATTGGTTTGATCGGCC
+HWUSI-EAS1795_0092:3:1:10178:2082#0/1
hhhhdhhhhghhhhehhhhhhhhhghhhhhghf
@HWUSI-EAS1795_0092:3:1:10485:2083#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:10485:2083#0/1
ggfggfgggggcfccfffffffcdfffd_ffcf
@HWUSI-EAS1795_0092:3:1:11551:2086#0/1
TGACCGGGCAGGTTCCTGTTGAAACGGGCACGC
+HWUSI-EAS1795_0092:3:1:11551:2086#0/1
hhhhhhhhhhhhhhhhhhhhfhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11639:2084#0/1
AGTGAATCATCTCAGTGCAACTAAAGGCCTAAA
+HWUSI-EAS1795_0092:3:1:11639:2084#0/1
fffggeggggeegfggcgggdffffQdcffffg
@HWUSI-EAS1795_0092:3:1:11836:2087#0/1
CACGCCTCCGTGCAGCTGAGCATCGTGGATGTG
+HWUSI-EAS1795_0092:3:1:11836:2087#0/1
hhhhhhhhhhhghhehhhgffgfffhhhhha_h
@HWUSI-EAS1795_0092:3:1:11910:2084#0/1
GCGCTCCGTCTTCCCCCAGAGGAAGTTCGCCGT
+HWUSI-EAS1795_0092:3:1:11910:2084#0/1
hhhhhhhhhhhhhhhhhhhhhhcghhhhfhhhc
@HWUSI-EAS1795_0092:3:1:12277:2089#0/1
TGACCAATTGGCAGGAGGTGGAGCGACTGCATT
+HWUSI-EAS1795_0092:3:1:12277:2089#0/1
gggggggggggggfgcgfaffc``db`cgggfg
@HWUSI-EAS1795_0092:3:1:12353:2086#0/1
CTGCCGGCATACTAATTTACCGAGTCCCCGACA
+HWUSI-EAS1795_0092:3:1:12353:2086#0/1
cfcfffc^ceceffadfe_dffa_ffffaff[c
@HWUSI-EAS1795_0092:3:1:12667:2082#0/1
GTCTGCAGACGCAGGTGTTCAAGCTGGGACTTG
+HWUSI-EAS1795_0092:3:1:12667:2082#0/1
ffggggfggfggfffcffffffdc[ddWffffa
@HWUSI-EAS1795_0092:3:1:13084:2089#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13084:2089#0/1
Sace^eefcfd\c[dedfffafYffffca_fff
@HWUSI-EAS1795_0092:3:1:13157:2092#0/1
CGGCATTATGGTGGCACTGTTCAAAAATCGACC
+HWUSI-EAS1795_0092:3:1:13157:2092#0/1
hfhhhhhhhffghfchghhhhhfhhhgghhghh
@HWUSI-EAS1795_0092:3:1:13222:2092#0/1
CCCAGATCAGCAGCGTCTGATCTTCGCCGGCAA
+HWUSI-EAS1795_0092:3:1:13222:2092#0/1
hhhhhhgghhhdhgghhhhgehhhghfhhcggh
@HWUSI-EAS1795_0092:3:1:13336:2090#0/1
ACCCAGTTGTATGGCACTAATCTAGGCAATTTT
+HWUSI-EAS1795_0092:3:1:13336:2090#0/1
hhhhhhhhhhhehhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13986:2084#0/1
AGTGGATGTAGCGCAGGTTCTGACGGAAGATGT
+HWUSI-EAS1795_0092:3:1:13986:2084#0/1
hhhhhhfhhhhhhhghhhhfghhghhhhggcgh
@HWUSI-EAS1795_0092:3:1:15142:2086#0/1
GGCGCTTAGCGTTGTAACGAATAGTGTTGCCAG
+HWUSI-EAS1795_0092:3:1:15142:2086#0/1
hfhhhghhhhghhhhehffcfcca`aahdhhhf
@HWUSI-EAS1795_0092:3:1:15194:2086#0/1
GCGGTCAATACAGCCTTTGGAGCGGGACAGGTT
+HWUSI-EAS1795_0092:3:1:15194:2086#0/1
hhhhhghhhhhghchhhhhhfhghhhhhehghh
@HWUSI-EAS1795_0092:3:1:15402:2090#0/1
CGGTCTCAACGGCCAGCATGACACCGCGACGAA
+HWUSI-EAS1795_0092:3:1:15402:2090#0/1
hhhhhhhhhhhhhhhhhhhghhghhhhhahhhh
@HWUSI-EAS1795_0092:3:1:15943:2092#0/1
GTTCTGGGCCGCACCGGCTCCCAGGGTCAGTGT
+HWUSI-EAS1795_0092:3:1:15943:2092#0/1
hhhhhghhhhghhhhhghghhhcfhh]hdhdfg
@HWUSI-EAS1795_0092:3:1:16610:2083#0/1
GAAGAACAAGAAACTGTTCGAACTGCTCGACGT
+HWUSI-EAS1795_0092:3:1:16610:2083#0/1
S_VM]YSMPPON[W]Z^ccccac]cV[]]T]V]
@HWUSI-EAS1795_0092:3:1:17052:2084#0/1
GGCAGCTTCAGGGTGGTTGGCCGACGGAAGTGC
+HWUSI-EAS1795_0092:3:1:17052:2084#0/1
hhhhhhghhhhhhchhhhhhhhghhhhchhehh
@HWUSI-EAS1795_0092:3:1:17161:2089#0/1
GCCAAAGCAGACGCAAGTGGACTCGTTGACTGC
+HWUSI-EAS1795_0092:3:1:17161:2089#0/1
hfhhhhhghghhhhhhgchhhhhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:18283:2090#0/1
GTAGAGTGGGTGGTTGGAGAGTGAGTGGGTGGT
+HWUSI-EAS1795_0092:3:1:18283:2090#0/1
ggggfggfffdffcfffffffafdfdfffbffc
@HWUSI-EAS1795_0092:3:1:18511:2091#0/1
GGGGCATCAATGATGGTCACGTAGTACTTGGCA
+HWUSI-EAS1795_0092:3:1:18511:2091#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:2325:2098#0/1
TAGCTCTTTCTCGAATCTATGGGTGGTGGTGCA
+HWUSI-EAS1795_0092:3:1:2325:2098#0/1
dfddfffgfeggfffaff]ffffcffXe_`ded
@HWUSI-EAS1795_0092:3:1:2919:2100#0/1
ACGTGGCTTTCCCACCATCAAGATCTTTGGCGC
+HWUSI-EAS1795_0092:3:1:2919:2100#0/1
c_fcfcfffffaa^aWR`e_c^eW[dbbbKdbf
@HWUSI-EAS1795_0092:3:1:3047:2097#0/1
TAAAAATGGAAACTAATGTAGATTTCAGCAGCA
+HWUSI-EAS1795_0092:3:1:3047:2097#0/1
ddffdffgcggggdfcacff[f]ffdf_dadff
@HWUSI-EAS1795_0092:3:1:3772:2098#0/1
AGAACCTGTACGTGATCGCCGTCCACGGAATCC
+HWUSI-EAS1795_0092:3:1:3772:2098#0/1
ffafcfffdfWf`de]a\dc_dfda]f`bb[dW
@HWUSI-EAS1795_0092:3:1:4103:2094#0/1
TCACTGCTTGCTAGTGCAGTCCTACTTCGCGCG
+HWUSI-EAS1795_0092:3:1:4103:2094#0/1
hfhhfefhehhhhhhahfghghhghhhhhehhh
@HWUSI-EAS1795_0092:3:1:4510:2099#0/1
AGATCGTCTCCAGTTGGCTGGGTGTCTTCATCT
+HWUSI-EAS1795_0092:3:1:4510:2099#0/1
ghhghhhhfhhhhhhghhhhhhhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:4599:2094#0/1
CTTTCCCGCCTCCGAGGCACTGGAGCATTTGGT
+HWUSI-EAS1795_0092:3:1:4599:2094#0/1
hhhhhhhhhhhhhchhhhhhhhhhhhhhhhgcc
@HWUSI-EAS1795_0092:3:1:4639:2100#0/1
CGGACACGACATTTTGTTTAAGCGCTGGTGGTG
+HWUSI-EAS1795_0092:3:1:4639:2100#0/1
egg[fgggggcggggfggggfgggggggggggf
@HWUSI-EAS1795_0092:3:1:6475:2099#0/1
CAGTTAACACTTCCCAGAATGCACACCACCCAC
+HWUSI-EAS1795_0092:3:1:6475:2099#0/1
hhhghhhhhhhhhhhhhhghhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6592:2094#0/1
CAAAAACCACAACATCATCCACAAGTACAACGA
+HWUSI-EAS1795_0092:3:1:6592:2094#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:7539:2096#0/1
CGGATCTCCTGCTTCTGCATGTCCATGCCACCA
+HWUSI-EAS1795_0092:3:1:7539:2096#0/1
fffggdgggggdggge]gggggfff]_ffdfcg
@HWUSI-EAS1795_0092:3:1:7558:2098#0/1
TGATCGATTACGATTACCACAATAAGTAGACGC
+HWUSI-EAS1795_0092:3:1:7558:2098#0/1
ggfafffafffcfcffac^cdedffa[ccdacg
@HWUSI-EAS1795_0092:3:1:7884:2101#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:7884:2101#0/1
gcfdgggafa]ff]fffaffccgggcffdad]e
@HWUSI-EAS1795_0092:3:1:8210:2103#0/1
ATAATTTACAATTGGTTGAGCTGACATGGCTTT
+HWUSI-EAS1795_0092:3:1:8210:2103#0/1
ggdgggeggfedacfffcaffc[aeee_acccZ
@HWUSI-EAS1795_0092:3:1:8633:2101#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8633:2101#0/1
gdggfdggdgggggaggdffffgggggg_gggf
@HWUSI-EAS1795_0092:3:1:8834:2099#0/1
GGTGTTTGCGTTTTTCTCTACGCCTCCGGCCGT
+HWUSI-EAS1795_0092:3:1:8834:2099#0/1
ffggfggggggggggggggggcggaggffffdf
@HWUSI-EAS1795_0092:3:1:9241:2102#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9241:2102#0/1
ggggggggggggggcgggeggfaggggg]gggf
@HWUSI-EAS1795_0092:3:1:9839:2104#0/1
CTGGTGATGATGTCTCCTTAACGGTTGGACTTG
+HWUSI-EAS1795_0092:3:1:9839:2104#0/1
Y\S\aTWXZXZUTTTVWcY\]ca\cScBBBBBB
@HWUSI-EAS1795_0092:3:1:10528:2102#0/1
GGCTGGGGGAAGGATGGCATCGAGGGCATCGAT
+HWUSI-EAS1795_0092:3:1:10528:2102#0/1
hhhhhhhhhaghhhhhh]hhhhhgegagggghg
@HWUSI-EAS1795_0092:3:1:10911:2102#0/1
AGACTTTGATCACTAAACATATTCTTTCGTTTT
+HWUSI-EAS1795_0092:3:1:10911:2102#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10974:2098#0/1
ATTGATAGTTGAAAAAGTGGAAAATCACATCAG
+HWUSI-EAS1795_0092:3:1:10974:2098#0/1
hhhghhhhhhhfhhhhhdhhghhghhhhghhgh
@HWUSI-EAS1795_0092:3:1:11304:2098#0/1
GTGTGCAGCACCTCGTGGTAGTGGTACTTAAAG
+HWUSI-EAS1795_0092:3:1:11304:2098#0/1
ffdfffffaffffffffffafdfdcf_fffffg
@HWUSI-EAS1795_0092:3:1:12095:2098#0/1
TTCCTCAATTTTGTAGTTCATGTTATCCAGCAA
+HWUSI-EAS1795_0092:3:1:12095:2098#0/1
gfgggggafffdc``f]ffffdgggfggggcgg
@HWUSI-EAS1795_0092:3:1:12834:2099#0/1
GATTTGCCACGGCCATCAAGAGTTTCGCGCATC
+HWUSI-EAS1795_0092:3:1:12834:2099#0/1
ffccf[fdeddbfffcfffaad`dbd^ffffda
@HWUSI-EAS1795_0092:3:1:12853:2100#0/1
TCTCGCTTCCGATCGCATGAGGGCGAGGTTGCC
+HWUSI-EAS1795_0092:3:1:12853:2100#0/1
ghhhhgghhhhghhghhgeffhhhhfhceehhh
@HWUSI-EAS1795_0092:3:1:13358:2097#0/1
GTTGTATTCGAGTTGGTGGCTGATAGTGACTTA
+HWUSI-EAS1795_0092:3:1:13358:2097#0/1
hhhfhhhhghhhhhhhfhgggghhgacfaghhh
@HWUSI-EAS1795_0092:3:1:13578:2094#0/1
CGGAAGATGGCGGCGACGGTAAGGTAGCGTCCG
+HWUSI-EAS1795_0092:3:1:13578:2094#0/1
gggggggggggfggg]gggaegggggggggggg
@HWUSI-EAS1795_0092:3:1:14101:2103#0/1
CACCACCAGCACCATATTTTCAAGAACACCACT
+HWUSI-EAS1795_0092:3:1:14101:2103#0/1
hhhhghhhhhhhghhhhhhhhhhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:14610:2100#0/1
CAAAAGTGCAGTGCATCCTTAACCGCAGAACAA
+HWUSI-EAS1795_0092:3:1:14610:2100#0/1
gfgfcggdafffggefggggggggggggggggf
@HWUSI-EAS1795_0092:3:1:14646:2103#0/1
CCCACAACTTAAAACCATTGGGTTCATAGCCCA
+HWUSI-EAS1795_0092:3:1:14646:2103#0/1
gfgggggggggggfgggfgfgggggggcggggg
@HWUSI-EAS1795_0092:3:1:14803:2100#0/1
CTGACCGGCGCCACGTTGGAAAGAGCGTCCTGT
+HWUSI-EAS1795_0092:3:1:14803:2100#0/1
gggggggfafffgfcgcffaffdaffdgegggg
@HWUSI-EAS1795_0092:3:1:15456:2104#0/1
CCAACATCATAATGCAGCCAACAACACCACTCA
+HWUSI-EAS1795_0092:3:1:15456:2104#0/1
hhhhehhhhhhhhhhhhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:15810:2100#0/1
CGCCAATGCGGAATACTACGGACCCTCGCTGTT
+HWUSI-EAS1795_0092:3:1:15810:2100#0/1
hhhhfhhhhfghhhdhhghhhdhhhfghhhhhh
@HWUSI-EAS1795_0092:3:1:15861:2097#0/1
GGGGTGGCCATCTTACAGCTCGTCCTTGAGATC
+HWUSI-EAS1795_0092:3:1:15861:2097#0/1
_fffacc`fcc`fdffffcfedf__cfVU`U^f
@HWUSI-EAS1795_0092:3:1:16078:2100#0/1
CAAGGGTATTTCCCAATCAGCCCTCCCCTACAG
+HWUSI-EAS1795_0092:3:1:16078:2100#0/1
hhhhhhhhhhhhhhhghhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16291:2097#0/1
CGGGCAGATAGAAGAGAAGGAATCCCACGAGGA
+HWUSI-EAS1795_0092:3:1:16291:2097#0/1
gfgfggggffgggecgggcfgfcffffffff_g
@HWUSI-EAS1795_0092:3:1:16756:2105#0/1
ATTTAGGCCTTTAGTTGCACTGAGATGATTCAC
+HWUSI-EAS1795_0092:3:1:16756:2105#0/1
hhghhhhhhhhhhhhhgghhhhhhfhhghhhhf
@HWUSI-EAS1795_0092:3:1:17383:2097#0/1
CAATTTTCATGTTCTTTTTTAAACACTTAGTCA
+HWUSI-EAS1795_0092:3:1:17383:2097#0/1
cefcfffgffcfdffffggfggggdggfcffcg
@HWUSI-EAS1795_0092:3:1:19289:2099#0/1
CTGCTGCGCCGTGTTAAGGAGGATGTGCTGAAG
+HWUSI-EAS1795_0092:3:1:19289:2099#0/1
hhhhhhhhhhhhfhghdhgdghdehehgghheg
@HWUSI-EAS1795_0092:3:1:19550:2104#0/1
GCAAGAAACAGGGCGCTAAGTTGGTCGCCGGTG
+HWUSI-EAS1795_0092:3:1:19550:2104#0/1
fggggfffcfffgdggeff]df_fcfffcfc`f
@HWUSI-EAS1795_0092:3:1:19698:2094#0/1
TCCGCTTGAAAATCTCGCAGCATGGTCGCCAAC
+HWUSI-EAS1795_0092:3:1:19698:2094#0/1
ghhhahhgghhhhhhhhfhfhgghhcgcffffh
@HWUSI-EAS1795_0092:3:1:2406:2112#0/1
AATCAACCGCCGGCCGCCACGCAACGATCAGCA
+HWUSI-EAS1795_0092:3:1:2406:2112#0/1
gdhhchhhghhhdhhdhhahdcfhhgddhadaf
@HWUSI-EAS1795_0092:3:1:3309:2112#0/1
CGCGGCGCAAAAAATCTTCGCGGCACTTGGAGT
+HWUSI-EAS1795_0092:3:1:3309:2112#0/1
hghhhhhhhhghhhcfhhhfhghghfhgfhhgf
@HWUSI-EAS1795_0092:3:1:3495:2113#0/1
CAATTTCCGATTAGCCTAACAAAATGGCTAACA
+HWUSI-EAS1795_0092:3:1:3495:2113#0/1
fggggfgggdfgacfffgggegggggcfggagS
@HWUSI-EAS1795_0092:3:1:3852:2110#0/1
TCCGTTTCCTGTATTCTTATTCCTGTATTTGAA
+HWUSI-EAS1795_0092:3:1:3852:2110#0/1
hhhhhhhhhhghhhhhhhhhhgghfhhhhhgeh
@HWUSI-EAS1795_0092:3:1:3950:2107#0/1
GCCAGCTTGTAATGATCCTTGTCGTACAGCACG
+HWUSI-EAS1795_0092:3:1:3950:2107#0/1
hhhhhhhhhhhhhhghhhhhghhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:4397:2106#0/1
TAAACTTCAACTCAATCAGCAATTGCGAACATA
+HWUSI-EAS1795_0092:3:1:4397:2106#0/1
hhhghhhhhhhhhhhgghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4677:2108#0/1
CGTGCTGCTTGGGATATGGGGTCGCCTTTAGGC
+HWUSI-EAS1795_0092:3:1:4677:2108#0/1
hhdghghhhhhhhghhhehfghhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:4759:2107#0/1
GTTAAATAAACATTTATCGTTTTTGTTTTGTTT
+HWUSI-EAS1795_0092:3:1:4759:2107#0/1
cfffdff]Z[Z\fcf_fffcffffacccccccg
@HWUSI-EAS1795_0092:3:1:5172:2111#0/1
GGCCAAGGTGCAGCGTGCCGTGTGCATGTTGTC
+HWUSI-EAS1795_0092:3:1:5172:2111#0/1
gggggggggggefaff^dfffffgfggggfegg
@HWUSI-EAS1795_0092:3:1:5283:2114#0/1
GCTGTATTGAGCTGTAATTCGACTTCTTCTTCT
+HWUSI-EAS1795_0092:3:1:5283:2114#0/1
acedc\ecccaacedc\ddfd[eceddfafaff
@HWUSI-EAS1795_0092:3:1:6652:2109#0/1
GTTGTACTTGGCACGCGGGGCGGGAACGGCCAC
+HWUSI-EAS1795_0092:3:1:6652:2109#0/1
hghchhhhhfhhfhfhffhhhhhhgeghfhhfc
@HWUSI-EAS1795_0092:3:1:7579:2110#0/1
CTGGCATTGCACCACTATGATGGTTGAGTCCGA
+HWUSI-EAS1795_0092:3:1:7579:2110#0/1
gcggefgggcgggfcdacfccffffffgggcga
@HWUSI-EAS1795_0092:3:1:8911:2107#0/1
TTCACATCGCGCTTCTTCAACAAGAAGGCGTTG
+HWUSI-EAS1795_0092:3:1:8911:2107#0/1
ggggffcgggggegaggggfdggggggffggfg
@HWUSI-EAS1795_0092:3:1:9588:2109#0/1
TCGACGGATACGAATGCTAAATGCAGACGAGGC
+HWUSI-EAS1795_0092:3:1:9588:2109#0/1
hhhhhhhghhhhhhghgghhhchgfhhefhhhh
@HWUSI-EAS1795_0092:3:1:9700:2107#0/1
GTTCGTCGCTTTGGTCAAAACTGCCTAATCCAG
+HWUSI-EAS1795_0092:3:1:9700:2107#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:9776:2111#0/1
AGAAGACCCAGCTGGGAGCCAAGGGAGTTCCTT
+HWUSI-EAS1795_0092:3:1:9776:2111#0/1
hghgahhhhhghhfhhfhghhhggfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10364:2108#0/1
GCTGAATTTTGGGGGCCTTGGAGGTGGCCTTCT
+HWUSI-EAS1795_0092:3:1:10364:2108#0/1
hhhhhhhhhhghhhhhhhhhhchhghghhhhhh
@HWUSI-EAS1795_0092:3:1:10816:2107#0/1
CCGGCAGCAAGAATGCTCGGACCGTGGATCCAT
+HWUSI-EAS1795_0092:3:1:10816:2107#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhcc
@HWUSI-EAS1795_0092:3:1:11185:2115#0/1
CAAGGATGGTCTGATCATCAAGAAGCCCGTCGT
+HWUSI-EAS1795_0092:3:1:11185:2115#0/1
gfgggeggggcggggggggfgcfggggdWfffg
@HWUSI-EAS1795_0092:3:1:11337:2115#0/1
TTTCAATGCTTGCTCAAATACTTCAAACCAGCA
+HWUSI-EAS1795_0092:3:1:11337:2115#0/1
hhhhhhhhhhhhghhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:11386:2115#0/1
TTGAATCGTTTTTTTCACCACATTCATTTGTTC
+HWUSI-EAS1795_0092:3:1:11386:2115#0/1
ggfffgggggdggggeggggg[dffcfggcggg
@HWUSI-EAS1795_0092:3:1:11599:2105#0/1
CTGGGACCAGCTGGTCAGCGAGGAGGAAAAGAT
+HWUSI-EAS1795_0092:3:1:11599:2105#0/1
hhghhhhhhhhhhhghhhhhghhhhhhhhchhh
@HWUSI-EAS1795_0092:3:1:11735:2111#0/1
GTGGGCGCTACTTGTGCCAGCACATGGAGAACC
+HWUSI-EAS1795_0092:3:1:11735:2111#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:12083:2111#0/1
GGGAACTGGACGCTTGCGACCTCCGCGGCGAAC
+HWUSI-EAS1795_0092:3:1:12083:2111#0/1
ggggggfffffffggggfgggfgggeegdggge
@HWUSI-EAS1795_0092:3:1:12476:2111#0/1
GGCGAGTGTAGTACTTCTCGATGATGACCTTAG
+HWUSI-EAS1795_0092:3:1:12476:2111#0/1
ggggggefdfdcggggcgggg]ggagggggfcg
@HWUSI-EAS1795_0092:3:1:13032:2113#0/1
GCGCAGCGCTCCTGGAGGCTGATGTGAATATCC
+HWUSI-EAS1795_0092:3:1:13032:2113#0/1
hhhhghfhghghhhhhghghdchgfhhghgghh
@HWUSI-EAS1795_0092:3:1:13179:2113#0/1
AAGCAGCTGATCGTTGGTGTGAACAAGATGGAC
+HWUSI-EAS1795_0092:3:1:13179:2113#0/1
caccc[_ZZaS\acc_aUZNWZaaa[][a]a[]
@HWUSI-EAS1795_0092:3:1:13838:2113#0/1
TCGATGGCCACGATGGCGCGGGCCGCCAGCTGC
+HWUSI-EAS1795_0092:3:1:13838:2113#0/1
hhhhhhghhhhhhhhhhfgehhhgghhhghhhg
@HWUSI-EAS1795_0092:3:1:14032:2112#0/1
CAGGAGAAGGAGAATCTACTCTCACAGGGTTTC
+HWUSI-EAS1795_0092:3:1:14032:2112#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14872:2115#0/1
CTCGTTTATGACATGAGGGGTTGTTTGCTATGC
+HWUSI-EAS1795_0092:3:1:14872:2115#0/1
hhhghhhhhhhhhhhghhhhhhghhhffhhgfc
@HWUSI-EAS1795_0092:3:1:15399:2116#0/1
CAAGCGGTCAACTACATTCACCAACACGGTGTC
+HWUSI-EAS1795_0092:3:1:15399:2116#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:15778:2106#0/1
GCGCGGTCAACTGACCGAGGGAGTCAGCGATCT
+HWUSI-EAS1795_0092:3:1:15778:2106#0/1
geggcgegggaffffcfcff__d]]ddgggggd
@HWUSI-EAS1795_0092:3:1:16007:2106#0/1
CGCCGCCAATGCGCACCTGCGCCTGCAACTTCT
+HWUSI-EAS1795_0092:3:1:16007:2106#0/1
hhhhhhhhhhhhhhehhhhhfghggehgdhhhg
@HWUSI-EAS1795_0092:3:1:16050:2109#0/1
TTCTTGTTCTTGAACTTGGTGAGCAACTCGGTG
+HWUSI-EAS1795_0092:3:1:16050:2109#0/1
hhhhYhhhhghhfhhhhhhhfchgghghfhghh
@HWUSI-EAS1795_0092:3:1:17483:2113#0/1
CGGGGGCAAGTATCAACTATTTCCTACTGTTTT
+HWUSI-EAS1795_0092:3:1:17483:2113#0/1
hhhhhhghhhhhhhhhhfhhhhhhhhghfhhhh
@HWUSI-EAS1795_0092:3:1:17538:2113#0/1
CTCGGAAATCATCGTAGGACAGGTCGAATAGCG
+HWUSI-EAS1795_0092:3:1:17538:2113#0/1
fddfdfffddfffgggegggcgfddffdcfffg
@HWUSI-EAS1795_0092:3:1:17584:2113#0/1
TATCACGCTGCGCAATCCCATGTTCCATCAGGG
+HWUSI-EAS1795_0092:3:1:17584:2113#0/1
gggggggffffd]ffffgggggccdcffafffd
@HWUSI-EAS1795_0092:3:1:17894:2110#0/1
GCGGATCTGACTGCAAGTGCGGCGGCGACAAGA
+HWUSI-EAS1795_0092:3:1:17894:2110#0/1
gfggcgggcfaefffffggggfggggf]affcd
@HWUSI-EAS1795_0092:3:1:17912:2114#0/1
GCTTTTGGGCTCCGGGGGAAGTATGGTTGCAAA
+HWUSI-EAS1795_0092:3:1:17912:2114#0/1
ggggggggggggggggggaggeggggggggggg
@HWUSI-EAS1795_0092:3:1:17961:2106#0/1
GTCTCAGCCCTGCCACTAGTGGATTCCGATGGT
+HWUSI-EAS1795_0092:3:1:17961:2106#0/1
hhhhhhfhhhhhhhhhhhhhhhghhhghhhhhg
@HWUSI-EAS1795_0092:3:1:18487:2110#0/1
ATAGACTGCTACTTCAAAGGCCAAATGGACTTT
+HWUSI-EAS1795_0092:3:1:18487:2110#0/1
hhghhhhhhhhhhhhhhhhhdhgchfhghhhhh
@HWUSI-EAS1795_0092:3:1:19368:2111#0/1
CGGTGGTGGTGAAAGAGTAACCGCGCTCGGTCA
+HWUSI-EAS1795_0092:3:1:19368:2111#0/1
hhhhhhdffcffhhgfhhhhhhfhghehghfhh
@HWUSI-EAS1795_0092:3:1:19624:2115#0/1
GTTCCTTTCCTGGTTACACACGACGGTCGCACC
+HWUSI-EAS1795_0092:3:1:19624:2115#0/1
ffefgggggggffggfggggggggggggdegcg
@HWUSI-EAS1795_0092:3:1:1966:2121#0/1
TTCAATTAATTAGAGCACATTAGCGGAAAATAT
+HWUSI-EAS1795_0092:3:1:1966:2121#0/1
hhhhhgfhghhdhghhhhhhhghhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:2049:2118#0/1
CGTGCACAAGAAGACCCTGGGAGTCGTGCCAGC
+HWUSI-EAS1795_0092:3:1:2049:2118#0/1
ffgggfgggfggfgggggfggggggggfggggg
@HWUSI-EAS1795_0092:3:1:2327:2122#0/1
GTGAAGAGCCCGTCGGTGTCGGATGTGGAGATC
+HWUSI-EAS1795_0092:3:1:2327:2122#0/1
hhhhhhfhhhhfhhhheebceecaffff[d`ba
@HWUSI-EAS1795_0092:3:1:2639:2124#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:2639:2124#0/1
hghhghfhhhgh[f_ffghhggcfheehbh]af
@HWUSI-EAS1795_0092:3:1:2726:2125#0/1
CTGGCCCAGAACGAGGTGAACATGAAGTCCAAC
+HWUSI-EAS1795_0092:3:1:2726:2125#0/1
hhhggghhhhhhhhghechhhhhhhfhggfhhg
@HWUSI-EAS1795_0092:3:1:2890:2124#0/1
CTGGCTGACATATTTACAAAACCGTTGCCTGCT
+HWUSI-EAS1795_0092:3:1:2890:2124#0/1
dcf[fdacdf_ffeggggafg`ffe[edff_fd
@HWUSI-EAS1795_0092:3:1:3096:2127#0/1
GTTCCACATTTAATCCTTGCTCTGCATGTACTT
+HWUSI-EAS1795_0092:3:1:3096:2127#0/1
a^\O\_\cacacPZSP^\^XaPa]R]aYYNNY_
@HWUSI-EAS1795_0092:3:1:3434:2126#0/1
GCCGCGTAAAGGAAAATGAGCGATTGCTGAAGG
+HWUSI-EAS1795_0092:3:1:3434:2126#0/1
ffddfdffgggg_ggggegggfagggggfe_gg
@HWUSI-EAS1795_0092:3:1:3586:2123#0/1
CCCGTATTTGGGAAGCTCATGGGAATAAGCAGC
+HWUSI-EAS1795_0092:3:1:3586:2123#0/1
hhhhhhhhhhhhhhhhhhhhhhhgghhhhhhfh
@HWUSI-EAS1795_0092:3:1:4117:2120#0/1
GCTGGGGATAATGGCTGGTGCTGCTGCTGCTGT
+HWUSI-EAS1795_0092:3:1:4117:2120#0/1
c[ccccc_cccccccccV]aT`BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4252:2120#0/1
GGGTTTTCTAGTTTAATGTTAATACTAGTTAAT
+HWUSI-EAS1795_0092:3:1:4252:2120#0/1
fgfddffa__edgfggg_ffffggaggfgfgfg
@HWUSI-EAS1795_0092:3:1:4578:2122#0/1
AAACACGATTGAACTGGAAATCCGCCAGGACTA
+HWUSI-EAS1795_0092:3:1:4578:2122#0/1
fhhhghhdfhhfghhhfdhhhfhhhgfhfhhah
@HWUSI-EAS1795_0092:3:1:5061:2123#0/1
ATCTAGCCGGTCGCGATTTAACCGACTACCTGA
+HWUSI-EAS1795_0092:3:1:5061:2123#0/1
afdgfdgggcgeaffffffaffggc_gggeg_`
@HWUSI-EAS1795_0092:3:1:5195:2117#0/1
CTGGCGCACAAGAAGCCGCGTATGATTCTCGTC
+HWUSI-EAS1795_0092:3:1:5195:2117#0/1
_ggdfggggggggfdgggdgfdfffffffdfff
@HWUSI-EAS1795_0092:3:1:5927:2117#0/1
GAGAACTTATGTTGTCGCCACATATGGTTATTG
+HWUSI-EAS1795_0092:3:1:5927:2117#0/1
hhhhhhhhhhhhhhhhhchhghghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5952:2128#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5952:2128#0/1
gggggf_ffffada]ffafaff]dfffgagggg
@HWUSI-EAS1795_0092:3:1:6404:2127#0/1
TTTCTCTTGGGTGGCATTGGCTTTTCCTTGCGA
+HWUSI-EAS1795_0092:3:1:6404:2127#0/1
hhhhhhhhhfhhgfhhhhhhgghhhhhhhehhh
@HWUSI-EAS1795_0092:3:1:6962:2126#0/1
CTTACAAAATGTGTGACGAAGAAGTTGCTGCTC
+HWUSI-EAS1795_0092:3:1:6962:2126#0/1
gggggggdcffdfcfffggggfgfgggggcfeg
@HWUSI-EAS1795_0092:3:1:7118:2121#0/1
CGGTGTTTAACTTTCCTTTTTCATTCCATTGCG
+HWUSI-EAS1795_0092:3:1:7118:2121#0/1
hhhhehhhhghhhhhhhhhhhhfhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:7235:2127#0/1
CTGCGTCGTGGCCAGGTGGCAGTTGGCTCCAAG
+HWUSI-EAS1795_0092:3:1:7235:2127#0/1
ggggggggggggggggfggffgggggggggggg
@HWUSI-EAS1795_0092:3:1:7408:2122#0/1
ATTATTGAGTGGTGTTGTTGGCTGCATTATGAT
+HWUSI-EAS1795_0092:3:1:7408:2122#0/1
hhhhhhhghhhghhhhghhhhhhhhhhhegfah
@HWUSI-EAS1795_0092:3:1:7511:2124#0/1
GTGCGCTTCAACGTCCTGAAAGTCAGCAAGGGT
+HWUSI-EAS1795_0092:3:1:7511:2124#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhghhhhhg
@HWUSI-EAS1795_0092:3:1:7625:2124#0/1
TATACTTTGAGGACAATGCCGGGGTAATAGTAA
+HWUSI-EAS1795_0092:3:1:7625:2124#0/1
__fffff\effcceeeegggggffeafdec`ce
@HWUSI-EAS1795_0092:3:1:8189:2118#0/1
GTTGTACTTGTTCTTGTCCTGAAATGTTAGGCG
+HWUSI-EAS1795_0092:3:1:8189:2118#0/1
hhhhhhhhhhhhhhhhhhhgdhhhhfhghhhhh
@HWUSI-EAS1795_0092:3:1:8417:2125#0/1
TGGCGATAACAAATGGAACCCAGACGAACAAAC
+HWUSI-EAS1795_0092:3:1:8417:2125#0/1
fffff_f[c`da_c_f]cdea`YVY[\b`ab`c
@HWUSI-EAS1795_0092:3:1:8536:2117#0/1
TGTTGCTGCTGCTGCTGCTGTTGTTGTTGTAGA
+HWUSI-EAS1795_0092:3:1:8536:2117#0/1
ggggggggggggggegg_gfggaffdfdcfdfa
@HWUSI-EAS1795_0092:3:1:8720:2126#0/1
GAAAAATCTTGTATTGGCCATTTCGTTCGGAAA
+HWUSI-EAS1795_0092:3:1:8720:2126#0/1
fegggggggggggcgggggegggdgggggfggf
@HWUSI-EAS1795_0092:3:1:9140:2120#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9140:2120#0/1
hhhhgchhhgggfhfhhehhhhghhhhgghhhh
@HWUSI-EAS1795_0092:3:1:9196:2120#0/1
GCGAAAGATTAAACTGCGCAGCTAGACGCGAAC
+HWUSI-EAS1795_0092:3:1:9196:2120#0/1
hhhhhhhhhhhhhhhgghhhfhahhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9245:2126#0/1
GGAGGATGACTTGGGCGGAGTTTGGGGCACCTG
+HWUSI-EAS1795_0092:3:1:9245:2126#0/1
hhhhhhdfhhhhghhhhhehhhhhhhhhhhhah
@HWUSI-EAS1795_0092:3:1:9357:2121#0/1
TGGGCAGCTGAAAAGAGTAGATTCACGATGGAC
+HWUSI-EAS1795_0092:3:1:9357:2121#0/1
ccac[YcZ\a_^aXaV\aaaVV\[\Yac]]]_[
@HWUSI-EAS1795_0092:3:1:9848:2127#0/1
GGGTTCGATTCCGGAGAGGGAGCCTGAGAAACG
+HWUSI-EAS1795_0092:3:1:9848:2127#0/1
ghhhhhhhhhhhhfcachggahhhhhffhhhhh
@HWUSI-EAS1795_0092:3:1:11306:2125#0/1
CGAGGAACGGAAACGCAAGAAGGAAGCGCGTCT
+HWUSI-EAS1795_0092:3:1:11306:2125#0/1
hhhhhhhhhhhhhdghhhdhhffhhfhgghhgh
@HWUSI-EAS1795_0092:3:1:11530:2120#0/1
CGCCAGCATTATTGTTACGATTTATGTTGTTAT
+HWUSI-EAS1795_0092:3:1:11530:2120#0/1
]dbbdddWdcccdddddf_Wfffcfffdfffff
@HWUSI-EAS1795_0092:3:1:12364:2121#0/1
CTGACAACTTCAAGTTCGGCGAGACCAACAAGT
+HWUSI-EAS1795_0092:3:1:12364:2121#0/1
hhhhhhhhhhhhhfhhhhehhhahhgdhhhhdg
@HWUSI-EAS1795_0092:3:1:12460:2118#0/1
CTTATCGTCGTTGGAGCTGATTCTGAAGTAGCG
+HWUSI-EAS1795_0092:3:1:12460:2118#0/1
ggggffgffcffagcgggggggd]fffgeaggg
@HWUSI-EAS1795_0092:3:1:12581:2120#0/1
AGCTTCTCAAAGCTGATGTCGTGCGCCGTGTAG
+HWUSI-EAS1795_0092:3:1:12581:2120#0/1
egfgggggggagfdf[dfccffgfggdfaf[ff
@HWUSI-EAS1795_0092:3:1:13451:2120#0/1
TGTGAACTGAAACTGTTCACATGAACTTGGAAT
+HWUSI-EAS1795_0092:3:1:13451:2120#0/1
aScacccd^cdd]f_ffdfffdaf]ffffdfff
@HWUSI-EAS1795_0092:3:1:13611:2128#0/1
GAAAATGCATATTCTGCCATTCCACACACACAC
+HWUSI-EAS1795_0092:3:1:13611:2128#0/1
ggfggggfgfegffggggggggeggggggggfg
@HWUSI-EAS1795_0092:3:1:13895:2126#0/1
AATTCGTTGAGTTTTCGCCCTGCGAGAATTACC
+HWUSI-EAS1795_0092:3:1:13895:2126#0/1
hhhhhhhhhhghhhhhhhhhfggggghhhhghh
@HWUSI-EAS1795_0092:3:1:14289:2125#0/1
CGAGCATTCATATATCGTAACAATCGGTTATGT
+HWUSI-EAS1795_0092:3:1:14289:2125#0/1
gggfa^g\f^fc^fc_f[ec`dff_f_ffffcf
@HWUSI-EAS1795_0092:3:1:15136:2128#0/1
CCCCGTCCCTCCTCCTGAACGGTTTGCGCTGCC
+HWUSI-EAS1795_0092:3:1:15136:2128#0/1
dcccddff_cccVea_`dff]cffddW\^]\a`
@HWUSI-EAS1795_0092:3:1:16034:2127#0/1
CTACGCTATGCTGGCCAAGACTGAAGTCCAGCA
+HWUSI-EAS1795_0092:3:1:16034:2127#0/1
hhhhhghhhhhhhhhhhghhhhhhhghhhhfgh
@HWUSI-EAS1795_0092:3:1:16123:2127#0/1
CACCAATCGTTATCACCAGCATTTGGGCCTTCA
+HWUSI-EAS1795_0092:3:1:16123:2127#0/1
ggggggggggfggcgggggcfggggfggggggg
@HWUSI-EAS1795_0092:3:1:17283:2120#0/1
CCTGGTGCCAGAGTACAAAACCCAAACATCTAC
+HWUSI-EAS1795_0092:3:1:17283:2120#0/1
hafffcfhhhhgeehhfhhhhhhghhhhfhhgf
@HWUSI-EAS1795_0092:3:1:17393:2126#0/1
GAAATTCGTCGATGGCCTGATGATCCACTCGGG
+HWUSI-EAS1795_0092:3:1:17393:2126#0/1
hhhhhhhghhghhhhhhhhhhhfhhghhhhahh
@HWUSI-EAS1795_0092:3:1:17879:2125#0/1
CTTGGTCAATGGGGGGCCAACTCCGCCGGCCAG
+HWUSI-EAS1795_0092:3:1:17879:2125#0/1
hhhhhhhhhhhhhhehhhhghhhehhghhhheh
@HWUSI-EAS1795_0092:3:1:18162:2124#0/1
ACGGTGCGGATGCCTGACGCCAACAGCAGCAGC
+HWUSI-EAS1795_0092:3:1:18162:2124#0/1
geggfegcffccggfecgcggfdddffffcfag
@HWUSI-EAS1795_0092:3:1:18210:2119#0/1
GTTCAGGGAGAAGTTCCAGAGGAGTCCCGGCAT
+HWUSI-EAS1795_0092:3:1:18210:2119#0/1
bZ^\\aaYSVSUMPQ]QYaa\\VWSXUaaa[[Q
@HWUSI-EAS1795_0092:3:1:18827:2124#0/1
GCCAACAGTTACCACCTTCCGCGAAGGATCTTT
+HWUSI-EAS1795_0092:3:1:18827:2124#0/1
gfhhhhgghhhhhfhhhhhhhhfghhhhhhhhf
@HWUSI-EAS1795_0092:3:1:19022:2119#0/1
TCGGTCACTACCTGGGCGAGTTCGCCCTGACCT
+HWUSI-EAS1795_0092:3:1:19022:2119#0/1
eggggffgggggf]ffffdffWffffd]ggggg
@HWUSI-EAS1795_0092:3:1:19650:2124#0/1
TGTTTTCCCGTCCCTTCCGAAAGCATGGAGTTA
+HWUSI-EAS1795_0092:3:1:19650:2124#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhhhhghhgc
@HWUSI-EAS1795_0092:3:1:19745:2119#0/1
CTCTTGGATCGCAGTGATCCCTCTAAGCGCACT
+HWUSI-EAS1795_0092:3:1:19745:2119#0/1
hhhhhghhhhhhghhfhhhhhehhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:2443:2129#0/1
GTTCTTTTTGCGCTTTGGGAAATATCTTCTTTA
+HWUSI-EAS1795_0092:3:1:2443:2129#0/1
cZdddd`cccdffdfc[ffcfff]ffdffffdc
@HWUSI-EAS1795_0092:3:1:3079:2137#0/1
GACATATACTGTTGTGTCGATATTTTCTCCTCG
+HWUSI-EAS1795_0092:3:1:3079:2137#0/1
gcggagggggagfafffdffffgggggfggggg
@HWUSI-EAS1795_0092:3:1:3568:2135#0/1
CGTGGGGTCTTGAAACCGAGTCCCACATCGCGG
+HWUSI-EAS1795_0092:3:1:3568:2135#0/1
hhhhhghhhhhhhhhhhhhfhhhhhhhahhhhh
@HWUSI-EAS1795_0092:3:1:3990:2135#0/1
CCGATCTGTGGAAGGAGATGCCTCTGGGCTCCA
+HWUSI-EAS1795_0092:3:1:3990:2135#0/1
hhhhhhhfhfhhhhhgchfhhgdhhhhfhhhhf
@HWUSI-EAS1795_0092:3:1:4140:2138#0/1
AGCGGTTGTTGTTGTTGTTGTTGTTGTGCTTGT
+HWUSI-EAS1795_0092:3:1:4140:2138#0/1
acfffdfcffcffaffaff`cfV]`^]aaff_d
@HWUSI-EAS1795_0092:3:1:4305:2129#0/1
CTCGGAGGAGTCCATCTTGTTCACACCAACGAT
+HWUSI-EAS1795_0092:3:1:4305:2129#0/1
gcfdf_dfccfccceccecdc^fffddfcfffZ
@HWUSI-EAS1795_0092:3:1:4341:2130#0/1
CTTCCCTAAACATGTTACATATTCGTAGTTTGT
+HWUSI-EAS1795_0092:3:1:4341:2130#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:4484:2135#0/1
TTACGGGTGGTGATGCGAAGGGTCTTGGTCGGC
+HWUSI-EAS1795_0092:3:1:4484:2135#0/1
hhhhhhhhhhhhhhhcfhfhfhgfhhfcffffg
@HWUSI-EAS1795_0092:3:1:4881:2129#0/1
GTCGGGATTGGGTGCACTGAGCAGTGCCTGAAT
+HWUSI-EAS1795_0092:3:1:4881:2129#0/1
hhhhhhaehhhhhhhhhhhhhhhhhfhdhhfgf
@HWUSI-EAS1795_0092:3:1:5074:2140#0/1
TCACTGCCCACGCCCACCTTGGAGTTGAATCAG
+HWUSI-EAS1795_0092:3:1:5074:2140#0/1
hhhhhghhhhhhhhhhhhhhfhchhhhghhhhh
@HWUSI-EAS1795_0092:3:1:5110:2138#0/1
CCAGTACTTGGACAAGTTGTAAAGCACCACCAC
+HWUSI-EAS1795_0092:3:1:5110:2138#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:6088:2137#0/1
AGCCAGTCTATGGAGAACCTTACGCCGGAACGT
+HWUSI-EAS1795_0092:3:1:6088:2137#0/1
fhhhfhhhhdhhfghhfhhhhhhhgffcfffhd
@HWUSI-EAS1795_0092:3:1:6178:2131#0/1
GCAGGTTGTTGGTGTGTCCGCACTTCTTCTTGC
+HWUSI-EAS1795_0092:3:1:6178:2131#0/1
gggggggggggggggggggggeggggggggggf
@HWUSI-EAS1795_0092:3:1:6211:2133#0/1
GTTGGTCATGAACTTGCGGGTGCGGATGGTAGC
+HWUSI-EAS1795_0092:3:1:6211:2133#0/1
gggggggcgggfggggfggggggggggffggaf
@HWUSI-EAS1795_0092:3:1:6282:2140#0/1
AGCATGGGCAGTCAGTTGGTAATCGACGATCGT
+HWUSI-EAS1795_0092:3:1:6282:2140#0/1
a^da[[W\ZYaYa^^ccaKaacSZTWXcffWQ\
@HWUSI-EAS1795_0092:3:1:6357:2130#0/1
CGCAAATATGGCCAAGGCTCCCGATGCTGCCGT
+HWUSI-EAS1795_0092:3:1:6357:2130#0/1
fhehhhhfghhhhfhdcfcffffdddf_fffeg
@HWUSI-EAS1795_0092:3:1:6575:2135#0/1
GCGGATTCGGAAAGCGTAAGGGTACTGCGAACG
+HWUSI-EAS1795_0092:3:1:6575:2135#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:6602:2134#0/1
GAAAGAACAGACGTGGAATTTTGCTGTGCTGGT
+HWUSI-EAS1795_0092:3:1:6602:2134#0/1
hhhhhhhhhhhhghgghhhhhhggghhhfhhgh
@HWUSI-EAS1795_0092:3:1:6798:2132#0/1
CTTGCACGCATCTTTCTGCGCTTACGCTTCAAC
+HWUSI-EAS1795_0092:3:1:6798:2132#0/1
ffaffafefgdgdfggcggggggecggafaaff
@HWUSI-EAS1795_0092:3:1:7039:2131#0/1
GGCGGTGTCAGATTTTGAGGCTTGCGTCGCTTC
+HWUSI-EAS1795_0092:3:1:7039:2131#0/1
gggggcgggggdfggggfdf_feWRd\_a^aac
@HWUSI-EAS1795_0092:3:1:7334:2131#0/1
CCGGAAACGGAGCCATGTCCCAGTCCAAGCTGA
+HWUSI-EAS1795_0092:3:1:7334:2131#0/1
hhhhhhhhhhhhhhhghhhhhhhghhhghhdhh
@HWUSI-EAS1795_0092:3:1:7366:2131#0/1
CTTGTTTTCGTCGTCGGGATAAATGATAATCTC
+HWUSI-EAS1795_0092:3:1:7366:2131#0/1
gggggggggfgggffggfcaagf]ac[fffffg
@HWUSI-EAS1795_0092:3:1:8186:2138#0/1
AAGCGACAAAAGAATATTAAATCGGCTCTGCCG
+HWUSI-EAS1795_0092:3:1:8186:2138#0/1
hhhhhhhhhhhhhhhhhhhhhchhhghhhghhh
@HWUSI-EAS1795_0092:3:1:8442:2136#0/1
GCTCTTTCTCGAATCTATGGGTGGTGGTGCATG
+HWUSI-EAS1795_0092:3:1:8442:2136#0/1
f^ggcgfffggfegegfffffWe__eeccccca
@HWUSI-EAS1795_0092:3:1:8552:2131#0/1
CGCTCTTCTACAAGTTCTTCTTTGGCGGTGCCA
+HWUSI-EAS1795_0092:3:1:8552:2131#0/1
ghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9118:2136#0/1
GGCGAACTTGCGGATCTCCTTGATGGCGCGGGG
+HWUSI-EAS1795_0092:3:1:9118:2136#0/1
gggggggggdgggggggggggdddfffcfffcg
@HWUSI-EAS1795_0092:3:1:9502:2139#0/1
GCAGAGAAGAATATGATGCGACTGTGAGCATTG
+HWUSI-EAS1795_0092:3:1:9502:2139#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:9641:2135#0/1
CAAAGCCACCCAAAACCGCCTCCCATTTGTCCG
+HWUSI-EAS1795_0092:3:1:9641:2135#0/1
ghhhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9741:2132#0/1
TTCATTTGCCGTCGCCAGTGGTTGCCCAGAAGT
+HWUSI-EAS1795_0092:3:1:9741:2132#0/1
hhhhhhhhhhhghhhhdhhhhhhhhhhhghffe
@HWUSI-EAS1795_0092:3:1:10051:2137#0/1
GCGGCCACTCACCTAGAGCAGCCAGAGTCCTTG
+HWUSI-EAS1795_0092:3:1:10051:2137#0/1
hhhhhhhhhhhhhhhhhhfhhhhhhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:11234:2135#0/1
CGGCGTTCACGTTCAAGTCACATATCTAAAAGG
+HWUSI-EAS1795_0092:3:1:11234:2135#0/1
hhhhhhhhghhhhhhhhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11581:2134#0/1
CTCTTATCCTTGGGATCCACCGTTTCCCAATTT
+HWUSI-EAS1795_0092:3:1:11581:2134#0/1
hhhhhhhhhehhhhhhhhhhhhhhhhfhhhhhg
@HWUSI-EAS1795_0092:3:1:11829:2140#0/1
GTTTCTCGAGGAGCTGGACAAGGCCGAGCAGAA
+HWUSI-EAS1795_0092:3:1:11829:2140#0/1
V\a[\_a\\\\_W^_W\Z\Y\\dddaS_^BBBB
@HWUSI-EAS1795_0092:3:1:11847:2131#0/1
CAACAAGGGCGAAATGAAGGGCTCGGCCATCAC
+HWUSI-EAS1795_0092:3:1:11847:2131#0/1
effcgdggfaggcgfgdfaacfaffffafcffg
@HWUSI-EAS1795_0092:3:1:11959:2136#0/1
GAGCTGCAATCTTAGTCTTCCGTTGCTCGTTTG
+HWUSI-EAS1795_0092:3:1:11959:2136#0/1
aScdaddafffffdfaccceeafa_fdffdfcf
@HWUSI-EAS1795_0092:3:1:12199:2132#0/1
TGGAGTAGTGGAGACTGCGCATCCTGCTGCATT
+HWUSI-EAS1795_0092:3:1:12199:2132#0/1
hhhhhghhhhhhfhhhhhfhfhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:12299:2134#0/1
CGCCGTGGCCACGGACGAGATTTTGCGGCTTTC
+HWUSI-EAS1795_0092:3:1:12299:2134#0/1
fcffddf^bdddca[cc]`[]bff]ff```bb^
@HWUSI-EAS1795_0092:3:1:12382:2133#0/1
CTTGGATCTGGCCTTTCTCCAGAGAGGTTTGGA
+HWUSI-EAS1795_0092:3:1:12382:2133#0/1
aaff^fdfdffffdff_effffff]f[fff_ag
@HWUSI-EAS1795_0092:3:1:12662:2132#0/1
GCCTTGCCTGGAGATCTGGCTGAGCAAGATTGT
+HWUSI-EAS1795_0092:3:1:12662:2132#0/1
ghhghhhhhghchhhhhhhhag_hhhhhghhch
@HWUSI-EAS1795_0092:3:1:12931:2133#0/1
TTGGGATCCATCTAGCATTTCTCCTCCTCCAGA
+HWUSI-EAS1795_0092:3:1:12931:2133#0/1
hhhhhhhhhhhhfhhhghhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:13291:2140#0/1
ATCCTCAGCTCGGAGCACTTAACCTTCACCATT
+HWUSI-EAS1795_0092:3:1:13291:2140#0/1
_gggffddfdfffcff[^bfdddafffaaffdg
@HWUSI-EAS1795_0092:3:1:14113:2140#0/1
CCCATGAAGGCCAGCTTGTCGGCAGGGGTCTGG
+HWUSI-EAS1795_0092:3:1:14113:2140#0/1
ghhhhhhhghhhhhghhchhgehhhhhheehhh
@HWUSI-EAS1795_0092:3:1:14387:2138#0/1
CAACATCTGGCACAGGTGCTCCAACACGTCCGT
+HWUSI-EAS1795_0092:3:1:14387:2138#0/1
gggdgcgg]ggggggggffcfffccfffefffc
@HWUSI-EAS1795_0092:3:1:14554:2137#0/1
CTGGGTATGATATGTCTTCTAATTGTCTGATGA
+HWUSI-EAS1795_0092:3:1:14554:2137#0/1
hhhhhhghhhghhhhhhhghhhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:14604:2131#0/1
ATGCTGTACGACAAGGAGCACCCGGTACATATT
+HWUSI-EAS1795_0092:3:1:14604:2131#0/1
fggfgggdfggfgfg_caffffggggggggggg
@HWUSI-EAS1795_0092:3:1:15222:2140#0/1
CGGTATTCGCCGTAACGAGAAGATCGCTGTCCA
+HWUSI-EAS1795_0092:3:1:15222:2140#0/1
hhghghfhhhhhhchhhceghfehhghhhghch
@HWUSI-EAS1795_0092:3:1:15252:2131#0/1
GCGGATATTGGTACGGCCTGTTGAGAAGTTTGC
+HWUSI-EAS1795_0092:3:1:15252:2131#0/1
hhhhghhhhhfhhhhghhhhhfchhhgfhhhhh
@HWUSI-EAS1795_0092:3:1:15273:2131#0/1
CTTACAAAAGAGTACATCCTCCAGTGTAATCTC
+HWUSI-EAS1795_0092:3:1:15273:2131#0/1
hhhhhhhghhhhhhhhhhhhhhhhhghffhhhh
@HWUSI-EAS1795_0092:3:1:16329:2137#0/1
GCCCAATCCCTTGGCTCCTGGCTCTCCTGGTCT
+HWUSI-EAS1795_0092:3:1:16329:2137#0/1
hhhhhhhhhhhhhehhhhfhhhghehhddhhhg
@HWUSI-EAS1795_0092:3:1:16460:2133#0/1
GCTTGAATCACTGTCGCCAGGGCCGCCTTCTGA
+HWUSI-EAS1795_0092:3:1:16460:2133#0/1
hhhhhghhhhhhhhhhhhhhhggghghhfhhhh
@HWUSI-EAS1795_0092:3:1:16599:2135#0/1
CCCAGATCTCAGGCGGAACCTGCGCCACGCCGG
+HWUSI-EAS1795_0092:3:1:16599:2135#0/1
ggfggfgggggggggggfggfgaffffgfggee
@HWUSI-EAS1795_0092:3:1:17548:2133#0/1
CACCAGTTCCTCCAGGTACTGATACCGCAGCTT
+HWUSI-EAS1795_0092:3:1:17548:2133#0/1
ca]cX_aWWY\^\MS\QPNOO]aaaT[ZZZZW[
@HWUSI-EAS1795_0092:3:1:17988:2135#0/1
GGAAAATTCGTTGGTTTTTTTGTTCTGTGCTGA
+HWUSI-EAS1795_0092:3:1:17988:2135#0/1
ggffcfegfggggggfggggggggggegfdgdb
@HWUSI-EAS1795_0092:3:1:18855:2133#0/1
ATTCTTTTGTTCTAGTTCTACGGTTTCCGGTTC
+HWUSI-EAS1795_0092:3:1:18855:2133#0/1
fcggggggggggggggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:19440:2139#0/1
GTCAACTTCAAGGATGCCTCCGGTGGCAAGGTC
+HWUSI-EAS1795_0092:3:1:19440:2139#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhhhhgdf
@HWUSI-EAS1795_0092:3:1:1184:2147#0/1
ATGAACTGTGCCGACAACACCGGAGCCAAGAAC
+HWUSI-EAS1795_0092:3:1:1184:2147#0/1
SdZaa^cddccSddL^aK`ZW`a]`b`fc_f]a
@HWUSI-EAS1795_0092:3:1:1413:2146#0/1
GCGGTAGTAGGTTTTGTGGTAGTGGTGCTAAAA
+HWUSI-EAS1795_0092:3:1:1413:2146#0/1
baaWafad\bbW`a^\[`bfdd\ZZO\eeeeef
@HWUSI-EAS1795_0092:3:1:1884:2148#0/1
GAACAAGAAGATACGCAATGCTCAGTTGGCCCA
+HWUSI-EAS1795_0092:3:1:1884:2148#0/1
f_fffafdfffaceddefdc[fgdgggggffgf
@HWUSI-EAS1795_0092:3:1:2096:2141#0/1
GTTCTATATTCGAAAATTTGCGCAACCCTCTCG
+HWUSI-EAS1795_0092:3:1:2096:2141#0/1
hhhhhhhhhhhhhfhhhhghhhhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:2396:2148#0/1
CTGTAGGGGAGGGCTGATTGGGAAATACCCTTG
+HWUSI-EAS1795_0092:3:1:2396:2148#0/1
hhhghhhhhhhhhhhghhhhhhhhhhghhhgga
@HWUSI-EAS1795_0092:3:1:2912:2140#0/1
GCCTCCAGGAGTGGTGGAGTAGAGGGTTCCGCC
+HWUSI-EAS1795_0092:3:1:2912:2140#0/1
eggggeggggggfccffcfaffggggggfgfdf
@HWUSI-EAS1795_0092:3:1:3307:2141#0/1
CGCGAACAGCTGCAGAGCCTGGCCATGCAGCAC
+HWUSI-EAS1795_0092:3:1:3307:2141#0/1
fdcffffggeafaWb`dffafcfe[ff_aafdc
@HWUSI-EAS1795_0092:3:1:3608:2152#0/1
TCTGCCCTGAGCTCCCTTGCGCTCCTTGGACTT
+HWUSI-EAS1795_0092:3:1:3608:2152#0/1
gggggggfggggggggfgfggfegggggggcgg
@HWUSI-EAS1795_0092:3:1:4220:2150#0/1
TTTGCATGTACTTGAGGCCCTGCAGATGGCTCT
+HWUSI-EAS1795_0092:3:1:4220:2150#0/1
hhhhhhhhhhhhhfhhhhhhhghghhhghhhhh
@HWUSI-EAS1795_0092:3:1:4992:2152#0/1
GCTGCTACACACACTCTGATCTGATCTGTATAC
+HWUSI-EAS1795_0092:3:1:4992:2152#0/1
ffadfdffffffgggggfdfffcgfgfgfgggg
@HWUSI-EAS1795_0092:3:1:5753:2150#0/1
GCAAAACAATGGAGGAGCACTGCGTAGTTCCGG
+HWUSI-EAS1795_0092:3:1:5753:2150#0/1
fdcafafff]ffd_dQffffff[fdafcffcfg
@HWUSI-EAS1795_0092:3:1:5909:2146#0/1
CGAGTACAACAAGCGCTTCTCCTCCCATTTCTT
+HWUSI-EAS1795_0092:3:1:5909:2146#0/1
ggfdffffffff[f_f]dffffaffX_fffffW
@HWUSI-EAS1795_0092:3:1:6231:2141#0/1
TTTGATTTTGCCTTTTGCAGAATTTCCAATGAC
+HWUSI-EAS1795_0092:3:1:6231:2141#0/1
hhhhghhhhhhhhhhhhhhfhfhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6988:2149#0/1
ATAGCTGTATCGTCGGCAAATGTGGATACCGTT
+HWUSI-EAS1795_0092:3:1:6988:2149#0/1
hhhhhhhhhhhhhhhhghhhgfhhhfghhhhhg
@HWUSI-EAS1795_0092:3:1:7544:2146#0/1
CTTTTGTAAGGAAGCTGCTGGTAATTTGATGTC
+HWUSI-EAS1795_0092:3:1:7544:2146#0/1
fffacZc`cfc[`^`^`bdde]fdffffffda`
@HWUSI-EAS1795_0092:3:1:7820:2146#0/1
GTCACGTAGTACTTGGCAGTTTCGAACTTCCAC
+HWUSI-EAS1795_0092:3:1:7820:2146#0/1
fffffffff]ffcf^cfff_fffcfffdfff_f
@HWUSI-EAS1795_0092:3:1:8655:2149#0/1
ATTTCAACTACCTAAAGCCCGGCTTCTCCAAAA
+HWUSI-EAS1795_0092:3:1:8655:2149#0/1
hhhhhhhhhghhhghhghhhhhhhhgghhhhgh
@HWUSI-EAS1795_0092:3:1:8732:2143#0/1
TTTCTGTACTGCAGTGTATGTATTTTTCAATCA
+HWUSI-EAS1795_0092:3:1:8732:2143#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:8799:2151#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8799:2151#0/1
ccaddaddcdddaaYccQZZZZPY\Y^fcfafa
@HWUSI-EAS1795_0092:3:1:9193:2152#0/1
CCCAAATCAATGCCGATCACTGTGCCCAGCTCC
+HWUSI-EAS1795_0092:3:1:9193:2152#0/1
hhhhhhhhhhhhhhhhghhhhchghhhhhhghh
@HWUSI-EAS1795_0092:3:1:9392:2141#0/1
GGGCTGGTGATCGGTGTTGGGGTCGGTCACCAC
+HWUSI-EAS1795_0092:3:1:9392:2141#0/1
hhhhhhhhhghhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9827:2146#0/1
GCGGCGGACTGAGTTCGCCATCACGCGGGGGTA
+HWUSI-EAS1795_0092:3:1:9827:2146#0/1
hhhghhhghhgahhggahhhgghhghhhhhh`f
@HWUSI-EAS1795_0092:3:1:10161:2150#0/1
CCGCGATCGAAGTAGTACTGCACGTGCCAGTTC
+HWUSI-EAS1795_0092:3:1:10161:2150#0/1
fhhhhghhghhhghfehhhhfhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:10562:2147#0/1
GCGCTTGTCGGGCATGTACATGTCCAGAGCCAA
+HWUSI-EAS1795_0092:3:1:10562:2147#0/1
ggcgfgagdggggegaggcggdggfeagcgcgg
@HWUSI-EAS1795_0092:3:1:10681:2146#0/1
GAAAAGACGATCATACAGAACCCCAGCGAGGCG
+HWUSI-EAS1795_0092:3:1:10681:2146#0/1
hhhhhghhhhhhdhhhhehhhhhhhhhhggdhh
@HWUSI-EAS1795_0092:3:1:11255:2151#0/1
CCAAAATGACGTCCCACGTCTCTGGGGTCAGCT
+HWUSI-EAS1795_0092:3:1:11255:2151#0/1
hhhhhghhhhhghghhhhhhhfghhhhhggahh
@HWUSI-EAS1795_0092:3:1:11933:2148#0/1
TGGTCTCCTCGACCGGGTGGTCGACGGCCTCCT
+HWUSI-EAS1795_0092:3:1:11933:2148#0/1
\aaccccccccccccccVc]\YYaBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12116:2150#0/1
GCGCTTTCGAGCAGTTTACAGCATGTTTAATGC
+HWUSI-EAS1795_0092:3:1:12116:2150#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:12722:2148#0/1
CTTCAGTGATGGACAACTGCGGGTTTGTCCTTG
+HWUSI-EAS1795_0092:3:1:12722:2148#0/1
hhhhhhhhhhfhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12812:2146#0/1
ATAGGATTGTATAAATGTATAACTGAGGATGAT
+HWUSI-EAS1795_0092:3:1:12812:2146#0/1
hhhhhhghghhhhhhhhhhhhhhhhhhhghgeh
@HWUSI-EAS1795_0092:3:1:13069:2147#0/1
CTGACAGCTTTTTTCGATATCTTTCGCAATCGA
+HWUSI-EAS1795_0092:3:1:13069:2147#0/1
ggcggggggggggggggfggdgggfggfggggg
@HWUSI-EAS1795_0092:3:1:13354:2147#0/1
GCGATGGCGCAGAGTAGCTGTGTGAGGAGGTCC
+HWUSI-EAS1795_0092:3:1:13354:2147#0/1
gggfgggggecggcgggfffafadfffcffdff
@HWUSI-EAS1795_0092:3:1:14900:2152#0/1
ACAAGCCCTACATCTCCCTGCCTAAGGGCAAGG
+HWUSI-EAS1795_0092:3:1:14900:2152#0/1
ggggecgggggfgfgdgg_eggggggffggggg
@HWUSI-EAS1795_0092:3:1:15006:2150#0/1
CCGGCATTTTCTGGCTCTCCTACCACTTGAAAA
+HWUSI-EAS1795_0092:3:1:15006:2150#0/1
fdadcafffddc`ffff_ggdggcgggggfggg
@HWUSI-EAS1795_0092:3:1:15171:2143#0/1
AGCGACGCCTCATGGAGAACGGCACGGATGCGT
+HWUSI-EAS1795_0092:3:1:15171:2143#0/1
ggdefffggedagcfcgggaaeffffcVY^^`b
@HWUSI-EAS1795_0092:3:1:15439:2151#0/1
CCATACTTCCCCCGGAGCCCAAAAGCTTTGGTT
+HWUSI-EAS1795_0092:3:1:15439:2151#0/1
gegggggggggfgggcfaffdfgegggfggggg
@HWUSI-EAS1795_0092:3:1:15855:2148#0/1
ATCAACCACTTGTGATTTCCGTACACCTCGGGA
+HWUSI-EAS1795_0092:3:1:15855:2148#0/1
gggggg_aedeefcafdfcffbfffffafffc[
@HWUSI-EAS1795_0092:3:1:16377:2150#0/1
CGACGAGCGGCGCTTGGCGGGCAACCGCCGGCG
+HWUSI-EAS1795_0092:3:1:16377:2150#0/1
hhhhhghgdhhdgdagdfgfgebdhhbeeccad
@HWUSI-EAS1795_0092:3:1:16510:2141#0/1
AGTTAATAGCAGATCTTGCCGCCGTCGTAGTAT
+HWUSI-EAS1795_0092:3:1:16510:2141#0/1
fggggggggefgggggggggggdffffdcfedg
@HWUSI-EAS1795_0092:3:1:16578:2146#0/1
CAGCAGCGTCCGGCGGTGACCAGGCACCACAGC
+HWUSI-EAS1795_0092:3:1:16578:2146#0/1
hhhhhhghhhhgghhhfhhhhhhhghghhfhhg
@HWUSI-EAS1795_0092:3:1:17411:2151#0/1
CGGATGTTGGATCCCGGGGTCCAAGGAGGTCGT
+HWUSI-EAS1795_0092:3:1:17411:2151#0/1
ggfKffbffffffgggggg_ggdfffdffddc_
@HWUSI-EAS1795_0092:3:1:17847:2141#0/1
ATTAACTAATATACTACGATGACAGCAACCTTT
+HWUSI-EAS1795_0092:3:1:17847:2141#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:18047:2150#0/1
GTTGCTGCCGGCATACTAATTTACCGAGTCCCC
+HWUSI-EAS1795_0092:3:1:18047:2150#0/1
ggggggggggggggggcedgggfgggggfgggf
@HWUSI-EAS1795_0092:3:1:18122:2142#0/1
TGTGACTCTGATTGATTTTTGGAAACATTTCCG
+HWUSI-EAS1795_0092:3:1:18122:2142#0/1
hhhhhhhhhhhghhghhhgfghfhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:18290:2141#0/1
CCGGATGCCGTGCGGAAGATGGATGGATGGATT
+HWUSI-EAS1795_0092:3:1:18290:2141#0/1
hhhhhhhhhhhhghhhgfffffghhhhfhcdff
@HWUSI-EAS1795_0092:3:1:18325:2145#0/1
AAGTACTACTACAGCAACGCGTAACCAATTGCC
+HWUSI-EAS1795_0092:3:1:18325:2145#0/1
ggffffffgfggggggggfgggfggfgdggfgg
@HWUSI-EAS1795_0092:3:1:18346:2151#0/1
GTTCACGCTAAAGTTTGACTTGCTCAGCTGGTC
+HWUSI-EAS1795_0092:3:1:18346:2151#0/1
hhhhhhhghhhhhhhhfhhhhhfhhhghhfghh
@HWUSI-EAS1795_0092:3:1:18393:2149#0/1
CGGTAAAACACTTGTAAACCGCACCCAGGGTCA
+HWUSI-EAS1795_0092:3:1:18393:2149#0/1
gggfggggfgggggggggggggggggfgggdgf
@HWUSI-EAS1795_0092:3:1:18938:2143#0/1
GTTTTTTGCTGTGAGTAGGTCGTGGTGCTGGTG
+HWUSI-EAS1795_0092:3:1:18938:2143#0/1
faggggfgf_ggeWceccaacdfffffggfggg
@HWUSI-EAS1795_0092:3:1:19514:2148#0/1
CAGGTGTTGAATACGCGCTAGACTAGAAAGCGA
+HWUSI-EAS1795_0092:3:1:19514:2148#0/1
gggggeggggggggfggfggaagggagggeggg
@HWUSI-EAS1795_0092:3:1:2507:2154#0/1
GGCGTTTATGAGCAGGGTGAAGCAGAGATAAAC
+HWUSI-EAS1795_0092:3:1:2507:2154#0/1
cccccYcW\\QaaV`bP]_YY_U\^TTccc]cc
@HWUSI-EAS1795_0092:3:1:2556:2153#0/1
GTCGTGTCCGGCAAACTGCGTGGTCAGCGTGCC
+HWUSI-EAS1795_0092:3:1:2556:2153#0/1
hhhhghhhhhhhhhhhhghhhhhhhhhhfgfhh
@HWUSI-EAS1795_0092:3:1:2727:2160#0/1
GCCGGCAGTTCGAACGTATACGCTCTCTGAGTC
+HWUSI-EAS1795_0092:3:1:2727:2160#0/1
gaggggdcffffWfffffcfafggggfgfgaeg
@HWUSI-EAS1795_0092:3:1:2940:2162#0/1
TGTTCTTGTAATCTCCGTTAGCAGACATGTCGA
+HWUSI-EAS1795_0092:3:1:2940:2162#0/1
f[fffffgeggcfafdfggggfggffdfafffg
@HWUSI-EAS1795_0092:3:1:2960:2155#0/1
GAGGAGTCCGAGTCCGAGGATGACGACATGGGC
+HWUSI-EAS1795_0092:3:1:2960:2155#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3144:2155#0/1
GCGCCGCCGACGGTGCTGCCCGCAAGGCTCTGC
+HWUSI-EAS1795_0092:3:1:3144:2155#0/1
gggggggggggddccfddfffcfcdbbfcfd_d
@HWUSI-EAS1795_0092:3:1:3188:2162#0/1
CATGGAAGTAGACTCGCGGCGTTTTAAATTTCT
+HWUSI-EAS1795_0092:3:1:3188:2162#0/1
hhhhghghghhhhfhhhghghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3476:2159#0/1
GTTTGCTTATGCGTCGTGTACAACTGTGTATAA
+HWUSI-EAS1795_0092:3:1:3476:2159#0/1
hhhhhhhhhhhhhghhhhhhhhgghhghhhhhh
@HWUSI-EAS1795_0092:3:1:3544:2155#0/1
GCGAAATGGAGTTGCGCATAGTGGCGCGACTAA
+HWUSI-EAS1795_0092:3:1:3544:2155#0/1
fhhchhhhgehhehhhfhhfhcffhhfhhhdhh
@HWUSI-EAS1795_0092:3:1:3897:2161#0/1
ATATCACGCTGACCATTGGCCAGGCCTTCGATT
+HWUSI-EAS1795_0092:3:1:3897:2161#0/1
gfgggggggggggeg[daeffcfffffggeggg
@HWUSI-EAS1795_0092:3:1:4005:2159#0/1
CGCAGGTCTGGATCAGCTTGCGGATGGACTTGG
+HWUSI-EAS1795_0092:3:1:4005:2159#0/1
fggggggggggfggdgafffcffffffWbffef
@HWUSI-EAS1795_0092:3:1:4463:2164#0/1
CAAGTCCGTCAGGCTGTTCACGATCGACGGCAA
+HWUSI-EAS1795_0092:3:1:4463:2164#0/1
gfggg_fggfgafff]ffdcccffcf[`_\[ed
@HWUSI-EAS1795_0092:3:1:5214:2155#0/1
TAGGAACTCGCCAAACATACAAACGGGTCAAAC
+HWUSI-EAS1795_0092:3:1:5214:2155#0/1
ggggcgcdfcafef^dcffafffafddfffafa
@HWUSI-EAS1795_0092:3:1:5502:2156#0/1
GCTTCGCCCTACGCCGCTATGTTGGCCGCTCAG
+HWUSI-EAS1795_0092:3:1:5502:2156#0/1
hghhhfhhhhhhhhhghhghghhehhhhfghgh
@HWUSI-EAS1795_0092:3:1:5775:2158#0/1
GGATGTCCAGCGCTCTTCTGAGAGTGCGGAGAA
+HWUSI-EAS1795_0092:3:1:5775:2158#0/1
hhhhhhhhhfhhhhghhhhhhgchhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:5825:2161#0/1
GTGATTTTTGTGGCGTTGTGGCTGGTTTTTATT
+HWUSI-EAS1795_0092:3:1:5825:2161#0/1
fcfffdddgggcggfgdcggggffKffcacBBB
@HWUSI-EAS1795_0092:3:1:6325:2161#0/1
CTTGAAGGATCCCTTTCCCATCTCCTGGGCCTC
+HWUSI-EAS1795_0092:3:1:6325:2161#0/1
hhhhhhhhhhhhhhhhhhhhdgghhhahhhheh
@HWUSI-EAS1795_0092:3:1:7371:2161#0/1
CGGAGATAATGGAATTTACAATTCATTCACCAG
+HWUSI-EAS1795_0092:3:1:7371:2161#0/1
hhhhghgdhhhhhhehhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7924:2160#0/1
CAGGGACTCTCGTTTTTGGGCTCCCGATTGTAT
+HWUSI-EAS1795_0092:3:1:7924:2160#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:8229:2159#0/1
AAGAAGTGCGAGCGCTCCTACCTGATGAAGCGC
+HWUSI-EAS1795_0092:3:1:8229:2159#0/1
caccc_cR\L`PZ__VZc]c^c]Za[]acUa[U
@HWUSI-EAS1795_0092:3:1:8907:2155#0/1
ATACACGTCTCCAAGTTCTACAAGGAGTCGAAG
+HWUSI-EAS1795_0092:3:1:8907:2155#0/1
agfafffggfggfgggggfgdggcgcagggcdc
@HWUSI-EAS1795_0092:3:1:8973:2161#0/1
GCAATTCTCAAATCGTATTCTCTTTCTCACTGA
+HWUSI-EAS1795_0092:3:1:8973:2161#0/1
ghhhhhhhhhhfhhhhhhhghhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:10347:2155#0/1
CTTTGTTGTGTGGCAGGACGATGAAGGCTCCGC
+HWUSI-EAS1795_0092:3:1:10347:2155#0/1
fggdegg`eefcfffffaff_aadaedgggcfg
@HWUSI-EAS1795_0092:3:1:10897:2157#0/1
CGGGCCACTTCCTCTGCCCGCTCACCAGGCTCA
+HWUSI-EAS1795_0092:3:1:10897:2157#0/1
acad]aaOZZXXXWV`XZZWTVccW]cBBBBBB
@HWUSI-EAS1795_0092:3:1:11195:2163#0/1
GTGCGTGCGCTTCTCGCCCAACCACTCCAACCC
+HWUSI-EAS1795_0092:3:1:11195:2163#0/1
gfggfgggggfggggggggggggggfggggggg
@HWUSI-EAS1795_0092:3:1:11497:2160#0/1
GGCGTCTCGAAGAGATCGGCTGATCCGCTGCCG
+HWUSI-EAS1795_0092:3:1:11497:2160#0/1
hhhhfhhhgghgggfhhhfgfg]cffdcWa`df
@HWUSI-EAS1795_0092:3:1:11955:2157#0/1
CTGCTATAAACAGCGAGAAAATCACGAAAACTC
+HWUSI-EAS1795_0092:3:1:11955:2157#0/1
Vafccdf^fcefggfgf\ff``fffdcggcecf
@HWUSI-EAS1795_0092:3:1:12054:2157#0/1
GAAAAGGACTCGTACGAGCTGCGCTACTTCAGA
+HWUSI-EAS1795_0092:3:1:12054:2157#0/1
c[cdddWfcfffbadddffff]a^^d^cfcfaf
@HWUSI-EAS1795_0092:3:1:12199:2153#0/1
AAGTACGATCCCTCCATCGGTATCTATGGTCTG
+HWUSI-EAS1795_0092:3:1:12199:2153#0/1
^ffffcf_ffffffd`afdfWfffaaffd]fcf
@HWUSI-EAS1795_0092:3:1:12580:2155#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12580:2155#0/1
hfhghfhhhghhhghhhhghhhhfhhggehhff
@HWUSI-EAS1795_0092:3:1:13370:2155#0/1
AGGGAGTCCTCGATTTTGTTGGAGAAGTAGAAT
+HWUSI-EAS1795_0092:3:1:13370:2155#0/1
hhhhhhhhhghhhhhhhfhhfhfeghhgfhghh
@HWUSI-EAS1795_0092:3:1:13742:2162#0/1
GAAGCAGCCACCATTATCACCGAAAAGCGAAAG
+HWUSI-EAS1795_0092:3:1:13742:2162#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:13926:2159#0/1
CAGCAACCAGGGATTCTAATTCGAAAATAACCC
+HWUSI-EAS1795_0092:3:1:13926:2159#0/1
hhgghhhhhfghhhhhhhhhhhghhghhhhghg
@HWUSI-EAS1795_0092:3:1:13992:2160#0/1
ATGCTAAACAAGATACTGCAGCAGCAGAACGAC
+HWUSI-EAS1795_0092:3:1:13992:2160#0/1
fhghhhghhhhfghhhhhhhfhhhhhhhhh_hh
@HWUSI-EAS1795_0092:3:1:14438:2153#0/1
CGCACCTTGTGCACGCGGCCGGAACCAAGCTTG
+HWUSI-EAS1795_0092:3:1:14438:2153#0/1
cafffaca_^_addacc\Z\I_BBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14542:2164#0/1
CAGAGTTATTGATTATGAAACGCAGTAAACGTT
+HWUSI-EAS1795_0092:3:1:14542:2164#0/1
hhhghhhhhhhhhghhghhhhhhhhgghhhhhe
@HWUSI-EAS1795_0092:3:1:14781:2155#0/1
CGTATAAAGAAGTCGACACCGAAGCGATCACCA
+HWUSI-EAS1795_0092:3:1:14781:2155#0/1
hhhhfhhhghhhhhhhhhhhfgfghghhghhhh
@HWUSI-EAS1795_0092:3:1:14963:2162#0/1
GGCGTGTACAAAGCATTATGTACATTAAACATC
+HWUSI-EAS1795_0092:3:1:14963:2162#0/1
hhhghghhhghhhhhhhhhhhhhghhhhhhfch
@HWUSI-EAS1795_0092:3:1:15116:2157#0/1
TACGCCCAGTATCTGCCCAAGGATCACTACTTG
+HWUSI-EAS1795_0092:3:1:15116:2157#0/1
\`ZVW__c[ccc\K]T^Za^\aaOc]]]^]`PX
@HWUSI-EAS1795_0092:3:1:15522:2160#0/1
CTCGGGATTGGACAGTATGTCGTAGTGGATGCC
+HWUSI-EAS1795_0092:3:1:15522:2160#0/1
cRacaaa\J\aYaJb]X\\__Za[a[ccccc[a
@HWUSI-EAS1795_0092:3:1:16498:2161#0/1
GTTTCCGCTGCCCCGAGGCCCTGTTCCAGCCCT
+HWUSI-EAS1795_0092:3:1:16498:2161#0/1
ggggggggggggaffafacfffgggcgcbfff_
@HWUSI-EAS1795_0092:3:1:16533:2161#0/1
CGGCCGCCTCGGTGGTCAGTGGGTACTTGATGA
+HWUSI-EAS1795_0092:3:1:16533:2161#0/1
gggggfggggggcgggggggggfeffffffffg
@HWUSI-EAS1795_0092:3:1:16610:2153#0/1
CGCCTCCATGGATACCCGCTCCCACTAAGGCCC
+HWUSI-EAS1795_0092:3:1:16610:2153#0/1
VPSVV\]cUccZc]aaBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:16635:2160#0/1
ACGGCAAGTCGGCCAGCGGCAACAACAACGGCA
+HWUSI-EAS1795_0092:3:1:16635:2160#0/1
ggggfggggdgggefgggggfgWfffffddcdg
@HWUSI-EAS1795_0092:3:1:16677:2156#0/1
CTGTGGTTTACTTCTTGGCCTTCTTGGGGTCTC
+HWUSI-EAS1795_0092:3:1:16677:2156#0/1
ghhhhhhhhfhhhhhhhhghhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16701:2156#0/1
AAGATGTTGGTGGCCACCACCCATCTGGGTTCC
+HWUSI-EAS1795_0092:3:1:16701:2156#0/1
fgggggggagfgeffffcfgggegg_fggg_gf
@HWUSI-EAS1795_0092:3:1:16916:2163#0/1
GCGCTTCTCGGGTTGTGGGGCCTTGGATGCGAA
+HWUSI-EAS1795_0092:3:1:16916:2163#0/1
gggggggggggfggcgefgggggggf_ggggeg
@HWUSI-EAS1795_0092:3:1:17224:2162#0/1
CCTCGATTGCCAGGCGGCGTTGGAGCCAGGATA
+HWUSI-EAS1795_0092:3:1:17224:2162#0/1
hhhhghhdhhhhhghhchgggedhghhhhggeh
@HWUSI-EAS1795_0092:3:1:17641:2154#0/1
CCCCGCAAGACTTGAAAACAAACTACCAACTAG
+HWUSI-EAS1795_0092:3:1:17641:2154#0/1
fddd_]dfc_ff_aacda_\\^cfff[eeaRaf
@HWUSI-EAS1795_0092:3:1:17840:2164#0/1
GGCCAGCTCATTGGACACTCAGCATGGGTTCTA
+HWUSI-EAS1795_0092:3:1:17840:2164#0/1
gdggggcge]fgaefffgegggggcgc]bfcfg
@HWUSI-EAS1795_0092:3:1:17880:2160#0/1
GAAGGATGCAGATGTCGTTTGCCGAGAACTTGG
+HWUSI-EAS1795_0092:3:1:17880:2160#0/1
fffffffcdfcff^dccfffcffffaffffYfd
@HWUSI-EAS1795_0092:3:1:18077:2163#0/1
GCGACGTGGGATGGGGGTGTCGGTGAGACCGGG
+HWUSI-EAS1795_0092:3:1:18077:2163#0/1
cSaa\a\cccacccQc_^[[a^ZZZ\Oc_cc_c
@HWUSI-EAS1795_0092:3:1:18544:2160#0/1
CCCAGGTTGCCTACCAGATTGGCAATGTGGAGA
+HWUSI-EAS1795_0092:3:1:18544:2160#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:18665:2156#0/1
CAGCGTGCTTGTTCTCGTCCCGAGCTAAGGCCA
+HWUSI-EAS1795_0092:3:1:18665:2156#0/1
hhhhhhhgghhhhhhhhhhhhhghgfhggghhg
@HWUSI-EAS1795_0092:3:1:18913:2158#0/1
CCAGAGGACGACCGTTCACCTTCAGGAGGCCGT
+HWUSI-EAS1795_0092:3:1:18913:2158#0/1
hhhhhghfhhghfhhhhhhhhghghhdbbffed
@HWUSI-EAS1795_0092:3:1:19057:2162#0/1
GGCGGATGACACTAGTTCGCCGATGGACAGATT
+HWUSI-EAS1795_0092:3:1:19057:2162#0/1
fcdbbccfffcdfgfggfcdfffffd_]dfffg
@HWUSI-EAS1795_0092:3:1:19118:2160#0/1
GGCGCTGGCGTCAAGTTCGCCGGCAAGTCGTTC
+HWUSI-EAS1795_0092:3:1:19118:2160#0/1
hghhghhgghhhggaehhhhhhchhhgdfhhfh
@HWUSI-EAS1795_0092:3:1:19298:2164#0/1
GGCCAAGCGCCGCCGTTCTGCCTCCATTCGCGA
+HWUSI-EAS1795_0092:3:1:19298:2164#0/1
gggggggaffdfggfgggggggggfdgecfffa
@HWUSI-EAS1795_0092:3:1:2132:2173#0/1
CTTGTCCTTGGGCACGCAGCGGGCGCAGTTGGT
+HWUSI-EAS1795_0092:3:1:2132:2173#0/1
hhhhhhhhhfhhhghhhhhghhhhhhafccffa
@HWUSI-EAS1795_0092:3:1:2519:2172#0/1
ATCTTGCGCAGGACAGGTGTTGGTGTTATACTA
+HWUSI-EAS1795_0092:3:1:2519:2172#0/1
gdgfgfgggf]ggfggggdeggfdffcggggac
@HWUSI-EAS1795_0092:3:1:3658:2170#0/1
GAGGAATACGCAACGGCTGACAAGCAAAAGCGT
+HWUSI-EAS1795_0092:3:1:3658:2170#0/1
ggggffgffffafffffff]\dffffffdfafa
@HWUSI-EAS1795_0092:3:1:3749:2173#0/1
AGAAAACCCCATTAAAATTTACGAAGACAATCA
+HWUSI-EAS1795_0092:3:1:3749:2173#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:4976:2172#0/1
GGCGAACACTGCTCCCATCGCCGGCGTAGCTCC
+HWUSI-EAS1795_0092:3:1:4976:2172#0/1
ffccfcfggcggegfgggga_d^dffbd^cbef
@HWUSI-EAS1795_0092:3:1:5036:2168#0/1
CGGTGATCTCCTTCTGCATACGGTCGGCGATGC
+HWUSI-EAS1795_0092:3:1:5036:2168#0/1
gggeggggggfggeggggggfeggggggggggg
@HWUSI-EAS1795_0092:3:1:5435:2167#0/1
GGAGCCTTGGCCATATTTGCGGGGATGCGAGTA
+HWUSI-EAS1795_0092:3:1:5435:2167#0/1
hhgfhghfhhhhhhhghhghhhhhhfcghchgh
@HWUSI-EAS1795_0092:3:1:5550:2174#0/1
CCCACGGCCGTGTGCGTCTGCTCCTGAAGAAGG
+HWUSI-EAS1795_0092:3:1:5550:2174#0/1
gggggggfgggfgggggggggfgggdgfgcfgg
@HWUSI-EAS1795_0092:3:1:5627:2166#0/1
CCCTACTTTCATCTTGGTCTGGCCGCCGCTCAG
+HWUSI-EAS1795_0092:3:1:5627:2166#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhdhghhh
@HWUSI-EAS1795_0092:3:1:5904:2168#0/1
TTTGAAGAACCTGGCCCAACAGCAGTACAAGTC
+HWUSI-EAS1795_0092:3:1:5904:2168#0/1
hhhhfhhhhhhhhhhhhhhfhhfhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:6251:2171#0/1
GCTGCCACTGAGCACGACAACGATCGGCGACTC
+HWUSI-EAS1795_0092:3:1:6251:2171#0/1
fcfffffggcggfYafaafadfd[fff]df_af
@HWUSI-EAS1795_0092:3:1:7079:2173#0/1
CGGTTGGCTATCCCAGGCTCCTATGAACAGTAT
+HWUSI-EAS1795_0092:3:1:7079:2173#0/1
fgegggfg_acfdfafffffcaK]`]^```\`f
@HWUSI-EAS1795_0092:3:1:7097:2165#0/1
AGGGCACCTCGTGCTTCTGTGTAAATGTGTGAC
+HWUSI-EAS1795_0092:3:1:7097:2165#0/1
ggggggggffgggffgggfggggggfaggggff
@HWUSI-EAS1795_0092:3:1:7181:2169#0/1
GCCACGTTCACATTGTCGGCAGAGGGGGCCTTG
+HWUSI-EAS1795_0092:3:1:7181:2169#0/1
ccdddddfffddfffafffaWdffafcccafdf
@HWUSI-EAS1795_0092:3:1:8519:2166#0/1
CCTAAAGAAGAGCACACACGGACCACACAGAAC
+HWUSI-EAS1795_0092:3:1:8519:2166#0/1
Y[a^caaYWWWa[YVaWTTWUUMO^[Sbdd`dc
@HWUSI-EAS1795_0092:3:1:8567:2165#0/1
GACGGACGGACGGATGGATGGATGGACAGGGAC
+HWUSI-EAS1795_0092:3:1:8567:2165#0/1
hghhhhhhgghhhhfegfhfhhaghfhghheag
@HWUSI-EAS1795_0092:3:1:8620:2168#0/1
CGCCGAACAAAACTCCGTTGAAAAGTTGAGGAC
+HWUSI-EAS1795_0092:3:1:8620:2168#0/1
hhhhhghhhhhhhhhhhhhfhhhhhhhfhhhhg
@HWUSI-EAS1795_0092:3:1:9290:2175#0/1
CGTCGATGTTCGTATTCATGATACGCAGGATGT
+HWUSI-EAS1795_0092:3:1:9290:2175#0/1
hhhhhghhhhhghfhhghhcfgfhhfhhggfhh
@HWUSI-EAS1795_0092:3:1:9478:2166#0/1
CCGCCAGTCACCACAGTCACCCACTCAGGCAGT
+HWUSI-EAS1795_0092:3:1:9478:2166#0/1
hhhhhhhhhhhhhhhhggghhhhgcghhhhghh
@HWUSI-EAS1795_0092:3:1:9569:2168#0/1
ACGGAATCGCTCATTTCCGATGGTGATGACCTG
+HWUSI-EAS1795_0092:3:1:9569:2168#0/1
hhghhhhhhgehgghghhhhgfhdghgfhhggf
@HWUSI-EAS1795_0092:3:1:11242:2167#0/1
GGCGGCTGGAGCAGCGGCGGCGGCAGCAGGGGC
+HWUSI-EAS1795_0092:3:1:11242:2167#0/1
fcfdffdffffddcfaf]ddBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:11737:2173#0/1
CCCGTATCCGTATCGTTTGGGTATGGATATATG
+HWUSI-EAS1795_0092:3:1:11737:2173#0/1
dfccffaccadWffdcfacdaWaabbb[ad[dd
@HWUSI-EAS1795_0092:3:1:12039:2168#0/1
CGTTCGGCTTGCGTGGCTCTCCTACAAATTAAT
+HWUSI-EAS1795_0092:3:1:12039:2168#0/1
\\ZZ_`affffR]^ac[\addef[ddfcd[fcR
@HWUSI-EAS1795_0092:3:1:12099:2169#0/1
AAGAACAAGAAGTACAAGCCCCTGGATCTGCGC
+HWUSI-EAS1795_0092:3:1:12099:2169#0/1
gfgggfggdggggggggfggggfgggggggggg
@HWUSI-EAS1795_0092:3:1:12289:2169#0/1
ACGGTGGATCCCAAGGATAAGAGTGCACACTGG
+HWUSI-EAS1795_0092:3:1:12289:2169#0/1
gggggcgggggfgggffgfg_gd[fffgggcgg
@HWUSI-EAS1795_0092:3:1:12563:2169#0/1
CTTTCGTACTAAAATATCACAATTTTTTAAAGA
+HWUSI-EAS1795_0092:3:1:12563:2169#0/1
hhhhhhhhhhhhhhhhfghhhfhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12997:2168#0/1
CATGGGAATAAGCAGCGCACACCACGCGATCAC
+HWUSI-EAS1795_0092:3:1:12997:2168#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13067:2166#0/1
GCAACACCACAAAATGCCAACAGTTACCACCTT
+HWUSI-EAS1795_0092:3:1:13067:2166#0/1
^Zcfffcfc_][VOUaS]b]bV]bZ`bYb]b]Y
@HWUSI-EAS1795_0092:3:1:13890:2171#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13890:2171#0/1
_\ffffffffffdffffffffffffffffffff
@HWUSI-EAS1795_0092:3:1:13957:2172#0/1
TCCTCATCGTCACTATTGTACTCTTCATCTTCC
+HWUSI-EAS1795_0092:3:1:13957:2172#0/1
fff_fdffcaf[d]b[a^^ac^\Y\\^``bab]
@HWUSI-EAS1795_0092:3:1:14078:2174#0/1
ACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCG
+HWUSI-EAS1795_0092:3:1:14078:2174#0/1
ggggfgggggggggfggcggggggcgggggggg
@HWUSI-EAS1795_0092:3:1:14301:2168#0/1
AGGTGATGTCCATCTTTGTGGAGTTCTACACCA
+HWUSI-EAS1795_0092:3:1:14301:2168#0/1
gggggggggggggggfggggggggggcggfggf
@HWUSI-EAS1795_0092:3:1:15300:2170#0/1
ATTGAAGCGCATCTTGCACGTGAATTCTCTGCG
+HWUSI-EAS1795_0092:3:1:15300:2170#0/1
hhhghhhhghhhghhfhhghhhgfghhhhhehh
@HWUSI-EAS1795_0092:3:1:15969:2165#0/1
GCAAAAACCACTTCCGGAGGGCAGTAGCTTGCG
+HWUSI-EAS1795_0092:3:1:15969:2165#0/1
hhhhhhhhhhghfhhhghhcghghhghhhh][^
@HWUSI-EAS1795_0092:3:1:16200:2165#0/1
CTTCCCCTTTCTTCGCTCTTTTCCTCTCCTCTC
+HWUSI-EAS1795_0092:3:1:16200:2165#0/1
TTTTVTR__^Z_UU\[\Y^Xa[_c\_a\W__^c
@HWUSI-EAS1795_0092:3:1:16762:2164#0/1
CCCGCTTCCAGTGGGACAAGTTCAAGGATCTGT
+HWUSI-EAS1795_0092:3:1:16762:2164#0/1
hhhhhgghhfhhhhhhdhhhhghhhhgdgeehh
@HWUSI-EAS1795_0092:3:1:17256:2165#0/1
TTGATTGATAGATTGCTGTTTATGTCCTAGAGG
+HWUSI-EAS1795_0092:3:1:17256:2165#0/1
hghhhhhhhhRhfhhhhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17360:2165#0/1
CTCAGATCATGTAAGAATTTAAAAGTCGAACAG
+HWUSI-EAS1795_0092:3:1:17360:2165#0/1
hhhhhhhhhhhhhhghhhhhghhhhefhhghhh
@HWUSI-EAS1795_0092:3:1:18224:2167#0/1
CTTTGGTCCTATCCGCAACGTATTTATGTCGCA
+HWUSI-EAS1795_0092:3:1:18224:2167#0/1
hhhhghhhhhhghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18707:2175#0/1
TTGAAAGAGTTCTCCGAACAGGAGCTGCTGGAC
+HWUSI-EAS1795_0092:3:1:18707:2175#0/1
hhhghhghhhhhhhhhhhfghg]hhhhhhhgge
@HWUSI-EAS1795_0092:3:1:19426:2165#0/1
CAAGAAGACGCGTGTCAAGCTGCCATCCGGCGC
+HWUSI-EAS1795_0092:3:1:19426:2165#0/1
hhhhhhehhhhhhgghhfdfd_fffdfhhgheh
@HWUSI-EAS1795_0092:3:1:1589:2185#0/1
CAGGAAACAGCAGGGTTTCGGAGGTCAGACCAA
+HWUSI-EAS1795_0092:3:1:1589:2185#0/1
fffadffc^cffggggggfgg[ffacffcafff
@HWUSI-EAS1795_0092:3:1:2112:2178#0/1
GAAAGTTGTGTTTTTCGTACATTTTGCCAATTC
+HWUSI-EAS1795_0092:3:1:2112:2178#0/1
hhchhhhfhhghhhhhhghhhhghhhghfhhhh
@HWUSI-EAS1795_0092:3:1:2745:2179#0/1
CGGCGACACGATGAACAAGAAGATACGCAATGC
+HWUSI-EAS1795_0092:3:1:2745:2179#0/1
fcfcffadgfgdaggeggeggggcggggfgdee
@HWUSI-EAS1795_0092:3:1:4018:2186#0/1
GCCGGGATGCGGACGAGGCGTCTCTGCACTCTT
+HWUSI-EAS1795_0092:3:1:4018:2186#0/1
fdffffWYaQ\\^^aR^[aa^aY^R`TTVTXX]
@HWUSI-EAS1795_0092:3:1:4672:2178#0/1
GACAACTGCAACGAGTGCCGCTGCCTGGAGGGC
+HWUSI-EAS1795_0092:3:1:4672:2178#0/1
gfgffggf\ffafffffceW[]]]`]`fR`b`\
@HWUSI-EAS1795_0092:3:1:4847:2182#0/1
TGATAGTACGTGCTGCACCAGCTCCTGGGTGTC
+HWUSI-EAS1795_0092:3:1:4847:2182#0/1
Ydd[dada]`^`a^W\cddcddffcff[a^adf
@HWUSI-EAS1795_0092:3:1:5288:2185#0/1
CGTGAAGCGGCTCTGGCCGAGGAGCAGTCAAAT
+HWUSI-EAS1795_0092:3:1:5288:2185#0/1
eggggggdfdc_]O]`]afcffc``ffdfea[b
@HWUSI-EAS1795_0092:3:1:5499:2183#0/1
CGCTGACGGATCAGGACGCGAGCATGATGGATG
+HWUSI-EAS1795_0092:3:1:5499:2183#0/1
gggcggfggggdgagggaffcccffffcff__f
@HWUSI-EAS1795_0092:3:1:6321:2186#0/1
GAGCGAGAGAAAGCTGCGCCCTCAGGTGAATCA
+HWUSI-EAS1795_0092:3:1:6321:2186#0/1
gggdgggcfffff_fffgcgggfdfffgfggae
@HWUSI-EAS1795_0092:3:1:6532:2178#0/1
AAAACATAACAAAATTCGACATTTTGGAAGTTT
+HWUSI-EAS1795_0092:3:1:6532:2178#0/1
a\ce\__ff[cacdcYfea[eaeacde_caaa`
@HWUSI-EAS1795_0092:3:1:7419:2179#0/1
GTGAACCAATGGTTAGCTAAAGAGAGAGCACAC
+HWUSI-EAS1795_0092:3:1:7419:2179#0/1
ghfhhhhhhhhhhhhhghghhhghhhghchhhh
@HWUSI-EAS1795_0092:3:1:7803:2184#0/1
CCTTGCGATTGTTCACGGTGGCCTCCCCGGAGC
+HWUSI-EAS1795_0092:3:1:7803:2184#0/1
hhhhfhhhhhchhhehgddeaff[fffhhhghh
@HWUSI-EAS1795_0092:3:1:7909:2186#0/1
AAGAAATGTCTTCTGGAGTTCTGCACGCGGATC
+HWUSI-EAS1795_0092:3:1:7909:2186#0/1
ghghhh_ggghfhfhhhhfhhhhghghghhhhh
@HWUSI-EAS1795_0092:3:1:7990:2176#0/1
CCTGAAGCATCAACGGACGCATTTTGTATTATA
+HWUSI-EAS1795_0092:3:1:7990:2176#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8170:2187#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8170:2187#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhfghhg
@HWUSI-EAS1795_0092:3:1:8633:2183#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8633:2183#0/1
fggcfdgdcdfddfcdfgg]ga[fffd]`fffc
@HWUSI-EAS1795_0092:3:1:9767:2181#0/1
ATTTATTATTCAAATATTAATTCGAAAAGGCAG
+HWUSI-EAS1795_0092:3:1:9767:2181#0/1
dfafcdc_ceeefaaffgacggf_cffcf]df`
@HWUSI-EAS1795_0092:3:1:9990:2183#0/1
GAAAGAAAAAACATGCCGCTAGCAAAAGATCTT
+HWUSI-EAS1795_0092:3:1:9990:2183#0/1
hhhhhhhhhhhhhhhhhghhhhgghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10102:2177#0/1
GGAAAATTGGTGAAGGTGCAGTTCTCGAAGATC
+HWUSI-EAS1795_0092:3:1:10102:2177#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhfhg
@HWUSI-EAS1795_0092:3:1:10389:2178#0/1
GTGGGACTCCACATCAAAGCAGTGCGTAGCTAC
+HWUSI-EAS1795_0092:3:1:10389:2178#0/1
d^ff]afggggcagggec]fffcccccf[_cfg
@HWUSI-EAS1795_0092:3:1:10954:2180#0/1
GTCAGGTTGCACTTGCCGCAGTAGTGACGATCT
+HWUSI-EAS1795_0092:3:1:10954:2180#0/1
hhhhhhhhhhhhhhfhhffccgfggfhghhhhh
@HWUSI-EAS1795_0092:3:1:11054:2177#0/1
TAAGCGAGCGGATGGATTTGGTTCTTCAGTTTA
+HWUSI-EAS1795_0092:3:1:11054:2177#0/1
ggggggggggggfggcfffcffgfggggggggg
@HWUSI-EAS1795_0092:3:1:11373:2176#0/1
GGGAGTTTGACTGGGGCGGTACATCTCTCAAAT
+HWUSI-EAS1795_0092:3:1:11373:2176#0/1
ggggggggggggggggeffccca^c\afdfffa
@HWUSI-EAS1795_0092:3:1:11443:2184#0/1
CTCGTCCTCCTTCTGGGCGTGCTTGGGGTTACG
+HWUSI-EAS1795_0092:3:1:11443:2184#0/1
dacfcffgcagcggfggggggaafffagggfad
@HWUSI-EAS1795_0092:3:1:12091:2187#0/1
GGCTCGACGTTGAACTCCTCACCAGTCACTTCA
+HWUSI-EAS1795_0092:3:1:12091:2187#0/1
ggcgggacffffgfggggcgaggggggfggggg
@HWUSI-EAS1795_0092:3:1:12894:2176#0/1
CAGGCGGAGATTTAAACAAAACTAGTGCTTTAA
+HWUSI-EAS1795_0092:3:1:12894:2176#0/1
hhhhhhhhhhfghghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13155:2187#0/1
TCTGGCTGAACGTCCACGGCGAACCATTTTGTT
+HWUSI-EAS1795_0092:3:1:13155:2187#0/1
ghhhhhhhhhhhhhfhhhhhhfhhgfhhhfghh
@HWUSI-EAS1795_0092:3:1:13415:2183#0/1
AGGGATTGGCTCAGGCCAACGGTGGCGCGTATG
+HWUSI-EAS1795_0092:3:1:13415:2183#0/1
fgffd_dfffcffcdfaccadc\dd`dc]cccd
@HWUSI-EAS1795_0092:3:1:14059:2181#0/1
CAGTTACAAAAAACCAACACAAAAATGGCCAAG
+HWUSI-EAS1795_0092:3:1:14059:2181#0/1
hhghgghghghhghghgfhhhhhfhhgfgfghh
@HWUSI-EAS1795_0092:3:1:15347:2180#0/1
TGATGACAGCTCCGTTAGTCCCTCGTTTGTATG
+HWUSI-EAS1795_0092:3:1:15347:2180#0/1
hhhhhhhhhhhhhhhhhghhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15780:2183#0/1
GCGCGAGGAGGCCAAGCGCCGCCGTTCTGCCTC
+HWUSI-EAS1795_0092:3:1:15780:2183#0/1
fdf]f]fPWZ_ZVVVURdcaddfafW_^^d[[W
@HWUSI-EAS1795_0092:3:1:15797:2176#0/1
TTGGACTCCAGTACACCGACTCCAAGGGCGACT
+HWUSI-EAS1795_0092:3:1:15797:2176#0/1
cgff_f]dffffgggggg_gcggggggdggggg
@HWUSI-EAS1795_0092:3:1:16093:2181#0/1
GGGCAAGTACACCGAGGAGACCGCCGCCCAGCC
+HWUSI-EAS1795_0092:3:1:16093:2181#0/1
hfhghhhhhhhhhhhhdfhhhhgghhhheghhh
@HWUSI-EAS1795_0092:3:1:16418:2176#0/1
TTCCAACCTTCTTGGTGCGCTTGGCCATTTTGC
+HWUSI-EAS1795_0092:3:1:16418:2176#0/1
hhhhhhhghhhhhhhgfggghhhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:16434:2183#0/1
GTCCATTTCTCGATGTCGTTGATGGGCACATCG
+HWUSI-EAS1795_0092:3:1:16434:2183#0/1
hhhhhhhhhhhhhhhhhhhhhgfhhehhhhghh
@HWUSI-EAS1795_0092:3:1:16989:2183#0/1
CGAACACCGATTCGATTGTAATTCGCTCTATAC
+HWUSI-EAS1795_0092:3:1:16989:2183#0/1
ff^dd_cfcfffbdWWddb\cd^\aQ\fffacf
@HWUSI-EAS1795_0092:3:1:17236:2178#0/1
CGAAGATCTACGAAAGCAATCGCACCATTAACA
+HWUSI-EAS1795_0092:3:1:17236:2178#0/1
hhhhhhhhhhhhhhhhhfghghhghhhhghhgh
@HWUSI-EAS1795_0092:3:1:17836:2184#0/1
CTGAGCTTCAACGATTTCCTGCTGAGCAGTGAG
+HWUSI-EAS1795_0092:3:1:17836:2184#0/1
ffcffffgggcgggcggffafaff[ff_fefaf
@HWUSI-EAS1795_0092:3:1:17976:2185#0/1
ATAAGATCAAGCAGAGCCTGTTTGGCGGCCTCG
+HWUSI-EAS1795_0092:3:1:17976:2185#0/1
^ccc[cYccc^aKPRN[b\\b^aI\aZ]PUG_U
@HWUSI-EAS1795_0092:3:1:18148:2183#0/1
GTTTGGCTTTTAAAGTTAGAAAGATGTGTTTAT
+HWUSI-EAS1795_0092:3:1:18148:2183#0/1
\_RVRYTaTTVP^OSZ^BBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18238:2179#0/1
CCACGGTCTCGACGATGAACGTCTGCTTGGCGG
+HWUSI-EAS1795_0092:3:1:18238:2179#0/1
ggffgggfffcdggggfgggggf_ffddddfec
@HWUSI-EAS1795_0092:3:1:18939:2177#0/1
GGAATTCTGGCCATGCCAAATGCCTTTCGTAAC
+HWUSI-EAS1795_0092:3:1:18939:2177#0/1
WY\aaa^daad^\^dca^^`aaa_fd^dd[aY`
@HWUSI-EAS1795_0092:3:1:19153:2179#0/1
GTTTGGCTCTGTATCCTAAACGTCTTGCTTTAT
+HWUSI-EAS1795_0092:3:1:19153:2179#0/1
gggggggggggggdgggggfgcfgfgggggagg
@HWUSI-EAS1795_0092:3:1:1507:2198#0/1
CAGACATTTGAAAGATCTGTCGTCGGTACAAGA
+HWUSI-EAS1795_0092:3:1:1507:2198#0/1
hagdhchhgghefhghgfhhhh\cadaffff_h
@HWUSI-EAS1795_0092:3:1:1795:2194#0/1
ATTGCGCAGGACACGCAGTAGTGGAGCTTCGCA
+HWUSI-EAS1795_0092:3:1:1795:2194#0/1
hghhghhhhh_hgccahgghhghf_gdhhhhhg
@HWUSI-EAS1795_0092:3:1:1867:2194#0/1
CAAGCGCCCCATGAAGCAGAAGCGCAAGCTGCG
+HWUSI-EAS1795_0092:3:1:1867:2194#0/1
fffffffgggYgffa]fgggg_fcdfaZ`\Zbb
@HWUSI-EAS1795_0092:3:1:2099:2193#0/1
ATTTTGACACTTGTTCCTACTTTGTGGATTGGA
+HWUSI-EAS1795_0092:3:1:2099:2193#0/1
agggfgggcfgggggggfggggggggc_gcggg
@HWUSI-EAS1795_0092:3:1:2335:2189#0/1
TCTGCAACACCCGTCGCAAGGTGGACCAACTGA
+HWUSI-EAS1795_0092:3:1:2335:2189#0/1
ffffffffffffd[d`daa[[Y[HZ`\aVZYSU
@HWUSI-EAS1795_0092:3:1:3573:2197#0/1
ACCCTCTGTACTTTCTCGTTGGATTTCCATGCC
+HWUSI-EAS1795_0092:3:1:3573:2197#0/1
cghhhhhhhfhhhhhfhehhcfchghhghcghh
@HWUSI-EAS1795_0092:3:1:4353:2190#0/1
GGACCAGAGGGAACTTGATCTTTGAATCGTGGA
+HWUSI-EAS1795_0092:3:1:4353:2190#0/1
ed_ad[ed]cedffdc^d[bcefc_]fbc]a`P
@HWUSI-EAS1795_0092:3:1:4414:2189#0/1
CGGATGTATTTGGGCCAGCGAACGAAACGGGAC
+HWUSI-EAS1795_0092:3:1:4414:2189#0/1
gggggggggggggggead]bfda]ffdXb`OZU
@HWUSI-EAS1795_0092:3:1:4432:2192#0/1
TGATCTTGCTCATGAACAAACGCTTCAGGATGA
+HWUSI-EAS1795_0092:3:1:4432:2192#0/1
fggfdgggegfgcggggfgg_gggg]dff_ffa
@HWUSI-EAS1795_0092:3:1:4759:2196#0/1
GCCAACTGGACAATTTCGTCCACCTTTTCGTAA
+HWUSI-EAS1795_0092:3:1:4759:2196#0/1
Y_^acccea_Wacdeeaaddcafc]dcZZ_XZU
@HWUSI-EAS1795_0092:3:1:5026:2188#0/1
CTGGGATTGTGGGATCCGAAGCGGGCTGTGCAC
+HWUSI-EAS1795_0092:3:1:5026:2188#0/1
^ffffddaa\^__c\ccdadBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5221:2190#0/1
CGCTCGTCGCTCCTCTGGCAGATCCTCTGGTGT
+HWUSI-EAS1795_0092:3:1:5221:2190#0/1
hhchhhhfhhhhhggahghhghhhffhhhfffh
@HWUSI-EAS1795_0092:3:1:5315:2192#0/1
TGCTTTATCACACCAAGGACATTCGCTTCCTGC
+HWUSI-EAS1795_0092:3:1:5315:2192#0/1
hhhghgffhhhhhhhhggehhfhchghhhhhhh
@HWUSI-EAS1795_0092:3:1:5665:2194#0/1
GGAGAAGGTCGACCGTCGTTCCGGCAAGACCAC
+HWUSI-EAS1795_0092:3:1:5665:2194#0/1
hhhhhhghhhhhhhhhhhhhhhehhhgfhhdgf
@HWUSI-EAS1795_0092:3:1:7101:2190#0/1
GGCGTCGTTATTCCAGTCATTGTCGGCGGACTC
+HWUSI-EAS1795_0092:3:1:7101:2190#0/1
^SGSSUZXXZ_Zc]Pa]bP]XVacc]cZ]]R]c
@HWUSI-EAS1795_0092:3:1:7740:2199#0/1
GGACCACTACGTTCTTCGACGGCCTCCCAGGAA
+HWUSI-EAS1795_0092:3:1:7740:2199#0/1
ggggfdggfggcffcfffdf]cffcffc]ffdg
@HWUSI-EAS1795_0092:3:1:8065:2197#0/1
GGGATGGGGGCCGAGTCAGGATTAAGTTAAGTT
+HWUSI-EAS1795_0092:3:1:8065:2197#0/1
hhhghhddghgghhhhhhhhgfhhfhhhfhfhh
@HWUSI-EAS1795_0092:3:1:8096:2190#0/1
AAATGCCACCCAAAAAGCCAACCGAGAAATCCG
+HWUSI-EAS1795_0092:3:1:8096:2190#0/1
hhhhhhhhhhhghhhhgfhhhfhhgghhhahhh
@HWUSI-EAS1795_0092:3:1:8406:2196#0/1
GTTCATCATTGTTGCGGGCATTGGCTCCGCGCT
+HWUSI-EAS1795_0092:3:1:8406:2196#0/1
hhhhhhhhhhhhhhhghhhhhhfhhhhhhhggg
@HWUSI-EAS1795_0092:3:1:8905:2197#0/1
GGCAAACAAAAGATTGCTGCTGCTGCTGCTGTT
+HWUSI-EAS1795_0092:3:1:8905:2197#0/1
gggggggfggcggegfggcfgfgdgde_ffafg
@HWUSI-EAS1795_0092:3:1:9067:2192#0/1
CAGAAGTCGTAGCTCAACACGTTTGCATTGATT
+HWUSI-EAS1795_0092:3:1:9067:2192#0/1
b^ZZZZUS^T^PQGOQSccccaccca]ZaXLZb
@HWUSI-EAS1795_0092:3:1:10240:2194#0/1
ACACAACTGGTTTGTCCATGTTAGATCGCTAAA
+HWUSI-EAS1795_0092:3:1:10240:2194#0/1
hhhhhhhhhhhhhghhhhhhhhfhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10345:2193#0/1
CCGAAGCCGGTGGCGTAATCCTTCTGGGAGGCG
+HWUSI-EAS1795_0092:3:1:10345:2193#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:10470:2194#0/1
ATCGCCACTTCAATGGAACCAAACTCCTTTGCC
+HWUSI-EAS1795_0092:3:1:10470:2194#0/1
hhhhhhhhghhhhhhhhhhfhgghhhghhhhgg
@HWUSI-EAS1795_0092:3:1:11023:2193#0/1
TGGCAATCCAACACGGGGGTGTAGCCGTTGGCA
+HWUSI-EAS1795_0092:3:1:11023:2193#0/1
hghhhhfhhhhhhhhhhggghehhhhhhdhfgh
@HWUSI-EAS1795_0092:3:1:11848:2189#0/1
CTTTTGTGGCCCCTTTCCGGTGATGATACACAG
+HWUSI-EAS1795_0092:3:1:11848:2189#0/1
gggggfgggggggfggggeg_g_ffffgggggg
@HWUSI-EAS1795_0092:3:1:12036:2195#0/1
CAAGAACAAGATCGGCCCCAAGAAGCCGCTGCC
+HWUSI-EAS1795_0092:3:1:12036:2195#0/1
hfhhhhhhhhhhhhhhhhhhhgdhghdhhehhh
@HWUSI-EAS1795_0092:3:1:12397:2196#0/1
GTCGCTTCTGGTTGTGCCAACCTATCTGAGCCG
+HWUSI-EAS1795_0092:3:1:12397:2196#0/1
affafffeccdaa`a_afffafSeceecffffd
@HWUSI-EAS1795_0092:3:1:12953:2191#0/1
ATCAAGTCGATGAAAATCTGAAGAAGAAGCGTA
+HWUSI-EAS1795_0092:3:1:12953:2191#0/1
ghhhhhhhhhfghghhhghhhhchhhhhgggfh
@HWUSI-EAS1795_0092:3:1:13387:2199#0/1
TAAATAGCCCATACCTACCTTTTTTGTAAACAA
+HWUSI-EAS1795_0092:3:1:13387:2199#0/1
hhhhhhhhhhhfhhghhhhhhhhhhehgehhhh
@HWUSI-EAS1795_0092:3:1:13515:2194#0/1
TTAAAGCAGGCTTCAAATGCCTGAATATTCTGT
+HWUSI-EAS1795_0092:3:1:13515:2194#0/1
hhhhghhhhhhhhhehhhhhhhhghghhhhhgh
@HWUSI-EAS1795_0092:3:1:13542:2188#0/1
AAAACAAATGCCTTATTAGCTGTCCGGACGGAT
+HWUSI-EAS1795_0092:3:1:13542:2188#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:13639:2194#0/1
GAGATTGCCACCAAGCTGGCCGAAGTGCAGCAC
+HWUSI-EAS1795_0092:3:1:13639:2194#0/1
dfcdcfcffffff^cd_ceedeaffca]abb^b
@HWUSI-EAS1795_0092:3:1:14249:2193#0/1
ATCGGAGTGGTGTCGGTGTACTTGGCGAACTTC
+HWUSI-EAS1795_0092:3:1:14249:2193#0/1
hhhhhhhhhhhdhhhhdhfhhhhhhdhhffhfh
@HWUSI-EAS1795_0092:3:1:15005:2195#0/1
GTTTGGCTGCTTATGAAGCGGCCAATCGAAACC
+HWUSI-EAS1795_0092:3:1:15005:2195#0/1
hhhhhhhhfhhhhhfhhhdhhghhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15115:2190#0/1
GGGTTGTTTGCTATGCTAATACAGCCTTGATTG
+HWUSI-EAS1795_0092:3:1:15115:2190#0/1
hhhhhhhhhhghhhhhhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15425:2195#0/1
CAGTTACAAAAAACCAACACAAAAATGGCCAAG
+HWUSI-EAS1795_0092:3:1:15425:2195#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhhg
@HWUSI-EAS1795_0092:3:1:15539:2190#0/1
GCAAAGGTCCATGCAAAGGTCGTGGGAGATCAG
+HWUSI-EAS1795_0092:3:1:15539:2190#0/1
hhhhhhhhhhhhhhhhfghhhhfhhfefffffh
@HWUSI-EAS1795_0092:3:1:15768:2196#0/1
GTGGATTTTTGTGGGTGGGTGCCCTGGAAGTGG
+HWUSI-EAS1795_0092:3:1:15768:2196#0/1
hhhhfhhghhhhhhhhghhhhhhhhhghhcehh
@HWUSI-EAS1795_0092:3:1:15941:2198#0/1
TTGTCTTTGTCAGAGAATTCGATCACGATACAA
+HWUSI-EAS1795_0092:3:1:15941:2198#0/1
ggfggggdcgfggafdgggggcgggecgdgfgg
@HWUSI-EAS1795_0092:3:1:16063:2195#0/1
TGTGAGTCAGCTGCTGGGATAGATGGCCACCAG
+HWUSI-EAS1795_0092:3:1:16063:2195#0/1
cccccccccaccZS[\^a]K[]SLZZXcccc[c
@HWUSI-EAS1795_0092:3:1:16606:2196#0/1
CAGAAGTACGGCAAGGTCGAGCAGGCCCTCGAG
+HWUSI-EAS1795_0092:3:1:16606:2196#0/1
hhhhhghhhhfghhhhchhhhhghgehhchfag
@HWUSI-EAS1795_0092:3:1:17010:2190#0/1
GGCGGGATAAAAAACACTAATTACAAAGCGATA
+HWUSI-EAS1795_0092:3:1:17010:2190#0/1
]fffacc_]dfcZW[ZUfdfcffffda]d^^]_
@HWUSI-EAS1795_0092:3:1:17652:2193#0/1
CAGCCTTAATGACACCGACAGCCACGGTCTGCC
+HWUSI-EAS1795_0092:3:1:17652:2193#0/1
hhhhhhhhhhhhhhhhhhhhghghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:17876:2191#0/1
GGGTTTCTTAGACTTCTTGGCGGCGTAAGCGGC
+HWUSI-EAS1795_0092:3:1:17876:2191#0/1
hhhhhghhhhhghhhgghhhehhhhhhhffgha
@HWUSI-EAS1795_0092:3:1:18212:2193#0/1
GTTGGCGTTGGGGCCGCGACGACGGCCGAAGCC
+HWUSI-EAS1795_0092:3:1:18212:2193#0/1
f]fffSfffffff[fffffff_dffaccfeaff
@HWUSI-EAS1795_0092:3:1:18479:2196#0/1
GAAAAAGCTCGAACCATGGTTAGTGGTGCAAAG
+HWUSI-EAS1795_0092:3:1:18479:2196#0/1
hghhhhhhhhhhhhhghhhhhhhhhhghhghch
@HWUSI-EAS1795_0092:3:1:18685:2189#0/1
GCAGCAGCATTGCCCACTAAATGGAACTCTTGA
+HWUSI-EAS1795_0092:3:1:18685:2189#0/1
hfdhfhhhhghhhhhhhhhhhgfhdhdhhhghh
@HWUSI-EAS1795_0092:3:1:18917:2196#0/1
CGGCAATGTAAGGAATTTCGAGCAGCATAGCGG
+HWUSI-EAS1795_0092:3:1:18917:2196#0/1
hhhhhhhhhhhhghhhhhhhfhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:19099:2192#0/1
AGGAACCGCAGGTACGGACCAATGGCACAATAC
+HWUSI-EAS1795_0092:3:1:19099:2192#0/1
hhghhhhgehhhghhhcfhhhhhhhghhghghh
@HWUSI-EAS1795_0092:3:1:19503:2192#0/1
TGAAGAAGCGCCCCTCCAAGGCAAACTTCAGCG
+HWUSI-EAS1795_0092:3:1:19503:2192#0/1
ffffdffdddedf````gggfggg]cgfaf_d`
@HWUSI-EAS1795_0092:3:1:19747:2189#0/1
CCGCGGGGTGGTTGTGGGGGCTACCAGCAGCGA
+HWUSI-EAS1795_0092:3:1:19747:2189#0/1
hhhhhhhhcgfgffcffhgheehhghhfhgfgc
@HWUSI-EAS1795_0092:3:1:1184:2199#0/1
ATTGTTTTCAGCTTATCCAAGACATCACTGGGA
+HWUSI-EAS1795_0092:3:1:1184:2199#0/1
dfdfac_`cfcfffeYaddcfdcfdaffffYc\
@HWUSI-EAS1795_0092:3:1:2316:2200#0/1
CCCAGGAGAGCGTGGAGAGGATGGATTCACCGG
+HWUSI-EAS1795_0092:3:1:2316:2200#0/1
fffccfffffddafffcQffffegggffcffda
@HWUSI-EAS1795_0092:3:1:2796:2205#0/1
TCCTGCGTTACTCCAAGGCCCAGATGTACAAGC
+HWUSI-EAS1795_0092:3:1:2796:2205#0/1
edaffffgdgfgacfacgaggffegfga_[afa
@HWUSI-EAS1795_0092:3:1:3528:2204#0/1
GCGGATCGTGCTCATCTGAAGCATCTTGCCGGT
+HWUSI-EAS1795_0092:3:1:3528:2204#0/1
cccccccBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3635:2210#0/1
GCAGGTGTTCATGTTGCGCAGCACATTCGTCTT
+HWUSI-EAS1795_0092:3:1:3635:2210#0/1
hhhhhghhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4399:2206#0/1
GGCCTCGTCTGCATTTAGCATTCGTATCCGTCG
+HWUSI-EAS1795_0092:3:1:4399:2206#0/1
daacdcdd_OadZYZYYfWffdcab[d\aOUZP
@HWUSI-EAS1795_0092:3:1:5086:2201#0/1
GGTTGATTTGCGTTTTATCTTTGGACTACTGCT
+HWUSI-EAS1795_0092:3:1:5086:2201#0/1
hhhhhhhhhfhhhhhhghhhhhghhghhhhhhg
@HWUSI-EAS1795_0092:3:1:5289:2210#0/1
CTCAAATTGCAGGTGTCCCTCAAGGCGGAATCG
+HWUSI-EAS1795_0092:3:1:5289:2210#0/1
hhhhhhhhhhhhhhhghhhhhghhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:5805:2200#0/1
AGAACACAAAGTCATTGACTAACTAAAGACCAT
+HWUSI-EAS1795_0092:3:1:5805:2200#0/1
fhfghhhhhhhhhhhhfehhhhhhhhhghhchh
@HWUSI-EAS1795_0092:3:1:5842:2200#0/1
ATACGTTCAATGTGTTTTATCTTTACAATAAAT
+HWUSI-EAS1795_0092:3:1:5842:2200#0/1
afdfaffffcfag_ggegcgggggggaggggeg
@HWUSI-EAS1795_0092:3:1:6589:2210#0/1
GTCAGGTTGCACTTGCCGCAGTAGTGACGATCT
+HWUSI-EAS1795_0092:3:1:6589:2210#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6774:2200#0/1
CGGGTACTGTGGAGTTGCGAACGTTGGGCGGAA
+HWUSI-EAS1795_0092:3:1:6774:2200#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhghhhg
@HWUSI-EAS1795_0092:3:1:6867:2209#0/1
CACTAGTCAGGAAAGCCGGCACGAAACGGATCA
+HWUSI-EAS1795_0092:3:1:6867:2209#0/1
hhhhhhhhghhhhhehhghhgfgghhhehhhhg
@HWUSI-EAS1795_0092:3:1:7037:2207#0/1
GCGAGGGATACCTGTGAGCAGCTTTCACTCCTA
+HWUSI-EAS1795_0092:3:1:7037:2207#0/1
f_d]cddW]dddffcf_^a_a^`daad[fffcc
@HWUSI-EAS1795_0092:3:1:7374:2207#0/1
GTTCGTTCATCAAAACTTCAGTAGCATCCTGTC
+HWUSI-EAS1795_0092:3:1:7374:2207#0/1
hhhhhhhhhhhhghhhhhhhehghhhhgghhgh
@HWUSI-EAS1795_0092:3:1:7894:2199#0/1
CGACTCGCTGTCCATGCGGTCGGAGCATTTGGC
+HWUSI-EAS1795_0092:3:1:7894:2199#0/1
hhhhhhhhgghhhhhhfhhghhhchhhhhhghh
@HWUSI-EAS1795_0092:3:1:8009:2208#0/1
GCTTGATCAGCTGGCGCACGTTGGTCAGGGGGT
+HWUSI-EAS1795_0092:3:1:8009:2208#0/1
hhhhhhhhhhhhfhhhhhhhhfghhhhhhhhhe
@HWUSI-EAS1795_0092:3:1:8288:2203#0/1
TTTCTTGCTGCAACGTGCCGACTTGCGGCTGTC
+HWUSI-EAS1795_0092:3:1:8288:2203#0/1
ffff`_cddddafcc`_```^`baRdd^BBBBB
@HWUSI-EAS1795_0092:3:1:8578:2202#0/1
GTTATGCGATTGAATTGTCGGATTGTGGGAGTA
+HWUSI-EAS1795_0092:3:1:8578:2202#0/1
hhhhhhhhhhhhhghhchhhhfhhghffhhffh
@HWUSI-EAS1795_0092:3:1:8935:2211#0/1
AAGCTGTGGGCCTTCACGGGACCCGGTTTTCTT
+HWUSI-EAS1795_0092:3:1:8935:2211#0/1
hhhhhghhghhhhhhhhhhhhhhhhhghghfhh
@HWUSI-EAS1795_0092:3:1:9819:2206#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9819:2206#0/1
de^^_^cdbbfb[ff_f`]bb`dcdd][^bd`Y
@HWUSI-EAS1795_0092:3:1:11449:2202#0/1
GCGGATCTTGTCCAGGGCATCGGAAGCGTTCGA
+HWUSI-EAS1795_0092:3:1:11449:2202#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11561:2201#0/1
GCGAACGCTGGACCTAACATCGCAGCTGGTAAA
+HWUSI-EAS1795_0092:3:1:11561:2201#0/1
ghgghhhhhhhghhhghfhhhhhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:11945:2201#0/1
CCATCAACTACTTTAAGCACATCTTGCTCGGCT
+HWUSI-EAS1795_0092:3:1:11945:2201#0/1
\[W\\\\a^^a^aaaa`aacaadddddXaab_f
@HWUSI-EAS1795_0092:3:1:12187:2201#0/1
TTCCGACTGCGCCTTCATGGTCGACAACGAGGC
+HWUSI-EAS1795_0092:3:1:12187:2201#0/1
hhhhhhhhhhhhhhhhhhhhhhhghgghhhhfh
@HWUSI-EAS1795_0092:3:1:12250:2206#0/1
GGAGAATCAAGAATCAGGATACGATAGTAGCAA
+HWUSI-EAS1795_0092:3:1:12250:2206#0/1
hhhhhhhhhhghhfghghfdhhhgeghhfhghh
@HWUSI-EAS1795_0092:3:1:12800:2210#0/1
GCGACGTAGTATTATTTGATTGTCATTCACAAT
+HWUSI-EAS1795_0092:3:1:12800:2210#0/1
ggggfgggggggdffffgfggfgffggggfggg
@HWUSI-EAS1795_0092:3:1:13807:2209#0/1
CAGAAGCATAAGTTTAATTTCTTCCATCGAAAG
+HWUSI-EAS1795_0092:3:1:13807:2209#0/1
ggggggdegggggeggfggggggggg]gggegg
@HWUSI-EAS1795_0092:3:1:13859:2203#0/1
GGCGAACGGTTTAAGAATCGAACGAAACTTGCA
+HWUSI-EAS1795_0092:3:1:13859:2203#0/1
hhhhghhhhhhhfgahhhhhhhfhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:14932:2207#0/1
GTAGGACAGGCGTCTCCGGAGCGTCAGACGTTG
+HWUSI-EAS1795_0092:3:1:14932:2207#0/1
hhhhhhhhhghghhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15061:2209#0/1
GCACAGTTTATTCATTTTGTGGTACATAGTTTA
+HWUSI-EAS1795_0092:3:1:15061:2209#0/1
ggggfggggggggdggggfeggdffdfggfggg
@HWUSI-EAS1795_0092:3:1:15503:2205#0/1
GTTGACACAAGCCAAGGTTTATTGTAGAATTCT
+HWUSI-EAS1795_0092:3:1:15503:2205#0/1
hhhhghhhhfhhhhfghhheehhehghhhhhhh
@HWUSI-EAS1795_0092:3:1:15642:2205#0/1
GGCTGACATATTTACAAAACCGTTGCCTGCTGC
+HWUSI-EAS1795_0092:3:1:15642:2205#0/1
fd[Rd[^bcdddc[addfc`cf^^aW^O\^Y^c
@HWUSI-EAS1795_0092:3:1:15754:2210#0/1
CTTATTCGACATGTGCAACAAAAATCCTTTGCC
+HWUSI-EAS1795_0092:3:1:15754:2210#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16440:2208#0/1
CTTATGTCGGCGATGAGGCACAGAGCAAACGTG
+HWUSI-EAS1795_0092:3:1:16440:2208#0/1
gggffggggggffcfdffcfdf_ffffJ[ZaWg
@HWUSI-EAS1795_0092:3:1:16997:2209#0/1
TGGTTGTTTACTTGCTTTATAAGTTGTTTCGAA
+HWUSI-EAS1795_0092:3:1:16997:2209#0/1
ff^aeeeff`ffggfgef__ffggcggggfgag
@HWUSI-EAS1795_0092:3:1:17494:2200#0/1
CCTCGATGTTGGATTAAGATATAATTTTGGGTG
+HWUSI-EAS1795_0092:3:1:17494:2200#0/1
ggggggggggggegggggeg]gggggggggggg
@HWUSI-EAS1795_0092:3:1:17754:2209#0/1
AATTGCGATTGCAATTGATTGACAACCCGAACG
+HWUSI-EAS1795_0092:3:1:17754:2209#0/1
ffdggagfcfdffff[a]ffffggfgggfcggf
@HWUSI-EAS1795_0092:3:1:17965:2209#0/1
GCCGGCTGCTTGTGCTTAATACTGCTGGATGTG
+HWUSI-EAS1795_0092:3:1:17965:2209#0/1
hhhfghhhaghhhcchhghfgfghhhhh[gheh
@HWUSI-EAS1795_0092:3:1:18052:2204#0/1
TAACTTCTTGTATATTTTCCACAAGATCCGTTA
+HWUSI-EAS1795_0092:3:1:18052:2204#0/1
gggggggfgfggggggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:18099:2207#0/1
CCGGCTTGGGCGGCTGGCCCAGAACACATTTTA
+HWUSI-EAS1795_0092:3:1:18099:2207#0/1
f_fdfffdffffcca]ffffdfffQ_Wbdbdb]
@HWUSI-EAS1795_0092:3:1:18231:2210#0/1
GGCCAAATGGCCGACAGAGCGGCTCGGTCGCAC
+HWUSI-EAS1795_0092:3:1:18231:2210#0/1
]Vfcacfgggaga\c^affffafffaK_^BBBB
@HWUSI-EAS1795_0092:3:1:1283:2212#0/1
CGGCAGGGGTCTGGAAGCGACCGTGACCCATCT
+HWUSI-EAS1795_0092:3:1:1283:2212#0/1
YfaS\cfaa^cY^aaW_Yddd^WQ\]JZKXPZ^
@HWUSI-EAS1795_0092:3:1:1802:2216#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:1802:2216#0/1
cfcffffffffffeabbeebde]dffcdfffac
@HWUSI-EAS1795_0092:3:1:3129:2213#0/1
CCACAACCTGTCCCATACGCTTCTCGTAGAAGA
+HWUSI-EAS1795_0092:3:1:3129:2213#0/1
hhhhghhhdhhhhhhghhhhghfgfhhhhhhgh
@HWUSI-EAS1795_0092:3:1:3291:2222#0/1
GGGGTGGTGTGCATTCTGGGAAGTGTTAACTGA
+HWUSI-EAS1795_0092:3:1:3291:2222#0/1
hhhfhhhghhfhhghhhhhhhfhhhhhhhfchg
@HWUSI-EAS1795_0092:3:1:3736:2211#0/1
CCTGCTCTGAGTGTGTGCATAATAAAATTATGA
+HWUSI-EAS1795_0092:3:1:3736:2211#0/1
gggggggggggggggggcgggggggggggggdf
@HWUSI-EAS1795_0092:3:1:4159:2217#0/1
CGGGCTTGGAATAATTAGCGGGGAAAGAAGACC
+HWUSI-EAS1795_0092:3:1:4159:2217#0/1
hhhhhhhhhhhhghhhhhhhhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:4236:2220#0/1
ATCTCTATCCTAATTCCAATAAAATGTTTTATT
+HWUSI-EAS1795_0092:3:1:4236:2220#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4752:2212#0/1
CCAAGAAGCTGCCCCGCAAGACGCACAAGGGTC
+HWUSI-EAS1795_0092:3:1:4752:2212#0/1
ggfggfggggfggggegegaggacfedcdcfab
@HWUSI-EAS1795_0092:3:1:4770:2211#0/1
TGGTCTCGCTGTCAGTGATCTCCATGTCGACGG
+HWUSI-EAS1795_0092:3:1:4770:2211#0/1
]ffffeffffffccfffcgggfgggcggggggg
@HWUSI-EAS1795_0092:3:1:5674:2219#0/1
CGACCAAGAAATAGCACAAGAACTCCCCAAAAA
+HWUSI-EAS1795_0092:3:1:5674:2219#0/1
hhhhhhghhhfgghhhhhhhhghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:6057:2217#0/1
CATCGATCTCGAACACCTCGTTGGGAATATCAT
+HWUSI-EAS1795_0092:3:1:6057:2217#0/1
hhhhhfhhhhhhhhhhghhfhhfhfhfhghgfh
@HWUSI-EAS1795_0092:3:1:6372:2220#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6372:2220#0/1
hhhhhhhhhhffghhhhhhhghafhghhaehhe
@HWUSI-EAS1795_0092:3:1:6729:2211#0/1
TTTCTACCGATTTCCTCAGCGACACCCACTCGT
+HWUSI-EAS1795_0092:3:1:6729:2211#0/1
^caY__ccc_caaa^RXcc^ccaccccBBBBBB
@HWUSI-EAS1795_0092:3:1:7017:2215#0/1
CATTGATTATTCGGGGCTTCTACATTAACAGAT
+HWUSI-EAS1795_0092:3:1:7017:2215#0/1
hghhhghhhhhhhhhhhhhghhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:7834:2211#0/1
CTGCTGTGGGGCGCCTCCAAACTGGTCCCAGTC
+HWUSI-EAS1795_0092:3:1:7834:2211#0/1
hhhhfhhhfhfhghhhhhhhhhdghdggghhhh
@HWUSI-EAS1795_0092:3:1:8169:2221#0/1
TGCGGCTTCACCGGCTCCTGCTTCATTTTTGCT
+HWUSI-EAS1795_0092:3:1:8169:2221#0/1
ggggggggggggfggegf_ccffffffgggac`
@HWUSI-EAS1795_0092:3:1:8492:2220#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8492:2220#0/1
ghehghhhgghhghghhhhhhhhhhfhfhfhcf
@HWUSI-EAS1795_0092:3:1:9201:2217#0/1
GCTCCTTGCCGGCGTGCCGCGGATCCAAGACCA
+HWUSI-EAS1795_0092:3:1:9201:2217#0/1
aScccccaaaBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:9914:2217#0/1
GACGCTGGCGGACGCCAAGGATTTGGCCATCAA
+HWUSI-EAS1795_0092:3:1:9914:2217#0/1
ggggggggggggf_gggfaffaggfggggafgg
@HWUSI-EAS1795_0092:3:1:10381:2217#0/1
CATCAAGCCATTCCAGGTCCGAAACCATCTGTG
+HWUSI-EAS1795_0092:3:1:10381:2217#0/1
ffff^^fdcfc__aa^a^c^ca]`^bac\acW_
@HWUSI-EAS1795_0092:3:1:11339:2216#0/1
GCCGATTCGTTTATTTAGGCGTTTTTTTCACGC
+HWUSI-EAS1795_0092:3:1:11339:2216#0/1
ffahffhhhhhhhfhhehhghhghhhhhhhcgc
@HWUSI-EAS1795_0092:3:1:11485:2217#0/1
GGGGCGTCCCAACTCGAACTTGCGCTTCTTGCG
+HWUSI-EAS1795_0092:3:1:11485:2217#0/1
gggggegggfgggggfgggfgdgggggggeggg
@HWUSI-EAS1795_0092:3:1:11534:2214#0/1
TGGATATCGCCTTGAGCACAGGTGGTGGCGGGG
+HWUSI-EAS1795_0092:3:1:11534:2214#0/1
gggggKgggggggaegggggggfggggddfdBB
@HWUSI-EAS1795_0092:3:1:12038:2213#0/1
CGAGATGATCACCTGAATGAAAGTAAGGGATCA
+HWUSI-EAS1795_0092:3:1:12038:2213#0/1
hhhhhgghhhhhhhhhhhhhhhfghhhgehhgh
@HWUSI-EAS1795_0092:3:1:12320:2221#0/1
TTGGAGACCAGCTGCGGATATTGGTACGGCCTG
+HWUSI-EAS1795_0092:3:1:12320:2221#0/1
hhhhhhhhghhhhfhhhcafafhfhghhghhfg
@HWUSI-EAS1795_0092:3:1:12434:2215#0/1
GCTAGATGGATCCCAATCCCCCAAACAAAACGG
+HWUSI-EAS1795_0092:3:1:12434:2215#0/1
hhhhghhhchhhhhhhhhhhhhhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:12899:2222#0/1
TGCCCTTTTCATCGGTGGCTACCTTGCAGCTTA
+HWUSI-EAS1795_0092:3:1:12899:2222#0/1
aX`a_a]__^_\_XaQSOWKTQ^BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13272:2214#0/1
CGGACTTGGTCACCTTGATCTCCAGGTCGAGGG
+HWUSI-EAS1795_0092:3:1:13272:2214#0/1
hchhhhhhhhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13442:2217#0/1
ACACCATCGGTCCACTCCTGCTTCGCCACAGTC
+HWUSI-EAS1795_0092:3:1:13442:2217#0/1
gggdggcgggggggfadggcgegggggggdggf
@HWUSI-EAS1795_0092:3:1:14172:2212#0/1
ATCGTGCACAAGAAGACCCTGGGAGTCGTGCCA
+HWUSI-EAS1795_0092:3:1:14172:2212#0/1
ggggggggggggggfgggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:14346:2217#0/1
CTGCACTTGGTGCTCCGCCTGCGTGGTGGTATC
+HWUSI-EAS1795_0092:3:1:14346:2217#0/1
hhhhhhhhhhhhhhhhhhhhgfhghhfhhghhh
@HWUSI-EAS1795_0092:3:1:14640:2218#0/1
GGAACTTCCATCTGCGTCGCCAGCACAAGTTCA
+HWUSI-EAS1795_0092:3:1:14640:2218#0/1
hhhghhhhhhhhfhghhgghggheghhhhhghg
@HWUSI-EAS1795_0092:3:1:14699:2212#0/1
GCCCGCTGCTGAAAAGGAGAAGAAGAAGGAGGA
+HWUSI-EAS1795_0092:3:1:14699:2212#0/1
hhhhhhhhhhhhhhhggechhfghhghhhdhh`
@HWUSI-EAS1795_0092:3:1:14747:2215#0/1
GGAGAATCCTGTTCATGGATCCATTGGCCCCAC
+HWUSI-EAS1795_0092:3:1:14747:2215#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14949:2222#0/1
TGGGTCTGGGCCTTCCTCAGCTGGGTGAGGATG
+HWUSI-EAS1795_0092:3:1:14949:2222#0/1
gcggggaffdffdffggfeggggcgggfeff]f
@HWUSI-EAS1795_0092:3:1:16479:2221#0/1
GGACATTCCGCTGCCCCGGCTGTCCTGTTTCAC
+HWUSI-EAS1795_0092:3:1:16479:2221#0/1
gcggggegfggdgggggafcffecfffcdfcfg
@HWUSI-EAS1795_0092:3:1:17269:2217#0/1
GTTCCGCCGTTTGCTGATTATACTGACGCAAAA
+HWUSI-EAS1795_0092:3:1:17269:2217#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18450:2214#0/1
TGTTGCTCGGCAAGGAGAAATTCGCCGGCGTCG
+HWUSI-EAS1795_0092:3:1:18450:2214#0/1
hhhhghhhhhgffgehd_cfffhhhggeheegg
@HWUSI-EAS1795_0092:3:1:19106:2220#0/1
TGAGCCCGAAGCTCTGGAGATCCTGAAGAAAAA
+HWUSI-EAS1795_0092:3:1:19106:2220#0/1
ggfggggggfgggdggfdgcggggggcggg`gg
@HWUSI-EAS1795_0092:3:1:19183:2220#0/1
AAACTGTGGAATCCGAGGCGGCCGCCTTCTTTG
+HWUSI-EAS1795_0092:3:1:19183:2220#0/1
hhhhhhhhhhhhhhhgfhfghfhgghhhhhhhg
@HWUSI-EAS1795_0092:3:1:19418:2213#0/1
AAACTGTTCACATGAACTTGGAATTCCCAGTAA
+HWUSI-EAS1795_0092:3:1:19418:2213#0/1
efgfgagggggggfgggggggggggggcggggg
@HWUSI-EAS1795_0092:3:1:19549:2217#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19549:2217#0/1
^Uc[c\c]`cdb^dS_^aa`eceabdedcdbc^
@HWUSI-EAS1795_0092:3:1:1618:2226#0/1
CCAGGGTCTTCTTGTGCACGATGCCGCTGTAGC
+HWUSI-EAS1795_0092:3:1:1618:2226#0/1
eeWffaff[]fcffcffWff_Wffafd^aWca`
@HWUSI-EAS1795_0092:3:1:2069:2229#0/1
GGTTTCTCTCTCTCTTCCTTCTGTTTTTTTTTT
+HWUSI-EAS1795_0092:3:1:2069:2229#0/1
gggggfgggggggggggfffcfggggfgggggg
@HWUSI-EAS1795_0092:3:1:2339:2230#0/1
CTATAGAATAGAGCCGGGATCTCGAAAGGTTGA
+HWUSI-EAS1795_0092:3:1:2339:2230#0/1
hhhhhhhhhgfghhhfhhghhghhhgfghhggh
@HWUSI-EAS1795_0092:3:1:3911:2229#0/1
CAAGAGCAAACTCTGGACACGGATGTTGAGATG
+HWUSI-EAS1795_0092:3:1:3911:2229#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhghggfg
@HWUSI-EAS1795_0092:3:1:3955:2224#0/1
TGCGGATATTGGTACGGCCTGTTGAGAAGTTTG
+HWUSI-EAS1795_0092:3:1:3955:2224#0/1
ZVYbaabaf[fff_dfffdWfacdbdeffcfff
@HWUSI-EAS1795_0092:3:1:4086:2228#0/1
TTCGTAGTTGTTGCTGCTACTGCTGCTCGTTGC
+HWUSI-EAS1795_0092:3:1:4086:2228#0/1
hhhghhhhhhhhhhhhhfhfhdghhghhhhhgh
@HWUSI-EAS1795_0092:3:1:4199:2229#0/1
TTGCGGATGCGGTGCACAGAGGCAGAATCGCCG
+HWUSI-EAS1795_0092:3:1:4199:2229#0/1
gggggggggcgggegggggaggggggggggggg
@HWUSI-EAS1795_0092:3:1:4697:2233#0/1
GGGGGAGCGGCAGCAGGCGTGGAGGCAGCCTTC
+HWUSI-EAS1795_0092:3:1:4697:2233#0/1
ffffffddfffff_fdc[caacacc^afdffc]
@HWUSI-EAS1795_0092:3:1:5038:2226#0/1
TGCGTTTGCAATTAAGTTATAATTGTTTTTTTT
+HWUSI-EAS1795_0092:3:1:5038:2226#0/1
daccddc\\___dad[daXaaa_bab]cccdcc
@HWUSI-EAS1795_0092:3:1:5174:2227#0/1
GATCGGTCTGGAAACCCAGGCAGTAGCAATAAT
+HWUSI-EAS1795_0092:3:1:5174:2227#0/1
hhhhhhhhhhhhhhhhhhhfhhhghhfhhhhag
@HWUSI-EAS1795_0092:3:1:5230:2231#0/1
GTTCAGTCGATACGCGCCGCGTAAGGAAAGGCT
+HWUSI-EAS1795_0092:3:1:5230:2231#0/1
hhhhhghhghhhfhfehhffhghhhefhghggg
@HWUSI-EAS1795_0092:3:1:5277:2231#0/1
TGCTGCAAGACCCTGTTGCTAACCACAAACTCA
+HWUSI-EAS1795_0092:3:1:5277:2231#0/1
hhhhghhghhhhghhhhghhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:5339:2227#0/1
GGAAAGTTGTGTTTTTCGTACATTTTGCCAATT
+HWUSI-EAS1795_0092:3:1:5339:2227#0/1
hhhhhhhghhhhhhhhhghhhhhhhghhgghhh
@HWUSI-EAS1795_0092:3:1:6260:2229#0/1
CTTATGCAGTCGCCAGTGCAGGCCCAGCTTATG
+HWUSI-EAS1795_0092:3:1:6260:2229#0/1
hhhhhghhhhhhfhhghhfhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6692:2234#0/1
GCGGTCATCTATAATCGTGGTCAGTATCCGCCA
+HWUSI-EAS1795_0092:3:1:6692:2234#0/1
hhhhhhhhhhhhhhhhhhghhhhhghhhhghhh
@HWUSI-EAS1795_0092:3:1:6800:2234#0/1
CGGCGAATAAATCCACTGTCTACATGGACAGTG
+HWUSI-EAS1795_0092:3:1:6800:2234#0/1
fffffff_cfcZab]`\afdd]\_accccdacc
@HWUSI-EAS1795_0092:3:1:6967:2224#0/1
CGACAGCAAGGACAAGTAAGCTCTGGCTGCAGC
+HWUSI-EAS1795_0092:3:1:6967:2224#0/1
faffddcd^YdaSSaa\ffff_caddc]d[^a_
@HWUSI-EAS1795_0092:3:1:7689:2224#0/1
CTGCTGGAGAAGTACCGCCCCGAGTCGCCGCTG
+HWUSI-EAS1795_0092:3:1:7689:2224#0/1
hhhhhhhhhhhhghhhhhhhhghgfhghhdhff
@HWUSI-EAS1795_0092:3:1:8698:2225#0/1
AAGTCGCTCTCCCTGCTGGAGGCCTACAAGCTG
+HWUSI-EAS1795_0092:3:1:8698:2225#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:8988:2226#0/1
GTGACCGACCCCAACACCGATCACCAGCCCATC
+HWUSI-EAS1795_0092:3:1:8988:2226#0/1
hhhehhhhhhhhhhhhhhfhchhhhhhhhgdff
@HWUSI-EAS1795_0092:3:1:9052:2233#0/1
CCGGTATCTCCCTTCTGTCCAACCAAGCCGGGC
+HWUSI-EAS1795_0092:3:1:9052:2233#0/1
fggggcggegggdfgffgggggegggggggggg
@HWUSI-EAS1795_0092:3:1:10121:2229#0/1
GAAAAAGTACAACAGGGTATTTATTCAAAATGT
+HWUSI-EAS1795_0092:3:1:10121:2229#0/1
ghfhhhhdhffhfffffhffghfhhfhhhhhgh
@HWUSI-EAS1795_0092:3:1:10786:2227#0/1
GCGGTTGTTGTGGTCCTCATCCCGATGACGGGA
+HWUSI-EAS1795_0092:3:1:10786:2227#0/1
hhhhhhhhhfghhhhhghhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:12004:2225#0/1
AAGAAACCCCAATGAGAGTTCAACTCAAAACAC
+HWUSI-EAS1795_0092:3:1:12004:2225#0/1
hhhghhhhhhhhh_ghhhhhgghhhhhhhdghh
@HWUSI-EAS1795_0092:3:1:13047:2234#0/1
CGCGTATACAGGGTGTCTCGTTCCCAAACATAC
+HWUSI-EAS1795_0092:3:1:13047:2234#0/1
hfhhhhhfhhhhhdghhhhhhhhhghhfggghh
@HWUSI-EAS1795_0092:3:1:13228:2227#0/1
GGAGTCGCCCATCAAGCTGGCCAAGGTCGATGC
+HWUSI-EAS1795_0092:3:1:13228:2227#0/1
gfggggggggfggdgfgcgggggggggggggfg
@HWUSI-EAS1795_0092:3:1:13298:2230#0/1
GCCCTACAACCACTACCACCTGGTGGACTACCT
+HWUSI-EAS1795_0092:3:1:13298:2230#0/1
gggggggfgccgggegggggggfdfffeffffg
@HWUSI-EAS1795_0092:3:1:13787:2231#0/1
GGCTACACCCAAAATTATATCTTAATCCAACAT
+HWUSI-EAS1795_0092:3:1:13787:2231#0/1
hhhhhhhhhhhhghhhfhhhhhhhhghhhhhhc
@HWUSI-EAS1795_0092:3:1:14406:2226#0/1
GCTTGATTCCAAACTGCCGTTTCGGCAGCCGGC
+HWUSI-EAS1795_0092:3:1:14406:2226#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhfdh
@HWUSI-EAS1795_0092:3:1:15156:2232#0/1
CACCACGCAGGCCGGTGGACACCAGTAGAAGCG
+HWUSI-EAS1795_0092:3:1:15156:2232#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15261:2231#0/1
GGCCGACAGACGTGCGAATCCCTGGGGCAGCTC
+HWUSI-EAS1795_0092:3:1:15261:2231#0/1
ghhhhghhhhhhhfhhhhghhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:16054:2233#0/1
GGCGACTATCAGAATGAACTAGGAGAGTTAACA
+HWUSI-EAS1795_0092:3:1:16054:2233#0/1
hhhhghhghhhhhhhhhgghghhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:16338:2228#0/1
GAGGTATTTCGCATAGTCCGGCTCCTTCCAGTA
+HWUSI-EAS1795_0092:3:1:16338:2228#0/1
hhhghhhhhhhhhghhghhhhhhchhhghhhhh
@HWUSI-EAS1795_0092:3:1:16756:2227#0/1
ACTACCCAACCGTCGCCCGGGGCCAGGAGAAAT
+HWUSI-EAS1795_0092:3:1:16756:2227#0/1
hfhhhhhhghghhgfhhhhhhhghghhggahgg
@HWUSI-EAS1795_0092:3:1:17278:2234#0/1
TGGTTATGATGAACTGGCCGGCTGGCGCGGGGA
+HWUSI-EAS1795_0092:3:1:17278:2234#0/1
hhhhhhhhhhhhhhhhfhhghh_hffehhhghc
@HWUSI-EAS1795_0092:3:1:17321:2230#0/1
CCCACAGAAGAAAAGGCAGAAAGTAGCCCTGAG
+HWUSI-EAS1795_0092:3:1:17321:2230#0/1
da__dda_c^ac```dRZYZ\Zcfdffad^^^a
@HWUSI-EAS1795_0092:3:1:17386:2230#0/1
GCGACGGCAGTCTTGGAGACAGCTGCGGAGATG
+HWUSI-EAS1795_0092:3:1:17386:2230#0/1
gggggKgfffffggggggggfgggggggggfdg
@HWUSI-EAS1795_0092:3:1:17554:2229#0/1
GCGCTTGCACTTTCGCTGCTGCTTCCTCGACTT
+HWUSI-EAS1795_0092:3:1:17554:2229#0/1
gggggggggggggggggggfgfgggggfggggg
@HWUSI-EAS1795_0092:3:1:17684:2223#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17684:2223#0/1
ghhhhhhhhhhgaffffhhhhgfghfhd]ffff
@HWUSI-EAS1795_0092:3:1:17839:2225#0/1
AAACAGCAGAGCACTTAAAAGAAATTGGAATTG
+HWUSI-EAS1795_0092:3:1:17839:2225#0/1
hhhhhhhghhhghhhhhhhhghhhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:17933:2226#0/1
CCTCCCTGTTGGTCATTCTGCTTGGGCAAGGCC
+HWUSI-EAS1795_0092:3:1:17933:2226#0/1
hhhhhhhhhhhhgchhhhhhdhhg_hhhgfchh
@HWUSI-EAS1795_0092:3:1:18075:2223#0/1
TGCAACTTAAACAAATAACAATATGAATTCGTG
+HWUSI-EAS1795_0092:3:1:18075:2223#0/1
hhhghhhhhhhhghhhhhhhhchhghhhhhhcf
@HWUSI-EAS1795_0092:3:1:18242:2230#0/1
GGGAAACACAAGCCGGAATTATTTCGCGCACCA
+HWUSI-EAS1795_0092:3:1:18242:2230#0/1
gggggffggaggffgggggg\cfffcfgggffg
@HWUSI-EAS1795_0092:3:1:18630:2233#0/1
GGAAAATTGGGATCTGCGGCAGCCAAATCGTTG
+HWUSI-EAS1795_0092:3:1:18630:2233#0/1
fagggggggg_]b`bbff]fc_fcffe[`d``c
@HWUSI-EAS1795_0092:3:1:19075:2232#0/1
AACGAGCGCGCCTTCCAAAAACAATTCGGTGTC
+HWUSI-EAS1795_0092:3:1:19075:2232#0/1
hhhhhghhhhhhhhhhhhhghccfcffffcffh
@HWUSI-EAS1795_0092:3:1:19320:2224#0/1
GGCCGATCAAGTCGATGAAAATCTGAAGAAGAA
+HWUSI-EAS1795_0092:3:1:19320:2224#0/1
ffc^dd^\aaa^fefffafdf_fdfffffcf_f
@HWUSI-EAS1795_0092:3:1:19418:2232#0/1
GGCGAATTTATTTATGCCACTAAGCGTGGTATT
+HWUSI-EAS1795_0092:3:1:19418:2232#0/1
gfggafggggggggggggffgfgggcdgggcec
@HWUSI-EAS1795_0092:3:1:19480:2229#0/1
TGCACTACTAGCTGCTCCAGTCTTCCCGTTGTT
+HWUSI-EAS1795_0092:3:1:19480:2229#0/1
hhhhhhhhhhhhhhhWhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:19701:2232#0/1
TGAAGCGTTTGGCTAAGTCCGATCCTATGGTGC
+HWUSI-EAS1795_0092:3:1:19701:2232#0/1
hhhhhhhhhhhghdhhghhhhhchhhhhghfcf
@HWUSI-EAS1795_0092:3:1:2904:2240#0/1
GCTTGAGTCAAGGAGCCAACGTAAGGGCCACCA
+HWUSI-EAS1795_0092:3:1:2904:2240#0/1
hhghfghhhhhghhhhhhhghhhhhhegaghhh
@HWUSI-EAS1795_0092:3:1:2935:2236#0/1
TTGTTGTCGCATTCCTTACTCTCATTCGGGAAC
+HWUSI-EAS1795_0092:3:1:2935:2236#0/1
`b[d__afcfafcffffcffffdfdfffcf]ff
@HWUSI-EAS1795_0092:3:1:3175:2246#0/1
CGCCGCTTATGTTGTTGCTGTTGCCACAGAAAA
+HWUSI-EAS1795_0092:3:1:3175:2246#0/1
gggggggggdgggcggcgggggegggggfgggg
@HWUSI-EAS1795_0092:3:1:3419:2244#0/1
ATTTACCAGCGGCTGGACACAAAAAACGAAACA
+HWUSI-EAS1795_0092:3:1:3419:2244#0/1
faffcffffcffaRccccfafffcdccffff]f
@HWUSI-EAS1795_0092:3:1:3861:2241#0/1
TCCGCCTTTCCAGCGCGGCAGTGCGTCTCCGCT
+HWUSI-EAS1795_0092:3:1:3861:2241#0/1
caffffffdf_Yfdedfffcfadc[dWO_Z]Pd
@HWUSI-EAS1795_0092:3:1:4037:2242#0/1
CCACAGCCAGTTGATCAGATCCGGTCGAATGGA
+HWUSI-EAS1795_0092:3:1:4037:2242#0/1
hhhhhhhhhhhhhghhhhhhhhgaehhhhhhhg
@HWUSI-EAS1795_0092:3:1:4159:2238#0/1
GCCAGTTGGTTCTTGACTCCGGCAATGGTGGCA
+HWUSI-EAS1795_0092:3:1:4159:2238#0/1
ff`Wd`e^^Y^\cf]_ffffffgggggdbddff
@HWUSI-EAS1795_0092:3:1:4178:2241#0/1
GAGCAATTTAGCATAGCAACCGCAACGCAATCA
+HWUSI-EAS1795_0092:3:1:4178:2241#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:4224:2241#0/1
CAATGATCTTGATCTTCATGGTCGACGGTGCCA
+HWUSI-EAS1795_0092:3:1:4224:2241#0/1
hhhghhghhhhgghhhhhhhcfhhdghghghca
@HWUSI-EAS1795_0092:3:1:4264:2242#0/1
TCGGCCTTCCAGGTGAGCAAGTACCGCCCACGC
+HWUSI-EAS1795_0092:3:1:4264:2242#0/1
hhghhhhhhhhhhhhghhhhhhhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:4565:2241#0/1
CTTCCGTCTGGTCTACGACGTGAAGGGACGCTT
+HWUSI-EAS1795_0092:3:1:4565:2241#0/1
gggggggggfggggcegaggggacffffffefg
@HWUSI-EAS1795_0092:3:1:4731:2238#0/1
CCAAGACGGTGAAGAAGGCCGCTAAGGTCATCA
+HWUSI-EAS1795_0092:3:1:4731:2238#0/1
gfgfgagff_fffaffffggcggcecgffffaa
@HWUSI-EAS1795_0092:3:1:5145:2244#0/1
GCAGGGTGGACTCCTTCTGAATGTTGTAGTCGG
+HWUSI-EAS1795_0092:3:1:5145:2244#0/1
hhhhhhhhhhhghhhhhhhhghhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:5170:2245#0/1
GGCGCCTGCTCGGAGCAGTCCTCCCGTATGACT
+HWUSI-EAS1795_0092:3:1:5170:2245#0/1
fafafffggfgeedaffcgggfggegggfggdg
@HWUSI-EAS1795_0092:3:1:5606:2237#0/1
CGGCGAGCGGGATCTCGAGCGGGAACCGGACTT
+HWUSI-EAS1795_0092:3:1:5606:2237#0/1
c\a`aMaUW\]IUZZ\_J\ZaaaOaaaaBBBBB
@HWUSI-EAS1795_0092:3:1:6293:2236#0/1
GGGTTATCGATGGCCACGATGGCGCGGGCCGCC
+HWUSI-EAS1795_0092:3:1:6293:2236#0/1
fffcffffcffdggfggff]ffggcggggcgde
@HWUSI-EAS1795_0092:3:1:6532:2241#0/1
CAACCAACCTACTTAAAACAACCAGTCATAAAC
+HWUSI-EAS1795_0092:3:1:6532:2241#0/1
hhhghhhhhhhhhhhhhhhhhhhhhgfhhhhhg
@HWUSI-EAS1795_0092:3:1:6722:2237#0/1
CCAGGTTGTTCACCTTGCCGTTGACCTTAAGGC
+HWUSI-EAS1795_0092:3:1:6722:2237#0/1
a_dd]dcadcdYb`ba]ca\c\SX_T`Z_X_ST
@HWUSI-EAS1795_0092:3:1:6748:2238#0/1
ATGCCCTTTTCAAGCTCCTGAACATCGGCCACC
+HWUSI-EAS1795_0092:3:1:6748:2238#0/1
cdfdfdfaffffggaegfaffcggfgeecgagf
@HWUSI-EAS1795_0092:3:1:6872:2243#0/1
GTTGTTGGCTGCATTATGATGTTGGTTATATGC
+HWUSI-EAS1795_0092:3:1:6872:2243#0/1
hhhhhhhhhhhhhhhhhhehhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:7118:2240#0/1
GGTGAAAGTAACCGAGATCTTTGACTTTGACGA
+HWUSI-EAS1795_0092:3:1:7118:2240#0/1
ffaffffeggggffffddfffafdfffgggegg
@HWUSI-EAS1795_0092:3:1:7138:2235#0/1
CCTCTCCCTGGCAAACCACGTACACATACTGCT
+HWUSI-EAS1795_0092:3:1:7138:2235#0/1
bR^]`b\]^TY^fccffb[`bdb`][d^`NO`Q
@HWUSI-EAS1795_0092:3:1:7229:2239#0/1
CGTAGGCACCCTGTTTTCCATCATGGCAGCGGC
+HWUSI-EAS1795_0092:3:1:7229:2239#0/1
[QIUPQ]Zb^]]d]]]^cfffcf_dffcfW_ff
@HWUSI-EAS1795_0092:3:1:7875:2235#0/1
CTTCTGAAGCAGATCATCGGCATTGGGTATGTT
+HWUSI-EAS1795_0092:3:1:7875:2235#0/1
hhhhhhhhhhhhhhhghhhghhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:7994:2241#0/1
TTGCAAGGTTACTAATAAAGCCTTGATAGCATG
+HWUSI-EAS1795_0092:3:1:7994:2241#0/1
WcaZ\^^[a_a^]`\X^`ZZ``aff]f^PZV`a
@HWUSI-EAS1795_0092:3:1:8132:2245#0/1
CAGCAAAATCAAGTGAATCATCTCAGTGCAACT
+HWUSI-EAS1795_0092:3:1:8132:2245#0/1
gfgcfceggfagggggdafffc[ffccccfffa
@HWUSI-EAS1795_0092:3:1:8159:2241#0/1
GGAAGAACCTGAAGAAGAACCAGGGCGGTGGCG
+HWUSI-EAS1795_0092:3:1:8159:2241#0/1
gfdegggfggfggdggdcggcggdcgfgegggd
@HWUSI-EAS1795_0092:3:1:8217:2241#0/1
AAGCGCTTCAACGAGGCCCAGGACGAGTCGAAG
+HWUSI-EAS1795_0092:3:1:8217:2241#0/1
hhhhhhhhhhhhhhehhhhhhhhhhghghhhhh
@HWUSI-EAS1795_0092:3:1:8371:2243#0/1
GGAAGAGCACAATGCCCATTTCTAAAGTTCCAA
+HWUSI-EAS1795_0092:3:1:8371:2243#0/1
hhhhhhhhhhhhhhhhhhhhhgh[hhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8537:2239#0/1
CAGCTCATGGGTCTGAAAGGCCTGAATGCCCAG
+HWUSI-EAS1795_0092:3:1:8537:2239#0/1
gggdgffffgfgffgggggagggegfgdggggg
@HWUSI-EAS1795_0092:3:1:8873:2239#0/1
TTTTCTTAACCTCGAATCCGTCGACCAGGACCT
+HWUSI-EAS1795_0092:3:1:8873:2239#0/1
hhhhhhhhhhhhhhhghhhhhhaffffhhghgh
@HWUSI-EAS1795_0092:3:1:9097:2239#0/1
TAAAAAACCCAGCACATCGGAGCATGTAATTTT
+HWUSI-EAS1795_0092:3:1:9097:2239#0/1
hhhhhhhhghhhhhhhhhhggehffghhhhhhh
@HWUSI-EAS1795_0092:3:1:9527:2240#0/1
GCTTTCTCGAATTCTGGGCTACCTACGGAAGGA
+HWUSI-EAS1795_0092:3:1:9527:2240#0/1
hhhhhhhhhghhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9587:2239#0/1
CGGGCGTCGAGGAGTACACCTCGGGCATCTGGA
+HWUSI-EAS1795_0092:3:1:9587:2239#0/1
hhhhhghhhhhhghehhhhhhhhhhhhhhhhch
@HWUSI-EAS1795_0092:3:1:9687:2246#0/1
GGTGTATAGTGGATGCGTCTCTGGGGCTCGGGT
+HWUSI-EAS1795_0092:3:1:9687:2246#0/1
hhghhhhhgghhhhhhhghhffghhchhafhh`
@HWUSI-EAS1795_0092:3:1:9902:2235#0/1
TGCCAATTCTCTGCGACAAGCCAAGGCTCTTGG
+HWUSI-EAS1795_0092:3:1:9902:2235#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10306:2241#0/1
GTTGTTTTCCTTCTCCTTTTGTTCTTCACCCGT
+HWUSI-EAS1795_0092:3:1:10306:2241#0/1
aZZaUaWZV^^`WO_SZccWW\_Sdaada`d`^
@HWUSI-EAS1795_0092:3:1:10351:2241#0/1
AGCGCCTCATTCTGGGCTACTTCGATCGTAGGG
+HWUSI-EAS1795_0092:3:1:10351:2241#0/1
hhhhhhhhhhhhhghhhhhhhhfhfhgahfhhh
@HWUSI-EAS1795_0092:3:1:10572:2245#0/1
CATACACACACACACACACACAAAACCCTGCCC
+HWUSI-EAS1795_0092:3:1:10572:2245#0/1
hhhhhhhhhhhghhhhhhhhghhhhhgdhghfg
@HWUSI-EAS1795_0092:3:1:10776:2245#0/1
AACAAGCTGAAGAAGAAGTCCAAGGTCAAGCCC
+HWUSI-EAS1795_0092:3:1:10776:2245#0/1
hhhhhhhhhhhghgcghehhhhfhhefhhhhhg
@HWUSI-EAS1795_0092:3:1:10844:2241#0/1
TCTCAGTAAGCGAACATCGTTGATTGAAACAGC
+HWUSI-EAS1795_0092:3:1:10844:2241#0/1
hhghfhhghhhhhhhhghghhhfhhhhghghhh
@HWUSI-EAS1795_0092:3:1:11207:2242#0/1
ATTTGTCTTGAGTATATTCCTACAGAGAATCAA
+HWUSI-EAS1795_0092:3:1:11207:2242#0/1
ghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11318:2235#0/1
CTCTGGAATAGGCATCTCGTTTGGAGTCAACTT
+HWUSI-EAS1795_0092:3:1:11318:2235#0/1
hhhhhhhhhhhhhhhhghhhhhhhdhhghhghf
@HWUSI-EAS1795_0092:3:1:12240:2238#0/1
GCCGCAGAAGGAGCAAGTGTACTTGCTGTGCTG
+HWUSI-EAS1795_0092:3:1:12240:2238#0/1
hhhhhhhghhhfhghhfhghfhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12592:2238#0/1
GATTTTTTTCAGATGTTTTGTTTTTTACACTAA
+HWUSI-EAS1795_0092:3:1:12592:2238#0/1
b^accccZ[Wbaffffdfc`dcdcccc]ecced
@HWUSI-EAS1795_0092:3:1:13369:2236#0/1
CCCCGATCCGCAGCGGTTTTACTTCTGAAGACC
+HWUSI-EAS1795_0092:3:1:13369:2236#0/1
gggggggggdegfccfWfffccbdbb[[bb^`c
@HWUSI-EAS1795_0092:3:1:13469:2246#0/1
AAAGTTTTGTTTGTTTGGTACTCGAGTTGGGGT
+HWUSI-EAS1795_0092:3:1:13469:2246#0/1
hhhhhhhhfhhhghhhhghhhhhhhghhghhfh
@HWUSI-EAS1795_0092:3:1:13597:2240#0/1
GTGCTATCTTAGTATTCCTGCCCGGTTGGAACC
+HWUSI-EAS1795_0092:3:1:13597:2240#0/1
gghghdhhheaahhhhhhchhhhhcfcchghfh
@HWUSI-EAS1795_0092:3:1:13905:2241#0/1
CAACTGTGTATAAAAGTGAATGGAATGCATTCT
+HWUSI-EAS1795_0092:3:1:13905:2241#0/1
ggggfggfggcgggffga_fdffffafcdfafd
@HWUSI-EAS1795_0092:3:1:14699:2246#0/1
ATTCGGAAATATTTGTTGCCAGTGGGGCCTAAA
+HWUSI-EAS1795_0092:3:1:14699:2246#0/1
hhhhhhhhghhhggfhhfhhhhggggeghhhhh
@HWUSI-EAS1795_0092:3:1:14933:2237#0/1
CAAACAGGCCCGTGCCGCCATCATCTCCCGACT
+HWUSI-EAS1795_0092:3:1:14933:2237#0/1
fffffffffff[abddaffWRcfcc_fcccfeR
@HWUSI-EAS1795_0092:3:1:15020:2242#0/1
CTTTTCTGTAATACGCTTGATCAGAGCCTCCTC
+HWUSI-EAS1795_0092:3:1:15020:2242#0/1
ggggggggggggggggggggafggggdfggggf
@HWUSI-EAS1795_0092:3:1:15422:2237#0/1
CTCGGCTTTGGTGGACATGTCGAAGTGCTGTGG
+HWUSI-EAS1795_0092:3:1:15422:2237#0/1
hhhhhhghhgghghfhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15448:2243#0/1
TGGGCTTCCTGAACGAGAACAGTTTCCTGTTGC
+HWUSI-EAS1795_0092:3:1:15448:2243#0/1
Wffffffffffffffaff]fffcfdffffffff
@HWUSI-EAS1795_0092:3:1:15542:2235#0/1
GCATATTCTGCCATTCCACACACACACCAACAA
+HWUSI-EAS1795_0092:3:1:15542:2235#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhhhhghe
@HWUSI-EAS1795_0092:3:1:15626:2245#0/1
GATCGACATATACATACGTGTGTACTGTGAACA
+HWUSI-EAS1795_0092:3:1:15626:2245#0/1
hhhhhhhhhhhhhhhhhhhgghhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15876:2244#0/1
TTAGACTTTATATATAATTCAAAAAGACATGTT
+HWUSI-EAS1795_0092:3:1:15876:2244#0/1
hhhhhhhhhghhhhhhghhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:16364:2240#0/1
ATTAAGGCTGTCAACTTCAAGGATGCCTCCGGT
+HWUSI-EAS1795_0092:3:1:16364:2240#0/1
fhhhhfhhdghfghhghgghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16391:2241#0/1
CTTCGACATGGGAACGCTGTACCAGAGCTTCGC
+HWUSI-EAS1795_0092:3:1:16391:2241#0/1
fdfdfffaf]ffafca_ceecd`_``^fdcf]f
@HWUSI-EAS1795_0092:3:1:17079:2246#0/1
GTTCGCTGCTGCTGTTGCTGGTATTATTGAGTG
+HWUSI-EAS1795_0092:3:1:17079:2246#0/1
hhhhhhhhhhhhhghhhfhhhhfhhhhhhefhf
@HWUSI-EAS1795_0092:3:1:17120:2240#0/1
ATTCGCGTGGAGGAAAATGTCCTGACACTGGAG
+HWUSI-EAS1795_0092:3:1:17120:2240#0/1
hhhhhhhhhhfhhghhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:17186:2238#0/1
GTCTTCTTCTGCTCTGGCTTCTTGTCGCCAGGC
+HWUSI-EAS1795_0092:3:1:17186:2238#0/1
hhhhhghhhhhhhhhhhhhhhhhghhhhhhghh
@HWUSI-EAS1795_0092:3:1:17496:2242#0/1
TAGCTATCATCTGTAGAGGTCTCATCGGCATAA
+HWUSI-EAS1795_0092:3:1:17496:2242#0/1
hhhhhhfhhhhhhhhfhhfhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17911:2245#0/1
GTACGAAATTGTCTTTAAAATATATGGATACCG
+HWUSI-EAS1795_0092:3:1:17911:2245#0/1
hhhhhhhhhhhhhghhhhhhhgehghhfhehhf
@HWUSI-EAS1795_0092:3:1:18285:2240#0/1
GCGTGCATCTCCTGTGGCAACCTCGGCTAAATA
+HWUSI-EAS1795_0092:3:1:18285:2240#0/1
dfdffffgeggeffd_a`````Wfabafcdfac
@HWUSI-EAS1795_0092:3:1:18461:2237#0/1
GAGCAGAAGCGGCTTCAGCGGGAGCAGGAGCTG
+HWUSI-EAS1795_0092:3:1:18461:2237#0/1
gggggggggggggggfffdaffddffdcgefee
@HWUSI-EAS1795_0092:3:1:18984:2236#0/1
TTTCGTGCGAGTGAGGCAACACCTCGTCCCTCA
+HWUSI-EAS1795_0092:3:1:18984:2236#0/1
fffdf_fff[fcOZ]ZZYaZa^fff_]ca_acc
@HWUSI-EAS1795_0092:3:1:1585:2252#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:1585:2252#0/1
WRa`_ba`WcdY_b_]TVa^aaKaZZ_c\ccWf
@HWUSI-EAS1795_0092:3:1:1818:2249#0/1
CAAGCCCGAGGATCTGCGCGCCAAGTTCCAACA
+HWUSI-EAS1795_0092:3:1:1818:2249#0/1
ffdafdfffcfaebabJaedeefRbb`ffffff
@HWUSI-EAS1795_0092:3:1:1910:2253#0/1
ACGGTGGTGTGATCGGGGAACTGCAGCCCCTTT
+HWUSI-EAS1795_0092:3:1:1910:2253#0/1
fhghhhhhhhhhhhhfhdghhhhhghhhhhghh
@HWUSI-EAS1795_0092:3:1:2584:2258#0/1
TTTGCGCGCACAATTTTTCCTCCCATTCCGGGA
+HWUSI-EAS1795_0092:3:1:2584:2258#0/1
fcdffffggggdYffffggggfffffffacf]f
@HWUSI-EAS1795_0092:3:1:3204:2257#0/1
GAAGCACAAGTTCAACTACGAACGTTTTAACCG
+HWUSI-EAS1795_0092:3:1:3204:2257#0/1
egggffggggfagggggggggagdggggggggg
@HWUSI-EAS1795_0092:3:1:3396:2249#0/1
GTTCGTGAAGGCAATCACGGGGATGTTCACGTA
+HWUSI-EAS1795_0092:3:1:3396:2249#0/1
W\_^U_Tcdcacf_f^LTOSQR\R\]XaaaWYa
@HWUSI-EAS1795_0092:3:1:3544:2248#0/1
CTACAATGTTTCCGTACTTATCAACCTGGAGGA
+HWUSI-EAS1795_0092:3:1:3544:2248#0/1
hhhhhhhhhhhhhhhhhhhhgghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:3765:2256#0/1
GTATGGGATACCATTGTTCGCAGGGCAATCTGG
+HWUSI-EAS1795_0092:3:1:3765:2256#0/1
fcffcfdfafffgggfgggggggcgggggggga
@HWUSI-EAS1795_0092:3:1:5270:2256#0/1
TGCCATATATGTATGGTCGAAAATGATTTATGG
+HWUSI-EAS1795_0092:3:1:5270:2256#0/1
hhhhhhhhghhhfhhhhhhhhhhhgdhhhfhhe
@HWUSI-EAS1795_0092:3:1:5690:2253#0/1
CGCGCGGAATGGAAGGCGCATAGGAGGAGCAGA
+HWUSI-EAS1795_0092:3:1:5690:2253#0/1
gggggggefgggggggaffffffffffdffffg
@HWUSI-EAS1795_0092:3:1:6511:2248#0/1
GCGAAGTGCGACTTGGCCAGCTCGACGTTCTGC
+HWUSI-EAS1795_0092:3:1:6511:2248#0/1
dfgdgfgdfffffffffdaaa]fbbadgggggf
@HWUSI-EAS1795_0092:3:1:6579:2249#0/1
GTTTAATCAGGCGGAGATTTAAACAAAACTAGT
+HWUSI-EAS1795_0092:3:1:6579:2249#0/1
hhhhhhhhhhhhhhhgghhhghhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:7380:2250#0/1
CACGTGCGTGCCGCAGTGCGCAAGCTCTACGAC
+HWUSI-EAS1795_0092:3:1:7380:2250#0/1
hhhhhhhhghhhhhghhhhhhhghhhgcfhhhh
@HWUSI-EAS1795_0092:3:1:7889:2251#0/1
TCGCTGTTTACTGTTTTTACCGTAACGCTTAGT
+HWUSI-EAS1795_0092:3:1:7889:2251#0/1
WZ^a^abfdadfffafc_\aad^baa]`Z^^ab
@HWUSI-EAS1795_0092:3:1:7926:2255#0/1
GCTGCTCGCGCAACGCCGTGTGGCCCATTGTGT
+HWUSI-EAS1795_0092:3:1:7926:2255#0/1
gggggggggggfgfccgggadcffffdggedga
@HWUSI-EAS1795_0092:3:1:8306:2251#0/1
CGGCAAGATCGTTGTCAACCTGACCGGTAGGCT
+HWUSI-EAS1795_0092:3:1:8306:2251#0/1
hhahhhhchhdhhghhghhhfef]ffffhhhhh
@HWUSI-EAS1795_0092:3:1:8434:2255#0/1
CAAAAATAACGTCTATAATTAAAAACATAACAA
+HWUSI-EAS1795_0092:3:1:8434:2255#0/1
hghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8459:2249#0/1
TTTCATTTTACACTTATTTAACGCCAATCGAAA
+HWUSI-EAS1795_0092:3:1:8459:2249#0/1
fhhhhhhhhhhghhhhhghhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:8851:2253#0/1
GTCGCCGCCATCTTCCGTGGACGCATGTCCATG
+HWUSI-EAS1795_0092:3:1:8851:2253#0/1
hhhhhhghhhhhhhhhhhhhdhfhhhfhhhhgh
@HWUSI-EAS1795_0092:3:1:9043:2249#0/1
GGAACGGAAAAAGAAACGAAAAAAGAAATGTGA
+HWUSI-EAS1795_0092:3:1:9043:2249#0/1
hhghhgghhhhhghhhhhhhhhhchhhhhhgff
@HWUSI-EAS1795_0092:3:1:10594:2253#0/1
CAGTCGAGAGCCAGCGGAGTAACAAGGAAACCC
+HWUSI-EAS1795_0092:3:1:10594:2253#0/1
hhhhhhghhghhhhhhgghhhhhhhhghghhhh
@HWUSI-EAS1795_0092:3:1:11493:2254#0/1
GAATCATGGGTCGTCCCACCATCGAGGGAAAAA
+HWUSI-EAS1795_0092:3:1:11493:2254#0/1
hhhhghhfhhhhhhhhheahhfcffhhddhhhe
@HWUSI-EAS1795_0092:3:1:11516:2249#0/1
TGAGATTACACTGGAGGATGTACTCTTTTGTAA
+HWUSI-EAS1795_0092:3:1:11516:2249#0/1
hhhhhhhhhhhhhhhhhfhchhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11635:2250#0/1
TCGGGCTTGGTGGCGGTGGGATCCTTGATCTTC
+HWUSI-EAS1795_0092:3:1:11635:2250#0/1
ggggggggggggggggdfffcfggggfegggge
@HWUSI-EAS1795_0092:3:1:11770:2251#0/1
GTGAGGATCCGTGGTCGCATTCTGACCGGCGTG
+HWUSI-EAS1795_0092:3:1:11770:2251#0/1
hhhhhhgghheghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11816:2258#0/1
GGAGGAGAATCATCTTGAAGCAATTAAAAAACA
+HWUSI-EAS1795_0092:3:1:11816:2258#0/1
dd^_aZaeaaeccdeeeffff]caeeefff`]c
@HWUSI-EAS1795_0092:3:1:11885:2252#0/1
GTGGTTCAGTACCAGATGGACATTCTGGAATAT
+HWUSI-EAS1795_0092:3:1:11885:2252#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhgghhhhh
@HWUSI-EAS1795_0092:3:1:12171:2249#0/1
ATGGCTTCTAAACCATTTAAAGTTTATAATTTA
+HWUSI-EAS1795_0092:3:1:12171:2249#0/1
fhhfhhhgghhhhhhfhhahhfghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:13511:2251#0/1
GTGGGTTTATTGAAAAGGAAACTCCTTAGGCTA
+HWUSI-EAS1795_0092:3:1:13511:2251#0/1
hhhhhhhhhhhghhhgdfffffRaaaagfhhhf
@HWUSI-EAS1795_0092:3:1:14204:2257#0/1
TGAGCGGACAAAGTGGCATCTGGAAACCGAGAA
+HWUSI-EAS1795_0092:3:1:14204:2257#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:14344:2255#0/1
GCGACTTCGAGCGTTCCCAATTGGCTATCAATC
+HWUSI-EAS1795_0092:3:1:14344:2255#0/1
^aYSaaaacScccccaccc\acaS^bbc_Ycca
@HWUSI-EAS1795_0092:3:1:14655:2246#0/1
GAAATTCTTGGGCAGGATTGGATTCCTCACGGG
+HWUSI-EAS1795_0092:3:1:14655:2246#0/1
hhhhhhhhhhhhhhhhhhhchfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15318:2247#0/1
GCATCTTCAGCTGTGAATCCCAACGAACTCTCC
+HWUSI-EAS1795_0092:3:1:15318:2247#0/1
hhhhhhhhhhghfhhhhhhhhhhfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15676:2256#0/1
GAGGAGTCGGAGGAGGACTCCGAAGATGAGTTG
+HWUSI-EAS1795_0092:3:1:15676:2256#0/1
hhhhghhhhhhhhghhghhhhhhhhghfdfhhh
@HWUSI-EAS1795_0092:3:1:15703:2253#0/1
TGGTTCTTGACTCCGGCAATGGTGGCATCCTGG
+HWUSI-EAS1795_0092:3:1:15703:2253#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16203:2256#0/1
TACATCGATCATGCATCCTACTAATTGTTAAGG
+HWUSI-EAS1795_0092:3:1:16203:2256#0/1
W]caZacY^a[^`^[^a\_[W\^aaaadbcaa_
@HWUSI-EAS1795_0092:3:1:16301:2246#0/1
GGGGATGGCTGCTGAGGGCTGTAAAGTAGTATT
+HWUSI-EAS1795_0092:3:1:16301:2246#0/1
fadf]ffcfff]fdffcc`debff_fdccccff
@HWUSI-EAS1795_0092:3:1:16349:2257#0/1
GCTCGTTTGTGAGTTTCTTAGCATTCCACCTTT
+HWUSI-EAS1795_0092:3:1:16349:2257#0/1
hghhhfhhhhhhhdhhhhfhhehhhhhhfghhh
@HWUSI-EAS1795_0092:3:1:16529:2253#0/1
CGCAGGCCTTCTTTCCGTCCATGAATCCTTTGG
+HWUSI-EAS1795_0092:3:1:16529:2253#0/1
hhhhhhhfghdhhgghhhhhcffghhhghghhh
@HWUSI-EAS1795_0092:3:1:16605:2256#0/1
TTATCCTTGCCGAGAGCGGCCAGACGACCCTTG
+HWUSI-EAS1795_0092:3:1:16605:2256#0/1
gggggggggggeggafcggfgggfggaggggga
@HWUSI-EAS1795_0092:3:1:16778:2253#0/1
CGACAACAACTTCAAGAACAACAACATGGAACC
+HWUSI-EAS1795_0092:3:1:16778:2253#0/1
egggggggggggggcd]gdggcgggfgageggf
@HWUSI-EAS1795_0092:3:1:16867:2258#0/1
GGACCATTGGCTCGCCTCGAGGCACAATCTGTT
+HWUSI-EAS1795_0092:3:1:16867:2258#0/1
fffffffffffff[ffBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:17776:2249#0/1
CGAGAGCACGGGGATGCAGATTCATCCGCAACT
+HWUSI-EAS1795_0092:3:1:17776:2249#0/1
hhhhhhhhfhhhhhchhhfhfgghhhhdhhfhh
@HWUSI-EAS1795_0092:3:1:18144:2254#0/1
GCGCTGGGTGATTTCCATCTTCTTGACCATCTT
+HWUSI-EAS1795_0092:3:1:18144:2254#0/1
dSfffffgggggggggggeggdggggggggggf
@HWUSI-EAS1795_0092:3:1:18393:2247#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:18393:2247#0/1
gggggggfgggcdfffcffffd_cffdbbdfWd
@HWUSI-EAS1795_0092:3:1:18469:2255#0/1
TTGCGCTGACATCGTATCTCGATTTCTTCTGTG
+HWUSI-EAS1795_0092:3:1:18469:2255#0/1
hghhhhhhhhhhhghhhhhhhhhhhhhhhhehf
@HWUSI-EAS1795_0092:3:1:18708:2249#0/1
CTCGGCGGGAGCGGCGACTTCGCTGACATCCAG
+HWUSI-EAS1795_0092:3:1:18708:2249#0/1
ggggggggg^ggfffccaafc[c[cccd]cfcd
@HWUSI-EAS1795_0092:3:1:18860:2258#0/1
GCCATGTTCAGTAGAATGTTGCCCTGTTCGTCC
+HWUSI-EAS1795_0092:3:1:18860:2258#0/1
hhhhhhhhhhhhhhhhhhhhghhghghhhhghg
@HWUSI-EAS1795_0092:3:1:18973:2252#0/1
CCCTGGACAGCATTCTGGATTCACTTGATTTCG
+HWUSI-EAS1795_0092:3:1:18973:2252#0/1
hhhhhhhhhfhhfghhhdhhhhffhhhfhhhhg
@HWUSI-EAS1795_0092:3:1:19162:2253#0/1
CTCAGCTCGGAGCACTTAACCTTCACCATTTTT
+HWUSI-EAS1795_0092:3:1:19162:2253#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhahhhhh
@HWUSI-EAS1795_0092:3:1:19514:2253#0/1
TAGGTACGTAGCCAACCAGCTCCAGATCCAGAT
+HWUSI-EAS1795_0092:3:1:19514:2253#0/1
gggggfgfcfffgggggggeggfffcddfffag
@HWUSI-EAS1795_0092:3:1:19724:2249#0/1
GGATGGGTCACCCAGATCGCCACCAACCCCAAG
+HWUSI-EAS1795_0092:3:1:19724:2249#0/1
ggggggggcgggggggfggggcgggggggdggg
@HWUSI-EAS1795_0092:3:1:1339:2267#0/1
AAAAGATTGCGTGACTCTGGCGTACTGGTGAAA
+HWUSI-EAS1795_0092:3:1:1339:2267#0/1
dc[fdccdf_ffgdgcfdfffdaYbdedf]cfg
@HWUSI-EAS1795_0092:3:1:2495:2262#0/1
GACCATTGCCGCCAAGAACGGCCTCGAGTCGTA
+HWUSI-EAS1795_0092:3:1:2495:2262#0/1
hhhhghhghhfhhghhhghhhhhghhggdhhdh
@HWUSI-EAS1795_0092:3:1:2626:2268#0/1
CTCCTCCTCCTCCTTTCGCTTTCTTAGCTGCTC
+HWUSI-EAS1795_0092:3:1:2626:2268#0/1
hchfhhhhhghhhhghghcchhhghhhgheghh
@HWUSI-EAS1795_0092:3:1:2946:2266#0/1
TCGGGGTCCACATCCACGATGCTCAGCCGCACG
+HWUSI-EAS1795_0092:3:1:2946:2266#0/1
_acaca]\\`BBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3002:2267#0/1
GTGCGAGACGCCCAGCGAGGAGAAGCCAGAGAA
+HWUSI-EAS1795_0092:3:1:3002:2267#0/1
hhghhhfhhhhhhhhhhfhhfhhhhhhfhhhhf
@HWUSI-EAS1795_0092:3:1:3423:2268#0/1
TGCAGAATATTTAGCACCTTTCATTGGGTTTGA
+HWUSI-EAS1795_0092:3:1:3423:2268#0/1
hhhhhhhhfghcfhhhhahghhghhedfhhchf
@HWUSI-EAS1795_0092:3:1:3936:2266#0/1
CAACACCCAACACACGCACACCCACAAGCTTAC
+HWUSI-EAS1795_0092:3:1:3936:2266#0/1
hhhhhhhghhhghghfhhfhhhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4198:2268#0/1
GCAGAATTCCTTCAAGATCCCCTCCTGCTGCAA
+HWUSI-EAS1795_0092:3:1:4198:2268#0/1
ggggcgggggggggggggggggggfggdggggc
@HWUSI-EAS1795_0092:3:1:4262:2261#0/1
CTTTGAGCGGAAGTACAACATGTGGATACCCGG
+HWUSI-EAS1795_0092:3:1:4262:2261#0/1
cSeefcff_ffccf_ffffff_cee[cddccbf
@HWUSI-EAS1795_0092:3:1:4504:2263#0/1
CGTTCACGTTACTGCTCCGTCAGGGATCAGAAT
+HWUSI-EAS1795_0092:3:1:4504:2263#0/1
gggcfggeff_fgcg^gfaeffgggggfafcfg
@HWUSI-EAS1795_0092:3:1:4531:2268#0/1
GCTGATCTGGCAGTGGGTTACAATCTTCAGGAT
+HWUSI-EAS1795_0092:3:1:4531:2268#0/1
ffc]cdaV`ZZX]QZ_WNQWTSdaaaaa^aaO^
@HWUSI-EAS1795_0092:3:1:4703:2260#0/1
TGTCGGTGAACAGTCCCAGATTGTCCTTGATCA
+HWUSI-EAS1795_0092:3:1:4703:2260#0/1
hhhhhhghghghhhghhhhdghdhhfhhfchgg
@HWUSI-EAS1795_0092:3:1:4893:2260#0/1
GCGCACCAGGCGTCCCAGCTTGGTCACTGGCAC
+HWUSI-EAS1795_0092:3:1:4893:2260#0/1
ccaX\`ZYQNa]SV^SPcccccccQ_caccBBB
@HWUSI-EAS1795_0092:3:1:5312:2258#0/1
GGGTGTTCAATCTTCTCGAGACTGGGGGGCAGA
+HWUSI-EAS1795_0092:3:1:5312:2258#0/1
cadWcdca^\^Uadddd_WcQcfff_fa_^_d[
@HWUSI-EAS1795_0092:3:1:5537:2269#0/1
GGGGTCCTTAACGTGCTCGGCGGTGCCCGCCAA
+HWUSI-EAS1795_0092:3:1:5537:2269#0/1
gggggggfffffgggggggggggfgggfggggg
@HWUSI-EAS1795_0092:3:1:5838:2262#0/1
CCCAAGAAGGCTGCCGAGCCCGCCGAGGAGTTG
+HWUSI-EAS1795_0092:3:1:5838:2262#0/1
hhhgghhhhhhhfhhhhffhhhhhhhhfdfhgh
@HWUSI-EAS1795_0092:3:1:5968:2266#0/1
GGAGCACATGACGGGTGGCGGTCTCGACATAGT
+HWUSI-EAS1795_0092:3:1:5968:2266#0/1
hhghahhhfhhhgffgffcffc_]dcacfcffe
@HWUSI-EAS1795_0092:3:1:6214:2261#0/1
CGCGCATCTTGTAGAGGGGAGTCTGGGGCTCCT
+HWUSI-EAS1795_0092:3:1:6214:2261#0/1
hhhhhghhhhhhhgfhghgcgghfghhhhhhfh
@HWUSI-EAS1795_0092:3:1:6931:2268#0/1
GGGCGCGGTACTGCTGGGATCCTCGGGAGGTCA
+HWUSI-EAS1795_0092:3:1:6931:2268#0/1
hhhdhhhhhhhhgdhhhhhahhhfhhhbfcbfb
@HWUSI-EAS1795_0092:3:1:7117:2267#0/1
CGCCCTTTATTAGAATTTCTTGCGTCATATTAG
+HWUSI-EAS1795_0092:3:1:7117:2267#0/1
hhhhhhghhhhhfhhhhhghhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8144:2262#0/1
CTTTTAAATAAATTTTAGCTTTTTGACTAAAAA
+HWUSI-EAS1795_0092:3:1:8144:2262#0/1
cfffc_dggggcggegggggcgfa]_fdfddff
@HWUSI-EAS1795_0092:3:1:8786:2265#0/1
CGACGCAATCACGGAGTCCAGTGCTCCGTAACC
+HWUSI-EAS1795_0092:3:1:8786:2265#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8996:2268#0/1
GTGTATGAATCGTTTCCAAGAAATATGCTCTTT
+HWUSI-EAS1795_0092:3:1:8996:2268#0/1
ggfgggfggggfggcggfffffgggfgggcggg
@HWUSI-EAS1795_0092:3:1:9180:2266#0/1
GATCTAACCACCTGTAGAGCTAAGGACCACCCA
+HWUSI-EAS1795_0092:3:1:9180:2266#0/1
hhhhhhhhhhhhhhhhfhhhghhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:9447:2269#0/1
TGCTTCGATCTGATGCTTATTGGCTTGGCACTA
+HWUSI-EAS1795_0092:3:1:9447:2269#0/1
hhhhhhghhhghhhhhhhhhhghhghWb[]bW`
@HWUSI-EAS1795_0092:3:1:9666:2262#0/1
CCGGTGTTAGCATCAATCAAGAGTTCCATTTAG
+HWUSI-EAS1795_0092:3:1:9666:2262#0/1
hhhhhhhhhghhhhhhhhhhahghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10063:2263#0/1
AATTCCTGAAAGATAGTAAGGAAAGTGAAAATA
+HWUSI-EAS1795_0092:3:1:10063:2263#0/1
hghhhhhhhhghhhhffhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10165:2263#0/1
GAAGACGCCACAGAGTTTCCTCGGAATCTGCGG
+HWUSI-EAS1795_0092:3:1:10165:2263#0/1
ffdfcffgggfgfWddafffffgggagfeaffa
@HWUSI-EAS1795_0092:3:1:10317:2263#0/1
CCTCGAATCCGTCGACCAGGACCTGCAGGGATT
+HWUSI-EAS1795_0092:3:1:10317:2263#0/1
gggggggggggggffgggggdgfffgeggggfg
@HWUSI-EAS1795_0092:3:1:10809:2269#0/1
GCCGATGATCTTCAACTCCTGGTCCAGACGCGC
+HWUSI-EAS1795_0092:3:1:10809:2269#0/1
hhhhhhhhhhhhhhhhghhhhhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11149:2260#0/1
GGATGCTGTGGTCAGCATGTGCGGCCATCTGTT
+HWUSI-EAS1795_0092:3:1:11149:2260#0/1
hhhhhhhhhhhhhhhhfggghhfghhdhhdchd
@HWUSI-EAS1795_0092:3:1:11248:2261#0/1
ATGGAGTCGGCGTCTACCGTCGAAGAATTCCTT
+HWUSI-EAS1795_0092:3:1:11248:2261#0/1
ggggggggggeggggggggfgggggggggggge
@HWUSI-EAS1795_0092:3:1:12018:2258#0/1
GCTGCATCCCTCCTCCGCTGATCTTCTAGCTCA
+HWUSI-EAS1795_0092:3:1:12018:2258#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12052:2262#0/1
CGTCCAACCATTCATTCCAGCCTTCAATTAAAA
+HWUSI-EAS1795_0092:3:1:12052:2262#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12484:2260#0/1
CCGGTTGTTGCGATCCCGCCGCTGGCCGAGCCA
+HWUSI-EAS1795_0092:3:1:12484:2260#0/1
ggggggeggggggfgggfffca[_^d_fddffg
@HWUSI-EAS1795_0092:3:1:12879:2269#0/1
GTCAGGACGCTGCTGAGCGGCGCCTTTACAGTG
+HWUSI-EAS1795_0092:3:1:12879:2269#0/1
hhhhhhhhhhhhhhhehhhhhhhhghhhhghfg
@HWUSI-EAS1795_0092:3:1:13300:2259#0/1
CTCCCCTCCATGATTAAGTTATTTCCGCTGGAC
+HWUSI-EAS1795_0092:3:1:13300:2259#0/1
hhhhhhhhhhhfhhhhhhhhhghhhhchhgahg
@HWUSI-EAS1795_0092:3:1:13749:2267#0/1
CTCCGGGAAGTATAGGGGGCAGTTCGCCAGGCA
+HWUSI-EAS1795_0092:3:1:13749:2267#0/1
fagggggdfffffffffaggaggcgggf[dffg
@HWUSI-EAS1795_0092:3:1:13973:2269#0/1
CTCGGCGGTTTCTTGCGGCGCCGGCTTCTTGCC
+HWUSI-EAS1795_0092:3:1:13973:2269#0/1
ffffffff_ff_\YLZT`]^]a]`]V`YY^VYf
@HWUSI-EAS1795_0092:3:1:14152:2259#0/1
GCCCGAGCTCAGGAAGAAGGTCATGCCTGCCGT
+HWUSI-EAS1795_0092:3:1:14152:2259#0/1
fggggggdggggfagcggggegadaeebdddec
@HWUSI-EAS1795_0092:3:1:14555:2268#0/1
GGAGTACTACGCTGAGATCGGACGTCTGGAGAA
+HWUSI-EAS1795_0092:3:1:14555:2268#0/1
hhhhhhhhghgghhhfhhfhhehhhfhhhcfhf
@HWUSI-EAS1795_0092:3:1:15190:2262#0/1
GTTGTCGAGGAAATCTTTGAGTTTGTGAACAGA
+HWUSI-EAS1795_0092:3:1:15190:2262#0/1
gggdgggaggcggggggf\fffggggggggffg
@HWUSI-EAS1795_0092:3:1:15489:2269#0/1
CGAGATTCTCTGAGCTGGCATTTAAAAGCTTTG
+HWUSI-EAS1795_0092:3:1:15489:2269#0/1
hghghhhhhhhhhhhhhhgdhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16042:2263#0/1
TGGTTACTTCGGCAAGGTGGGCATGAGGAACTT
+HWUSI-EAS1795_0092:3:1:16042:2263#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhgghh
@HWUSI-EAS1795_0092:3:1:16308:2263#0/1
GAAGGATCAATGAGGAGAGTCCCATCTACAGCA
+HWUSI-EAS1795_0092:3:1:16308:2263#0/1
hfghhhhgghghghhggdhghhhhhgfhgghhh
@HWUSI-EAS1795_0092:3:1:16541:2269#0/1
GCGTGTTGATCAAGCGCAACACCACCATCCCGA
+HWUSI-EAS1795_0092:3:1:16541:2269#0/1
fhhghhfhghhhaghggchhhhhhhhghhhhhc
@HWUSI-EAS1795_0092:3:1:16887:2267#0/1
GGAGAAGAAGGAGGAGTCCGAGTCCGAGGATGA
+HWUSI-EAS1795_0092:3:1:16887:2267#0/1
ffcf[ff]a`a`ea]ebdffcfcfadcfd^^dd
@HWUSI-EAS1795_0092:3:1:17090:2266#0/1
AAAATGCAGAGTGGATATTTTTGTTATTTGATC
+HWUSI-EAS1795_0092:3:1:17090:2266#0/1
hhhhhhfghfhhhhhhhfhhhfchffhhhhfhh
@HWUSI-EAS1795_0092:3:1:17126:2266#0/1
GTTCCTCATCGAACACACCCATTGCAGACAAAG
+HWUSI-EAS1795_0092:3:1:17126:2266#0/1
hhhhhhhhhhhhhhhhhfhhhgghhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:17405:2263#0/1
CCTACTCCTCCCTTGCGTCCAGCAACTCCATCG
+HWUSI-EAS1795_0092:3:1:17405:2263#0/1
hh[Z]]E[[[[Vhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17455:2268#0/1
CCTTGGGGTGCCCGTCAGCCTTGTTGCAGAGTA
+HWUSI-EAS1795_0092:3:1:17455:2268#0/1
ggegggggggggggggcggcfgfgagggggggg
@HWUSI-EAS1795_0092:3:1:17471:2260#0/1
ATGAGAACAAGCACAAGATTGCCAAGCACAACC
+HWUSI-EAS1795_0092:3:1:17471:2260#0/1
cbdd[aaWZZV`aaadaWbdbd]bddbfQff]d
@HWUSI-EAS1795_0092:3:1:18026:2263#0/1
CCGGTTGAAGGTCTACCAGGGTGTTTACTCGGT
+HWUSI-EAS1795_0092:3:1:18026:2263#0/1
gfffeffggggggggggggggeggggggggggf
@HWUSI-EAS1795_0092:3:1:18266:2263#0/1
ACTGGCCAATAAATTATCCGTTCGACTGCGATC
+HWUSI-EAS1795_0092:3:1:18266:2263#0/1
hhhhghhhhhhhhhhhghhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:18586:2261#0/1
GTGCATTCTGGGAAGTGTTAACTGATCCAGCAT
+HWUSI-EAS1795_0092:3:1:18586:2261#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:19290:2269#0/1
CAAGGATAGTTTGGTGTACAGCGTGACGAGTGG
+HWUSI-EAS1795_0092:3:1:19290:2269#0/1
hhhhhhhghhgffcf_fhhhhhhhhhehhgcgf
@HWUSI-EAS1795_0092:3:1:1665:2280#0/1
GTTGGATTAAGATATAATTTTGGGTGTAGCCGT
+HWUSI-EAS1795_0092:3:1:1665:2280#0/1
dffddfdfdfcfffdffgggggbfffffc_fff
@HWUSI-EAS1795_0092:3:1:1863:2278#0/1
ATTTTTAGTTGGATTATCAATTCCAATTTCTTT
+HWUSI-EAS1795_0092:3:1:1863:2278#0/1
SZcc\\Sab`aaZacccc__ccccccc_aaacc
@HWUSI-EAS1795_0092:3:1:3232:2275#0/1
GCCGCTGTACATGAGCACCAAGAACACCATTCT
+HWUSI-EAS1795_0092:3:1:3232:2275#0/1
affffWfffa_[b^aaafffadcfaffffffcd
@HWUSI-EAS1795_0092:3:1:3624:2278#0/1
CAGCTGGTTAACAACCTTCTTGACCACGGGCTT
+HWUSI-EAS1795_0092:3:1:3624:2278#0/1
gggfgggggegggggggggggfggggggggggg
@HWUSI-EAS1795_0092:3:1:4389:2281#0/1
ATTTGGGGATTTAAGCAAGGACAAAGCGCATCG
+HWUSI-EAS1795_0092:3:1:4389:2281#0/1
ghhhhhhhhhhhhghghhhfhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4441:2272#0/1
CGTGGTACTACAATATGCGTATGTGCTGCTCCG
+HWUSI-EAS1795_0092:3:1:4441:2272#0/1
hhhhhhghhhhhhhhhhhhhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5414:2273#0/1
TACAGCCGAACCATGCCAGGGAGACGTCCCGAA
+HWUSI-EAS1795_0092:3:1:5414:2273#0/1
ggggggggeggggfggd_fff[cf[fdfffafg
@HWUSI-EAS1795_0092:3:1:5485:2278#0/1
AAGGAGGAGGATGAGGAAGGATATGTGCTATTT
+HWUSI-EAS1795_0092:3:1:5485:2278#0/1
fgggfgggggdggfgggfff_fdffffgggggg
@HWUSI-EAS1795_0092:3:1:5784:2271#0/1
CCGGTTTTGCCATGATATGCCTTATAGGGCAAA
+HWUSI-EAS1795_0092:3:1:5784:2271#0/1
hhhhhhhhhhhghfhhhhhhhhhhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:7403:2280#0/1
GATATTTTCTCCTCGGACCTTGAAAATTTATGG
+HWUSI-EAS1795_0092:3:1:7403:2280#0/1
gcgagcfffcfdaffffgggcdggggggggggd
@HWUSI-EAS1795_0092:3:1:7597:2278#0/1
CAGAACGCTGCTTTCTCGCCTCGCAAGTGTGTT
+HWUSI-EAS1795_0092:3:1:7597:2278#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8039:2274#0/1
TATTCATGTCCCACATTTGTTCTATTGTCTAAG
+HWUSI-EAS1795_0092:3:1:8039:2274#0/1
ggggfgggggggggcgggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:8174:2272#0/1
GCGGTGTGTACAAAGGGCAGGGACGTAATCAAT
+HWUSI-EAS1795_0092:3:1:8174:2272#0/1
hhhhhghhhhhhhggghhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8303:2280#0/1
GCCACCAAGGGCAAGAAGTAGCTGGTTTGCTTC
+HWUSI-EAS1795_0092:3:1:8303:2280#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:8360:2272#0/1
CGCCTGTGTCCCCACTCCCACTCTACTCTTTTT
+HWUSI-EAS1795_0092:3:1:8360:2272#0/1
hheghhhfhfhhgdhchhhhgfhhchhhhhhhh
@HWUSI-EAS1795_0092:3:1:8495:2272#0/1
GAGGAACCGCAGGTACGGACCAATGGCACAATA
+HWUSI-EAS1795_0092:3:1:8495:2272#0/1
hhhhhhhhhhhhhghhhfhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:9403:2273#0/1
GCCTCTTGGAGACGCTTTACGGACATCAAATTA
+HWUSI-EAS1795_0092:3:1:9403:2273#0/1
hhhhhhhhhhhhhgghhhfhhhghhhhhhghhh
@HWUSI-EAS1795_0092:3:1:9864:2276#0/1
CGCCGAACTTGAAGTTGTCAGCCACTTTCACCT
+HWUSI-EAS1795_0092:3:1:9864:2276#0/1
hghghfggfhhgffhhhhhghhhghhhhhhghg
@HWUSI-EAS1795_0092:3:1:9908:2271#0/1
GCCAGCGATGGCTGCCTCCATTTCCGGACGTTC
+HWUSI-EAS1795_0092:3:1:9908:2271#0/1
hfhhhhhfghhgghhhhfhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:9988:2273#0/1
TTGACGTGTCACAATTTCGACGATTGGCAAGTG
+HWUSI-EAS1795_0092:3:1:9988:2273#0/1
hhhhhhhhhhhhhghhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10034:2272#0/1
TGCGGTTGGCGTCGCGCGGAGACAGGGCCTTGC
+HWUSI-EAS1795_0092:3:1:10034:2272#0/1
hhhghhhhhffhhgghghhhcghhhhhhfeafd
@HWUSI-EAS1795_0092:3:1:10252:2279#0/1
GAAACATCATCCGTACTTAGCTGCGACATATCA
+HWUSI-EAS1795_0092:3:1:10252:2279#0/1
hhhhhhhhhhhhhhghhhhfhhhhhghhhhgfh
@HWUSI-EAS1795_0092:3:1:10299:2280#0/1
ATAACACCAACACCTGTCCTGCGCAAGATGACC
+HWUSI-EAS1795_0092:3:1:10299:2280#0/1
hghhhhhhhhghhhfhhhhgghffhfhhhhahg
@HWUSI-EAS1795_0092:3:1:10426:2271#0/1
CGCTGCGTTTGTCGTCGAACAGCATTGGGCCCG
+HWUSI-EAS1795_0092:3:1:10426:2271#0/1
hhhhehhhhhhhhhghhgfhgghhhhhgehhhg
@HWUSI-EAS1795_0092:3:1:10596:2273#0/1
CGAGAACATCGCGAAGGCCGCCGAGCCCTTCAA
+HWUSI-EAS1795_0092:3:1:10596:2273#0/1
ggggggggcgfggfcgggggdgafgeggggggf
@HWUSI-EAS1795_0092:3:1:10737:2274#0/1
TCAGGGTTAAATTTGGGTAGCTTAACATCATCA
+HWUSI-EAS1795_0092:3:1:10737:2274#0/1
ggggggggggdggeggcgcffffgggdffffW[
@HWUSI-EAS1795_0092:3:1:11082:2274#0/1
CGATGAGCAGGATTTCTTCGCCGATCAGAGCCT
+HWUSI-EAS1795_0092:3:1:11082:2274#0/1
ggfafffffddfaffffggfgfc[]e]]b```]
@HWUSI-EAS1795_0092:3:1:11533:2273#0/1
CGCCTCTTACGCGTTTGTTTACTATTACACCAA
+HWUSI-EAS1795_0092:3:1:11533:2273#0/1
hhhhhhghhhhhhhhhghhhghhghgghhhhhh
@HWUSI-EAS1795_0092:3:1:11698:2275#0/1
GGCGATATACAGCTCTACTTGTTGGCATACCCG
+HWUSI-EAS1795_0092:3:1:11698:2275#0/1
hhhhhhhhhhhhhghhhhhghhhhhghhhghhh
@HWUSI-EAS1795_0092:3:1:11900:2271#0/1
GGAAGGCCTTGCGCAGACCCTCGTCCTTGTCGT
+HWUSI-EAS1795_0092:3:1:11900:2271#0/1
hhhhhfhhhhfhhhhgfhhhgghhhhhhhfhdh
@HWUSI-EAS1795_0092:3:1:11989:2272#0/1
CTGAACTTTCTCAAGAACAAAATGGACGAGTAC
+HWUSI-EAS1795_0092:3:1:11989:2272#0/1
hhghhhhhhhhhhhdhhhhhhhhghhhhhghhh
@HWUSI-EAS1795_0092:3:1:12302:2279#0/1
GAGGGATTCAGCATGGCCAGATTGGTCTTGCCA
+HWUSI-EAS1795_0092:3:1:12302:2279#0/1
hghhhhhhhhhhhgfhhhggehghhhhhghhhh
@HWUSI-EAS1795_0092:3:1:12434:2274#0/1
CTCGTCTGTATTAATCTGCTGTAACTGTTGTGT
+HWUSI-EAS1795_0092:3:1:12434:2274#0/1
gggggggggcgggggggfgggggffggggggfg
@HWUSI-EAS1795_0092:3:1:12463:2274#0/1
CCTGCTTGAAGACCACCTGCTGGTACTTGTTAT
+HWUSI-EAS1795_0092:3:1:12463:2274#0/1
fgdggggaggdgfcfffgggcge`cbcaa`b^f
@HWUSI-EAS1795_0092:3:1:13812:2273#0/1
TGTTGTTGTTGGTGGTGGTGGTGCTGGCGGTGG
+HWUSI-EAS1795_0092:3:1:13812:2273#0/1
hhhhghghhhhhehhhdfdfffffcfffff_dd
@HWUSI-EAS1795_0092:3:1:14385:2271#0/1
GCTATGTGTCCGCCGGTACCAACACGGTGACCA
+HWUSI-EAS1795_0092:3:1:14385:2271#0/1
hhhghhhhhhhfhhhhhghhhhhhhhhhghhgg
@HWUSI-EAS1795_0092:3:1:14727:2275#0/1
CATCATTCCCAGGTCATCTACACACGTGCCACC
+HWUSI-EAS1795_0092:3:1:14727:2275#0/1
ff_ffcfdf_fffggfgccfffffcca`a`bbf
@HWUSI-EAS1795_0092:3:1:14924:2280#0/1
GTGGATAGTAGATGGATATAGTGGCTCTACTGG
+HWUSI-EAS1795_0092:3:1:14924:2280#0/1
cccccacc_cca_ac^a__aa]aca]aacaWcc
@HWUSI-EAS1795_0092:3:1:15165:2272#0/1
CTCAATAGTCCATGACTATTGCCCATACGAACT
+HWUSI-EAS1795_0092:3:1:15165:2272#0/1
hhhhhhhhhhhhhhhhghhhghhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:15716:2271#0/1
GCTTCAAAAGGCAGTTTAGCCGATACATCAAGT
+HWUSI-EAS1795_0092:3:1:15716:2271#0/1
hhhhhhhhhhhhghhhhhhhhhhghhhgghech
@HWUSI-EAS1795_0092:3:1:16430:2274#0/1
AGCCGGTGATGTGGCGGAACATGTTGCGGTTCA
+HWUSI-EAS1795_0092:3:1:16430:2274#0/1
hhhghhgghghchhhfhehahechdfdhhdeef
@HWUSI-EAS1795_0092:3:1:16963:2277#0/1
CTGACAGGCAAACTAGCAGATGCTAATTTGCAA
+HWUSI-EAS1795_0092:3:1:16963:2277#0/1
gggfggcgfgcfc]fcaff]]fggggggggcgg
@HWUSI-EAS1795_0092:3:1:17078:2280#0/1
GCAAGGGCGACAGCAAGGACAAGTAAGCTCTGG
+HWUSI-EAS1795_0092:3:1:17078:2280#0/1
geggggacggcggfggffcgffgggfgdfg_ge
@HWUSI-EAS1795_0092:3:1:17169:2281#0/1
TGCTACGCATGGAGCAGGTTATCTTGAAGATTC
+HWUSI-EAS1795_0092:3:1:17169:2281#0/1
hhhghhhhhhhhcghhghggfghhhhhhc_ghg
@HWUSI-EAS1795_0092:3:1:17539:2281#0/1
GTGAGCGTTGGGCAACAGTGTGTTGTCAAGCTT
+HWUSI-EAS1795_0092:3:1:17539:2281#0/1
ggggafffafccaaeada[aUab^a^]dbdaeg
@HWUSI-EAS1795_0092:3:1:17814:2280#0/1
CGGCTTGCAGTGATCACGGACGTAGCGACCCGC
+HWUSI-EAS1795_0092:3:1:17814:2280#0/1
ggggaf[cdddafcfefefaf_dfdffggggdg
@HWUSI-EAS1795_0092:3:1:17889:2277#0/1
ATTATTTGAAAGAATTGCTGCTGGAACTACAAT
+HWUSI-EAS1795_0092:3:1:17889:2277#0/1
VVY\NIUSH^VOHPOZRaWIJ\QQVKSaT^BBB
@HWUSI-EAS1795_0092:3:1:18036:2280#0/1
CGTTGATGATGCGCATCACCTGCAGACCGGCAA
+HWUSI-EAS1795_0092:3:1:18036:2280#0/1
gggggdgggggffffafaffffgggggafafff
@HWUSI-EAS1795_0092:3:1:18521:2275#0/1
TCTACTTCAACTTCTTCTTGGGGCGCAGGTTGT
+HWUSI-EAS1795_0092:3:1:18521:2275#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18825:2279#0/1
CGCAGCCAGCGTTCCGGGATGAATTCCTTTGCC
+HWUSI-EAS1795_0092:3:1:18825:2279#0/1
hhhhhhhhhhhhhhhhhhchhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19443:2272#0/1
CCCGCTTGCGCTCGGCCTCTGCCTCAAGGTCTT
+HWUSI-EAS1795_0092:3:1:19443:2272#0/1
hhhhfhhfffffhhghhhhcehfdfffeechhf
@HWUSI-EAS1795_0092:3:1:19576:2276#0/1
CGCGGTCAGCGGAGCGTAGAAGCTGTGCACGTA
+HWUSI-EAS1795_0092:3:1:19576:2276#0/1
hhhhhhhghhhhehhhhhfhhghghfhhhhhgd
@HWUSI-EAS1795_0092:3:1:1975:2289#0/1
CCCTCATCGGGTTCTTCGCGGGATCGCGCTTAA
+HWUSI-EAS1795_0092:3:1:1975:2289#0/1
f[gggdgggggggggegffcffggggggggggg
@HWUSI-EAS1795_0092:3:1:2039:2290#0/1
CGCAGGGTCCGCCGCCCGCCTACTCCGCTTCCA
+HWUSI-EAS1795_0092:3:1:2039:2290#0/1
hfdfhfdfhhechfhahhhhhhhhdhgchhhhh
@HWUSI-EAS1795_0092:3:1:2450:2287#0/1
CGCCAAGATCGAGAACGCCGCCGATGGTAAAAA
+HWUSI-EAS1795_0092:3:1:2450:2287#0/1
dfaafcfggggfg[gfgggfcgffeffacafff
@HWUSI-EAS1795_0092:3:1:2469:2289#0/1
GCGGAGGATCCTGGCTGCAGGACACCGATCTAC
+HWUSI-EAS1795_0092:3:1:2469:2289#0/1
ggggg]dggggfgaggggcgdgacfffddcWf_
@HWUSI-EAS1795_0092:3:1:2800:2293#0/1
GTGCATTCTGGGAAGTGTTAACTGATCCAGCAT
+HWUSI-EAS1795_0092:3:1:2800:2293#0/1
^_dadddafaffddcffcccdccdcad_f[^aa
@HWUSI-EAS1795_0092:3:1:5278:2291#0/1
CTCGGTAGCAGACATCTTTGCAGTATGGTTTAT
+HWUSI-EAS1795_0092:3:1:5278:2291#0/1
hhhhhhhhhhhhhhhhhhhchhhhehhhhhhhh
@HWUSI-EAS1795_0092:3:1:5563:2288#0/1
GCAAGGGAGAAGTAGGCAGTCCGGGACCCAATG
+HWUSI-EAS1795_0092:3:1:5563:2288#0/1
hhghhhhhhggghhhhdghhhhhhhfhhhgahh
@HWUSI-EAS1795_0092:3:1:5766:2286#0/1
GCCGGCATTAGATACGGTTAATTACCTGGACTA
+HWUSI-EAS1795_0092:3:1:5766:2286#0/1
hhhhhhhhhhhhhhhhhhhgghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6165:2284#0/1
TCTGAATGAGAGTAAGAAAAGAAAGCGAGATGA
+HWUSI-EAS1795_0092:3:1:6165:2284#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:6650:2289#0/1
GAAAAGACAGCAGGAACTCAGCCATGTCGAAGA
+HWUSI-EAS1795_0092:3:1:6650:2289#0/1
hhhhhhhhfhfhhhhhhhhhhhfhhghhhfgfh
@HWUSI-EAS1795_0092:3:1:6699:2289#0/1
ACCAGATCCTGCGCATCGAGGAGGAGATCGGCG
+HWUSI-EAS1795_0092:3:1:6699:2289#0/1
hhhhhhhhhghhhhhhhhfhhchhhhhhghehh
@HWUSI-EAS1795_0092:3:1:7219:2289#0/1
GAAAAGAACGAGCCAGCCAAGGACAAGAACATC
+HWUSI-EAS1795_0092:3:1:7219:2289#0/1
hhhhhhhhhfhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:7502:2287#0/1
CGAACAGCAGCAGGAAGGTGTCGATGAATTCGC
+HWUSI-EAS1795_0092:3:1:7502:2287#0/1
hhhhhghhhhhhhhghhhdfhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:8238:2291#0/1
AAAACCGTCTAGTCACAAGGTCTTCAGACTAGT
+HWUSI-EAS1795_0092:3:1:8238:2291#0/1
fffdfdddccddac^cadddddffdfdfa_fdf
@HWUSI-EAS1795_0092:3:1:8370:2289#0/1
AAAACCATGGGCGTCAACCTGGGCGTTGAGCCC
+HWUSI-EAS1795_0092:3:1:8370:2289#0/1
dfdffaf^]Sfacfffcfff_fccedcdeacec
@HWUSI-EAS1795_0092:3:1:8631:2282#0/1
ACTTAGTGCTGAACTGTTTTCTTTTCGCTCGCC
+HWUSI-EAS1795_0092:3:1:8631:2282#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:8974:2292#0/1
GTTACAACGCTAAGCGCCGTCACTGGAGGCGTA
+HWUSI-EAS1795_0092:3:1:8974:2292#0/1
hhhhhhhhhhhhhghhhhhhhghhffehhhhhh
@HWUSI-EAS1795_0092:3:1:9196:2290#0/1
TTTTGACTGTGCAAAGGTAGCATAATCATTAGT
+HWUSI-EAS1795_0092:3:1:9196:2290#0/1
hhhhhfghhhhhhhhhhhhhfhhhhhhghhggh
@HWUSI-EAS1795_0092:3:1:9604:2291#0/1
TAGAGCTTCACTACAAGGTGCAGGAGTGTATCG
+HWUSI-EAS1795_0092:3:1:9604:2291#0/1
hhhhhhhhhhhhhhhhhhfhhhhghhghhhhhh
@HWUSI-EAS1795_0092:3:1:9801:2287#0/1
GGGCTAGAAGAGCATGACATATACTGTTGTGTC
+HWUSI-EAS1795_0092:3:1:9801:2287#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9896:2287#0/1
CGGGCTTGTAGGTCAGGGCGAACTCGCCCAGGT
+HWUSI-EAS1795_0092:3:1:9896:2287#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgb
@HWUSI-EAS1795_0092:3:1:10361:2286#0/1
CCTTAACCATTTTGTTTGCTGTTTACTTTTTTC
+HWUSI-EAS1795_0092:3:1:10361:2286#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10655:2284#0/1
ATGTGGTGACGTTCTAAACGAACTCCTGACCGA
+HWUSI-EAS1795_0092:3:1:10655:2284#0/1
hhhhhhhhghhhhhhghhhhhhhhhhhhgghfh
@HWUSI-EAS1795_0092:3:1:11026:2285#0/1
CTGGCATCCTGGCCTTGAGTTTTTTTATTTGCC
+HWUSI-EAS1795_0092:3:1:11026:2285#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11109:2293#0/1
AAATAACAGCAAATATGTGAGACTGCTTGATAG
+HWUSI-EAS1795_0092:3:1:11109:2293#0/1
fggfggggggggggggggggfgfafffggfgcg
@HWUSI-EAS1795_0092:3:1:11303:2282#0/1
GGGACTTCCCAGGTCCTTACTGCGCACGGGAGA
+HWUSI-EAS1795_0092:3:1:11303:2282#0/1
hhhhhhhghhhafhhhhhfhhhgfhhfhgafhh
@HWUSI-EAS1795_0092:3:1:11471:2290#0/1
CCTCCTCATCAGTAAATTGTGATATATAAAAAT
+HWUSI-EAS1795_0092:3:1:11471:2290#0/1
hhhhhhhhhhhfhghghhhfhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12123:2291#0/1
AGAAGATTGGCCAGGGTGCCTCTGGCACAGTGT
+HWUSI-EAS1795_0092:3:1:12123:2291#0/1
hhhhhhhghhhhhhghehhhghfhhhhhfhghg
@HWUSI-EAS1795_0092:3:1:12819:2292#0/1
AAAGAATCCAGACCATGCGCTCCATTAACGCCA
+HWUSI-EAS1795_0092:3:1:12819:2292#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13657:2291#0/1
GGGACATGAAAATGAAAGGGCGAAAGGAAGAAC
+HWUSI-EAS1795_0092:3:1:13657:2291#0/1
hhhhhhhhhhhhhehhhghhgghhhhchhhhhg
@HWUSI-EAS1795_0092:3:1:13698:2286#0/1
GGGTGCTTCTTGCCCTTTTTGGCCGACTTGGCC
+HWUSI-EAS1795_0092:3:1:13698:2286#0/1
fggecggggdecgfaeggggfcgfc][fafcfd
@HWUSI-EAS1795_0092:3:1:14215:2290#0/1
CCAAAGTCAAAAATCACAGAAGCGAGTCGCATC
+HWUSI-EAS1795_0092:3:1:14215:2290#0/1
hhhhhhhhhhhhghhhhhhhhhhhhhhhhhhaf
@HWUSI-EAS1795_0092:3:1:14261:2285#0/1
CAGCAAACCCAATTTGTCTCGTAACTCCACAAA
+HWUSI-EAS1795_0092:3:1:14261:2285#0/1
hfhhghhhhhhghhhchggfhhhghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:14508:2290#0/1
CGCCGTCGTAGTATAGTAGTATTTATCGTTTTT
+HWUSI-EAS1795_0092:3:1:14508:2290#0/1
hhhhhhghhhhhhgghghhhfhhhhhghhhhhg
@HWUSI-EAS1795_0092:3:1:14873:2284#0/1
TTTTGCGCGACTGTTCAAGCCAAGATACCGCTA
+HWUSI-EAS1795_0092:3:1:14873:2284#0/1
hhhhehhhhhhhhhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15362:2284#0/1
GCCCCGCCAAGAACACCGTGCGTGTTGACTTCA
+HWUSI-EAS1795_0092:3:1:15362:2284#0/1
hghhhhhhhhfhhchhhhghfhhghhhhafhhh
@HWUSI-EAS1795_0092:3:1:15463:2284#0/1
ATTCTAAACAAAAAGCAGCCGACCGACCACCCA
+HWUSI-EAS1795_0092:3:1:15463:2284#0/1
c`_aa__cZaZ\\\\ac^aaYKZVYVV^aaa[c
@HWUSI-EAS1795_0092:3:1:15742:2284#0/1
GGCAGAACGGACACGACGCACAATGGCTTTCCT
+HWUSI-EAS1795_0092:3:1:15742:2284#0/1
aWc]aad\[aa[ac_fa^a\\\cddd^ffdadc
@HWUSI-EAS1795_0092:3:1:16979:2287#0/1
AGATGACCCAGATCATGTTCGAGACCTTCAACA
+HWUSI-EAS1795_0092:3:1:16979:2287#0/1
a\a`^`addacaaaaaaddada\abbafaff__
@HWUSI-EAS1795_0092:3:1:17308:2289#0/1
ACGCCCTGTGCTTCTCGCCCAACCGCTACTGGC
+HWUSI-EAS1795_0092:3:1:17308:2289#0/1
hhhhhhhhhhhhhhghghhhhhhhhhghhghhh
@HWUSI-EAS1795_0092:3:1:17496:2286#0/1
GCGAAGGAAAGACCGATTACTATGCCAGGAAAC
+HWUSI-EAS1795_0092:3:1:17496:2286#0/1
hhhhhhhhhfhhhhhhhfffffhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18176:2288#0/1
AAAAAGTTCGCGTGGCATTGGCAAGGGATATAG
+HWUSI-EAS1795_0092:3:1:18176:2288#0/1
ccdda^^UZSYSK]]SPddad_ddbbbZUW]Z^
@HWUSI-EAS1795_0092:3:1:1608:2293#0/1
CTCGGCATCAGGGAGTCCAATAGTGGTGCTTAT
+HWUSI-EAS1795_0092:3:1:1608:2293#0/1
fgdfacfgggggcfaffcffYfcfffcfaf]fg
@HWUSI-EAS1795_0092:3:1:1725:2301#0/1
CCCTTGTCCGTGCACTCGAAAGACTCTGAAATC
+HWUSI-EAS1795_0092:3:1:1725:2301#0/1
ggggegggggcgggggfggfggggggggdcegd
@HWUSI-EAS1795_0092:3:1:2363:2300#0/1
TTCATGGAGGAGGTTATCATCACAAACATATAT
+HWUSI-EAS1795_0092:3:1:2363:2300#0/1
hhhhhhhghefghhghhhehcdhhhahdhhggh
@HWUSI-EAS1795_0092:3:1:3597:2299#0/1
CCGACATTAACAATTATATCTAAACTAAATTAC
+HWUSI-EAS1795_0092:3:1:3597:2299#0/1
hhhhhhhhhhhhghhhfghfggechhhhfhhgh
@HWUSI-EAS1795_0092:3:1:3626:2302#0/1
CTAGAGTCTGAGCGATACAATCTCAGGCTATTC
+HWUSI-EAS1795_0092:3:1:3626:2302#0/1
hhhhfghhhgfhfhgggehggfghhghhhhhhh
@HWUSI-EAS1795_0092:3:1:3850:2305#0/1
CGTGGGCCCGATCGGACCCGCTGGTGTTGCCGG
+HWUSI-EAS1795_0092:3:1:3850:2305#0/1
Yccacacaa\a^^\_]bBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:3951:2295#0/1
CGGGCCTCGTGGACGCCAGTGGAGGCGCCGGAG
+HWUSI-EAS1795_0092:3:1:3951:2295#0/1
ccc_\ccc[^a_QRV]Vccc_caBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:4424:2304#0/1
TTGGCATTGAGGAAGGCTGTTGAATATAGGCAA
+HWUSI-EAS1795_0092:3:1:4424:2304#0/1
ghhhhhhhhhhhhhhhhhfhhhhfhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:4673:2295#0/1
CATGCCTAAGTCATCTACTTGCCATTATGCACA
+HWUSI-EAS1795_0092:3:1:4673:2295#0/1
fcaf_cfffffcgggeggffggggfaccffffg
@HWUSI-EAS1795_0092:3:1:4696:2302#0/1
TTCAAGGCCGGTCCCCGCCGTTCCCTGAAGAAG
+HWUSI-EAS1795_0092:3:1:4696:2302#0/1
fffffaffffffcffff]ccfd_dfffcf[fdf
@HWUSI-EAS1795_0092:3:1:5131:2295#0/1
CGCTGGGCGGGGATCTGGACGGGCACATCGTCG
+HWUSI-EAS1795_0092:3:1:5131:2295#0/1
hhhhhhghhhhhhhhghhfhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5542:2293#0/1
AGCTGAACAACCAGGTGCTGTTCGACAAGGCCA
+HWUSI-EAS1795_0092:3:1:5542:2293#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6145:2303#0/1
CTGGAATCCAAACGTGACTCCCTTGATCATGTT
+HWUSI-EAS1795_0092:3:1:6145:2303#0/1
f[ff_fffffdfffffcf[fffdfffcfffff_
@HWUSI-EAS1795_0092:3:1:7082:2302#0/1
TTTGGGTATTATGTTTGGTAAGGGGTGGGTTAG
+HWUSI-EAS1795_0092:3:1:7082:2302#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7622:2296#0/1
CGCCCAGGATGCGCAGCCTGGCCTCGGCGTACT
+HWUSI-EAS1795_0092:3:1:7622:2296#0/1
c]gggggggcggca]c]fccfffcfcfbb`bdd
@HWUSI-EAS1795_0092:3:1:7647:2304#0/1
GCCTCAAGTTCATTGCCACCAAGCTGCTGACCA
+HWUSI-EAS1795_0092:3:1:7647:2304#0/1
^\cdeccdcbe\aca^cdcdddf^]Ycee[caf
@HWUSI-EAS1795_0092:3:1:7938:2297#0/1
GTTCGTGTCTGCCCGGCTGGTATTCGGGGTCTT
+HWUSI-EAS1795_0092:3:1:7938:2297#0/1
`]a^aaabbbfdggggdWdd_[dddddffadd`
@HWUSI-EAS1795_0092:3:1:7993:2302#0/1
TAGATAGTAGACCATACATAACCTAAAGAAGAG
+HWUSI-EAS1795_0092:3:1:7993:2302#0/1
dgfadfcfffcff_YccfddffdfccdbcZ`bf
@HWUSI-EAS1795_0092:3:1:8789:2302#0/1
CGGATCCTTCTACGTTGGGAAGCGTTGCGTCTA
+HWUSI-EAS1795_0092:3:1:8789:2302#0/1
hhhhhhhhhhhhhhhhghhhghhfhhhhhhghg
@HWUSI-EAS1795_0092:3:1:9156:2303#0/1
CTGCTGTTTCGCTTTCCCTACTCTCATTCGGGT
+HWUSI-EAS1795_0092:3:1:9156:2303#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:9492:2296#0/1
CGATGCGAAAGTGAAATTATACTCTCTGATGAA
+HWUSI-EAS1795_0092:3:1:9492:2296#0/1
hhhhhhhhhhhhhhhhhhgghhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:9537:2304#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9537:2304#0/1
f_ffc_fdfd[fd[cff`dbf[addecaff]fa
@HWUSI-EAS1795_0092:3:1:9561:2301#0/1
CTCCTCTGTGATTCTGGAAAGCAGTGCAAGTAC
+HWUSI-EAS1795_0092:3:1:9561:2301#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhdhh
@HWUSI-EAS1795_0092:3:1:9620:2304#0/1
AGATCATCAAGGGCGCCTTCGGCACCCGTGCCC
+HWUSI-EAS1795_0092:3:1:9620:2304#0/1
fcgggggfff]d[ffffggggggggggfdWff^
@HWUSI-EAS1795_0092:3:1:10573:2297#0/1
GCTCGCTGAAGTTTGCCTTGGAGGGGCGCTTCT
+HWUSI-EAS1795_0092:3:1:10573:2297#0/1
`V^Zaca]cdadaaa_adddcYaa[[[`cdadc
@HWUSI-EAS1795_0092:3:1:10788:2296#0/1
TCCACCAAGACGGCGGCAATTATGAAGAAAAAA
+HWUSI-EAS1795_0092:3:1:10788:2296#0/1
hhhhhhhhhhhhhhhhhhhhhghhgghhhhhhh
@HWUSI-EAS1795_0092:3:1:11356:2298#0/1
GTTGCTGCCGCTTCCGCTGCTGCTGATGTTACT
+HWUSI-EAS1795_0092:3:1:11356:2298#0/1
hhhhhhhghhhhhhhhhhhghgchhcdhhfhhh
@HWUSI-EAS1795_0092:3:1:11543:2303#0/1
GAGGACCAGGAACAGTTCCAACTGGATCTGTAG
+HWUSI-EAS1795_0092:3:1:11543:2303#0/1
hggghhhhhhhhhehhhhhhhhffehgghhhgh
@HWUSI-EAS1795_0092:3:1:11977:2298#0/1
CCCTCGTAGGCCTTGGCGTTCTTGCAGTCCAGA
+HWUSI-EAS1795_0092:3:1:11977:2298#0/1
ggggggggggggcggggggcdgggggggggggg
@HWUSI-EAS1795_0092:3:1:12221:2302#0/1
GGAAGATGGCGTCTAAATCGCTGGCGAAAATGC
+HWUSI-EAS1795_0092:3:1:12221:2302#0/1
fWffccf]badbcfffacf[ffd`]]dfff]_U
@HWUSI-EAS1795_0092:3:1:12935:2294#0/1
GGACAAGCGTCAGGCTGTTCTGTGCATCCTGGC
+HWUSI-EAS1795_0092:3:1:12935:2294#0/1
gfcgggdgcgggeggcggfgggcggggggdgcg
@HWUSI-EAS1795_0092:3:1:13017:2295#0/1
CCACCTCTCTGTTCCCCTTCAACCAGCGCATGG
+HWUSI-EAS1795_0092:3:1:13017:2295#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13263:2296#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13263:2296#0/1
hhhhhhhhhhhhhhhhhhhhhgfhhhhhhhefh
@HWUSI-EAS1795_0092:3:1:14070:2294#0/1
CTTGAGAATTTGGACGCCGTTTATGAACGAAAA
+HWUSI-EAS1795_0092:3:1:14070:2294#0/1
J\Z\__\S\a_aZLa[a\acaa`K^^[_^L\ab
@HWUSI-EAS1795_0092:3:1:14479:2299#0/1
CTGAGCGCGAGCGTGGTATCACCATCGATATCG
+HWUSI-EAS1795_0092:3:1:14479:2299#0/1
ggfcc\feaeadcbbbd]affcffWfffRf^WR
@HWUSI-EAS1795_0092:3:1:15138:2294#0/1
CGATGGAACCCCGGAGAAGCCCTTCGGACACGC
+HWUSI-EAS1795_0092:3:1:15138:2294#0/1
hhhhhhhhhhhhhhhfhhdhhhhhghghhghhg
@HWUSI-EAS1795_0092:3:1:16107:2294#0/1
CAGAAAATGAGGGGGGTCCCCGCCTTACCCTGA
+HWUSI-EAS1795_0092:3:1:16107:2294#0/1
hhghhhhghhfhhghhhhhhhhhgghfhhheeh
@HWUSI-EAS1795_0092:3:1:16701:2304#0/1
AGGACTACAAAAAGGTCCAGGAGACTTTCGATT
+HWUSI-EAS1795_0092:3:1:16701:2304#0/1
hhhfh_hhhhhghfhehhhhhdhhhghhhhghh
@HWUSI-EAS1795_0092:3:1:17381:2301#0/1
TTGCTGACGAATACGCTCTTCGAGCTCTCGCTG
+HWUSI-EAS1795_0092:3:1:17381:2301#0/1
hhhhhhhhhhgghhghhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:17573:2304#0/1
TGCTTCTTGGATTTACTATCGGGCAAAGGAATA
+HWUSI-EAS1795_0092:3:1:17573:2304#0/1
hgfghhhhhhffhhhhhhhhhehghhhhfhhfh
@HWUSI-EAS1795_0092:3:1:17627:2296#0/1
GTTGATGAGGCGTTGCATCGCATACTCCTGCGA
+HWUSI-EAS1795_0092:3:1:17627:2296#0/1
hhhghffhghhhhhghhhhghhfhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:17956:2300#0/1
CCAGAATCAAGGACAAACCCGCAGTTGTCCATC
+HWUSI-EAS1795_0092:3:1:17956:2300#0/1
hhhfghhhhhgghhhhhhhhhhdfgggghhhgg
@HWUSI-EAS1795_0092:3:1:18603:2294#0/1
GGCGGTGCATCGTACGGTGGTGTGTTGTCCTTG
+HWUSI-EAS1795_0092:3:1:18603:2294#0/1
faffc]fff_ffdcdddaddadaddc_faffff
@HWUSI-EAS1795_0092:3:1:19142:2293#0/1
ATCGTGACCTTCTTCTTCCGCCCCTGCAGCCTG
+HWUSI-EAS1795_0092:3:1:19142:2293#0/1
ffcff]_ddfffcfccffafff[[V`^\\aaaf
@HWUSI-EAS1795_0092:3:1:19534:2305#0/1
ATCGCGAGGTCATCATGAAACAATTCCGTTCGG
+HWUSI-EAS1795_0092:3:1:19534:2305#0/1
gggfgggggggggggggdgggfcgcggeggfag
@HWUSI-EAS1795_0092:3:1:19593:2302#0/1
CCAACACCTGTCCTGCGCAAGATGACCGATAAG
+HWUSI-EAS1795_0092:3:1:19593:2302#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhaghhh
@HWUSI-EAS1795_0092:3:1:19728:2295#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19728:2295#0/1
NN^JS^^HPKZHYWZIUccc\[aYJS\[Ka\a[
@HWUSI-EAS1795_0092:3:1:1887:2312#0/1
CACAGAGTGCAGAATGTATAGGATTTCATCATC
+HWUSI-EAS1795_0092:3:1:1887:2312#0/1
g_fffffaffffcfffaggggfdfffdeggggg
@HWUSI-EAS1795_0092:3:1:2012:2307#0/1
CACAACCGCGAGCTGAAGAAGCTGACGGTCAAG
+HWUSI-EAS1795_0092:3:1:2012:2307#0/1
gfgg_ggddfYcgggggcdfa_fcadd_affc_
@HWUSI-EAS1795_0092:3:1:2863:2307#0/1
TTGGAAGGCAAGGAGTTGGAATTCTACCTTAAG
+HWUSI-EAS1795_0092:3:1:2863:2307#0/1
hhhhhghhhhhhhedhhhghhghhhfgghhhhh
@HWUSI-EAS1795_0092:3:1:3253:2315#0/1
TACCGCCCTAGTTCTAACCATAAACGATGCTAG
+HWUSI-EAS1795_0092:3:1:3253:2315#0/1
afffacffcf_fcfafcffcaffcfff__dfdW
@HWUSI-EAS1795_0092:3:1:4873:2307#0/1
CACCGCCATCGCCATGCAATTCCAGAAGCTTTG
+HWUSI-EAS1795_0092:3:1:4873:2307#0/1
hhhhhhhghhhhhhhghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4948:2315#0/1
CCGGGATGCTTGCGGTGCTTGCCGATACGGCCG
+HWUSI-EAS1795_0092:3:1:4948:2315#0/1
hhhhhgheghhfhhhhhhhhchhhghhghhhhh
@HWUSI-EAS1795_0092:3:1:4989:2309#0/1
CGATGTTCTTCCACTTGCTGTAGTCCACCATTT
+HWUSI-EAS1795_0092:3:1:4989:2309#0/1
hhfehhghhhhhhhhhhhhfhghghhhhhghhh
@HWUSI-EAS1795_0092:3:1:6128:2313#0/1
TAAATTTGCTTAAATCGGCCACCAGCCTGCAGC
+HWUSI-EAS1795_0092:3:1:6128:2313#0/1
hhhhhhhhhhhhhghhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6418:2306#0/1
CCTCCAGTGTAATCTCATGGTCATTCCGTAGTC
+HWUSI-EAS1795_0092:3:1:6418:2306#0/1
hghhhfhhhhhhhhhhghhhhhhhhhhfhahgg
@HWUSI-EAS1795_0092:3:1:6468:2311#0/1
CGCCGGCAGAAGCGACTCGTCTTCTCCACCATC
+HWUSI-EAS1795_0092:3:1:6468:2311#0/1
]__aa]aY\VVYUVPUVaabS]\RS]_]a_cVW
@HWUSI-EAS1795_0092:3:1:6556:2314#0/1
TTTCTCCGTTTCTGGATGATTATGGAGTAATGC
+HWUSI-EAS1795_0092:3:1:6556:2314#0/1
hhhhhhghhhhghhhhhhhhhhghhgdhhhhhg
@HWUSI-EAS1795_0092:3:1:7164:2307#0/1
GAGAGAGCGACCATGGTGTGCAGCAGCGCGTGT
+HWUSI-EAS1795_0092:3:1:7164:2307#0/1
hhhhhhhhhhhehhhhhfffffhhchhhfhgha
@HWUSI-EAS1795_0092:3:1:7541:2306#0/1
GATATGGGACTGTGAACAAAGCTTTAGCACAGT
+HWUSI-EAS1795_0092:3:1:7541:2306#0/1
hhhhhhhhhhhghhhhghhhhhhhfhhhhhhhf
@HWUSI-EAS1795_0092:3:1:7601:2307#0/1
TTCCCTTCTTCTTCGGCTGATCAGCAGGTTAAT
+HWUSI-EAS1795_0092:3:1:7601:2307#0/1
hhhhhhhhhhhhhhhhhhhchhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8130:2312#0/1
CGACCTTCTCCTTGATCTCAGCGAACTTGCAAG
+HWUSI-EAS1795_0092:3:1:8130:2312#0/1
ggggfggffgggggggccgggffgegg]dffdg
@HWUSI-EAS1795_0092:3:1:8644:2306#0/1
CCGCAACATCCCCGGCATTGAGACCATCAACGT
+HWUSI-EAS1795_0092:3:1:8644:2306#0/1
hhhhhhhhgehhhhcehghhheghhfhfhhghd
@HWUSI-EAS1795_0092:3:1:9101:2306#0/1
CGGCGATCTGGGCACCCGTTACGCCCATCTGGG
+HWUSI-EAS1795_0092:3:1:9101:2306#0/1
hhhghghhffhhhghhggfghhdhhhhhgghgh
@HWUSI-EAS1795_0092:3:1:10310:2306#0/1
CTTGAAAGCGTAAAAAAAAATTCAAAACCCCGA
+HWUSI-EAS1795_0092:3:1:10310:2306#0/1
hhhhhhhhhhhhhhhhhhhhhhgghhhhghhhh
@HWUSI-EAS1795_0092:3:1:10496:2312#0/1
CAGTAAGTGTGAGTCATTAACTCGCATTGATTA
+HWUSI-EAS1795_0092:3:1:10496:2312#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhgh
@HWUSI-EAS1795_0092:3:1:11004:2311#0/1
CGTCGGTCTGCTTTTAAATTCCTTCACCGTCAT
+HWUSI-EAS1795_0092:3:1:11004:2311#0/1
ffgggfefggggggggggfgggggggggggggg
@HWUSI-EAS1795_0092:3:1:11073:2307#0/1
CGGAGCTGATCGCTTCGGCGGCGCCGCTGGTGG
+HWUSI-EAS1795_0092:3:1:11073:2307#0/1
hhhghhhhhhhhhhhhhhhghcfghhf_ffaff
@HWUSI-EAS1795_0092:3:1:11258:2306#0/1
TACTGGGGCAACGATGGCTACATCCTGATGTCG
+HWUSI-EAS1795_0092:3:1:11258:2306#0/1
hhhhhhhhhhhhhhhhhhhhhhehhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11904:2310#0/1
GCCGAATCCAGTCCAGTCAGCCAGTCGCTTACT
+HWUSI-EAS1795_0092:3:1:11904:2310#0/1
gcgfggfggfdfggggggffggefgfgfggagg
@HWUSI-EAS1795_0092:3:1:11959:2315#0/1
TCTGGGGATGTCCTTTGATCGTGGCGCTGCTAT
+HWUSI-EAS1795_0092:3:1:11959:2315#0/1
hhhhhhhedhhhhhhhgcghhhhhghhQff]cf
@HWUSI-EAS1795_0092:3:1:11993:2310#0/1
CCCTCGTAGGCCTTGGCGTTCTTGCAGTCCAGA
+HWUSI-EAS1795_0092:3:1:11993:2310#0/1
VJSGRUOQW\QTKaYY\]PY\RI\___Xa\Saa
@HWUSI-EAS1795_0092:3:1:12243:2315#0/1
CTGCACCATAGGATCGGACTTAGCCAAACGCTT
+HWUSI-EAS1795_0092:3:1:12243:2315#0/1
hhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12413:2307#0/1
TGTGCTTCTTGTGCGTCTTCTTCTCGGCCCACT
+HWUSI-EAS1795_0092:3:1:12413:2307#0/1
ffcf^_dffffcafffafgggcfffaRdfffaf
@HWUSI-EAS1795_0092:3:1:12663:2307#0/1
CCCAGGTCATCGTGCTGAACCACCCCGGTCAGA
+HWUSI-EAS1795_0092:3:1:12663:2307#0/1
hhhhhhhhhhhhhehhhhhhhhhhhhhhehfhh
@HWUSI-EAS1795_0092:3:1:12807:2314#0/1
GAGGAGGAGGAGGCGCCCAAGAAGGACGAGTTG
+HWUSI-EAS1795_0092:3:1:12807:2314#0/1
fegggggfggfgdggggfff[cffdfadaffaf
@HWUSI-EAS1795_0092:3:1:13577:2316#0/1
GTGAGCGTCATCCCGGTTCCTTCGACATTGTGC
+HWUSI-EAS1795_0092:3:1:13577:2316#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:13708:2306#0/1
TTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTC
+HWUSI-EAS1795_0092:3:1:13708:2306#0/1
hhchhhhhfhhhghhhchhhegfhhhhhhghhf
@HWUSI-EAS1795_0092:3:1:14294:2312#0/1
CGAACTTCTCGAGAAGATTATTCTGGACTCGTC
+HWUSI-EAS1795_0092:3:1:14294:2312#0/1
hhhhhhgeehhhfhgfhhhdehhghhhegfhdh
@HWUSI-EAS1795_0092:3:1:14417:2307#0/1
TCACAACAGCAAAAGATAATACTACTTTACAGC
+HWUSI-EAS1795_0092:3:1:14417:2307#0/1
hhhhhhhhhhhhhhhgghhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14714:2307#0/1
TACAGCGGCACGCCCTTCTTGGCGGCTCCAGCC
+HWUSI-EAS1795_0092:3:1:14714:2307#0/1
hhhghhhhhdhgchhhhghhggggfe_df_afg
@HWUSI-EAS1795_0092:3:1:15233:2309#0/1
GCCGTCTCCGAGATGTTGATAAACTCGGTTTCC
+HWUSI-EAS1795_0092:3:1:15233:2309#0/1
hhhhhhhhhhhhfhghhggcfhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:15398:2305#0/1
TTCGACGCCCCGAGAGTTGCGCTCAGGAACATT
+HWUSI-EAS1795_0092:3:1:15398:2305#0/1
hhhhhhhhhhhhhdghhhhghfhfghhhhhfhh
@HWUSI-EAS1795_0092:3:1:15593:2313#0/1
GCCCACGGCAAGGCGACGATTTCCAACGATGGA
+HWUSI-EAS1795_0092:3:1:15593:2313#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:15869:2309#0/1
TGGCATACAGATCCTCACGGATATCCACATCAC
+HWUSI-EAS1795_0092:3:1:15869:2309#0/1
agfYc_fccfaffaf]c^a^YSaWcaa^aaaae
@HWUSI-EAS1795_0092:3:1:16084:2311#0/1
CGTGGAGTTCTTGACCCTTAGGGAGGTGAGATC
+HWUSI-EAS1795_0092:3:1:16084:2311#0/1
hhhhhghhhhhhhhhhhhhhhhhhhh_hhghhh
@HWUSI-EAS1795_0092:3:1:16264:2316#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:16264:2316#0/1
hhhhhhhhhhhhhhhhhhhhhhcghhfgghhgh
@HWUSI-EAS1795_0092:3:1:16531:2310#0/1
GCTGGTCTTCCTGCTGCTGCTTTTCTTCTACAT
+HWUSI-EAS1795_0092:3:1:16531:2310#0/1
baX`b]bffff_Weeaeggg_gggcgcgggaed
@HWUSI-EAS1795_0092:3:1:16673:2316#0/1
TGAGTGTTAAAGAGCAGAGCTAGAAAAATGGTG
+HWUSI-EAS1795_0092:3:1:16673:2316#0/1
hhhhhhhhhhhhhhhhhfhhhghhhhehhhhhh
@HWUSI-EAS1795_0092:3:1:16784:2305#0/1
CAGCAATGTAATCCTGTCCCTTGAGAAAAGTTT
+HWUSI-EAS1795_0092:3:1:16784:2305#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17246:2309#0/1
ACGATGATGACGTCCTCCGCAATGGAGCTCAGC
+HWUSI-EAS1795_0092:3:1:17246:2309#0/1
ffafdffggdgggg]ggffffffffffgggagg
@HWUSI-EAS1795_0092:3:1:17342:2316#0/1
AGGATCTCGACCAGATCGCCAGGAAGCGACATT
+HWUSI-EAS1795_0092:3:1:17342:2316#0/1
fgggggeggggefcfeffffffdgcggefgggg
@HWUSI-EAS1795_0092:3:1:17605:2313#0/1
CCAACGTCTCCCTGTTGGCCCTCTACAAGGAGA
+HWUSI-EAS1795_0092:3:1:17605:2313#0/1
hhhhhhhhhhhhhghhhhhhhghhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:17927:2311#0/1
GTTACGGTGCCCAAATTAACAACTCATGCAGAT
+HWUSI-EAS1795_0092:3:1:17927:2311#0/1
hhhhhhhhhhhhghghhhhhhfh]gfhghhhgh
@HWUSI-EAS1795_0092:3:1:18210:2305#0/1
TTCAAATCATTCATAAAAGCCTACATGTTGGAG
+HWUSI-EAS1795_0092:3:1:18210:2305#0/1
adfdff]ffffffacf_\^cdafa[cfffffaf
@HWUSI-EAS1795_0092:3:1:19256:2315#0/1
GCCCGCCGAGGCCAAATTGGCCTTTGTCGTCCG
+HWUSI-EAS1795_0092:3:1:19256:2315#0/1
ffffdfccWcf]e^aa``Kddd]dd`aBBBBBB
@HWUSI-EAS1795_0092:3:1:19787:2307#0/1
AAAATTAATTAAATAAATATAAATTAAGTCTTT
+HWUSI-EAS1795_0092:3:1:19787:2307#0/1
gggg_gggc_gggegggggggggfgfgcfgggg
@HWUSI-EAS1795_0092:3:1:1562:2327#0/1
GCGGAGGTCGTAAACAGCGGAGATTTCTGGTTA
+HWUSI-EAS1795_0092:3:1:1562:2327#0/1
ggfffafcfcfcffcf\K\_O\addddgggggc
@HWUSI-EAS1795_0092:3:1:1937:2328#0/1
GGATGACGACATGGGCTTCGCTCTCTTCGAATA
+HWUSI-EAS1795_0092:3:1:1937:2328#0/1
f[ffcffdfffdffccfffc]fdfdffaf_cfd
@HWUSI-EAS1795_0092:3:1:2915:2322#0/1
GTAAAATCCAATCGATATAGTGATTCACACGGA
+HWUSI-EAS1795_0092:3:1:2915:2322#0/1
hhhhhhhhhhhhhhhhhehhhhdhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:4773:2323#0/1
CGTTGCGGTACTTCTCGGCCTCGTTGACCATGC
+HWUSI-EAS1795_0092:3:1:4773:2323#0/1
hhhhhhhhhhfhhhhhhhhhfffhghfhhhhfh
@HWUSI-EAS1795_0092:3:1:5155:2320#0/1
GCGCGCCAAGAACCTTCTGAAGACCAACATGCT
+HWUSI-EAS1795_0092:3:1:5155:2320#0/1
hhhhghghhhghhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:5272:2318#0/1
ACTGGGGCCTCCGTGTGCGTGGCCAGCACACCA
+HWUSI-EAS1795_0092:3:1:5272:2318#0/1
cffcdfffgafgggcfgfddafggfcgb]dbbf
@HWUSI-EAS1795_0092:3:1:5527:2326#0/1
CATATACTGTTGTGTCGATATTTTCTCCTCGGA
+HWUSI-EAS1795_0092:3:1:5527:2326#0/1
fabc[ccb`d``e^ffffc_caW````cfafdd
@HWUSI-EAS1795_0092:3:1:5947:2328#0/1
CTGGGAAATATATATTTTTAACAAAATACTTAT
+HWUSI-EAS1795_0092:3:1:5947:2328#0/1
ggggggggggfgdggggggfgdggggggggggg
@HWUSI-EAS1795_0092:3:1:6443:2323#0/1
GCAAAGCCACCCAAAACCGCCTCCCATTTGTCC
+HWUSI-EAS1795_0092:3:1:6443:2323#0/1
ggfgggffa]fcfffccaaea`f``Pfdf]fff
@HWUSI-EAS1795_0092:3:1:6534:2318#0/1
AGAAACTTGGTTTCCTATCTTAAGCAGAAGGAG
+HWUSI-EAS1795_0092:3:1:6534:2318#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:6681:2325#0/1
CGCCGGTGAGAATGTTGATCTGTACGTGCCCCG
+HWUSI-EAS1795_0092:3:1:6681:2325#0/1
hhhhhhedffhhhhggghhhgghhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:7259:2326#0/1
CAATGGCCGATATCAGTGGACTTTCATTATTAC
+HWUSI-EAS1795_0092:3:1:7259:2326#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:7846:2318#0/1
AAAAATTTTTGCATTTATTCAAAGATTTCATAC
+HWUSI-EAS1795_0092:3:1:7846:2318#0/1
hgghhhhhhfhhhhhhhhhhhhhhghhhghhhh
@HWUSI-EAS1795_0092:3:1:8024:2319#0/1
TGCGCACTCCCTGCAGGGCCAATTGCTTCGTCA
+HWUSI-EAS1795_0092:3:1:8024:2319#0/1
hghghhhhhhhhhhhhhhhhhhghhhffhhhhh
@HWUSI-EAS1795_0092:3:1:8108:2321#0/1
GCCAGATCTTCTCCATATCGTCCCAGTTGGTCA
+HWUSI-EAS1795_0092:3:1:8108:2321#0/1
ffcfccffddaacfffd^dcecff[[bW^a^af
@HWUSI-EAS1795_0092:3:1:8258:2324#0/1
CAGATGGCAGCCGCAGTAGTCCAAAGTTTCGGC
+HWUSI-EAS1795_0092:3:1:8258:2324#0/1
hghhhhhhhhhhhhhghfghhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:8631:2321#0/1
CCCACTGCCAGATCAGCCAATGGCTTAATGCCA
+HWUSI-EAS1795_0092:3:1:8631:2321#0/1
hhhhhghhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8664:2318#0/1
TCGCCATGACCCGTGATGGCAAACGTGTTCGTC
+HWUSI-EAS1795_0092:3:1:8664:2318#0/1
hhhhhhhghhhhhhghghhghhhhhhhhhhahh
@HWUSI-EAS1795_0092:3:1:8753:2327#0/1
GTGTTCTTTTTGCGCTTTGGGAAATATCTTCTT
+HWUSI-EAS1795_0092:3:1:8753:2327#0/1
hhhhhhhhhhhghghhhhchhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8804:2326#0/1
TCCTGCTTCTCCTTAAGGTAGTCCACCTGCCAT
+HWUSI-EAS1795_0092:3:1:8804:2326#0/1
gggegggggggggggSgfbfdbggfgggggggg
@HWUSI-EAS1795_0092:3:1:9201:2319#0/1
ATTTTCTATACGGCTAGGCTAGGCTAGGCTATT
+HWUSI-EAS1795_0092:3:1:9201:2319#0/1
ggggggggggggfgggggdgfggecgfggdcgg
@HWUSI-EAS1795_0092:3:1:9620:2322#0/1
CAGTATTGTCTCACGATTCCTGCGACTCCCGTG
+HWUSI-EAS1795_0092:3:1:9620:2322#0/1
hhhhhhhhhhhhhhhhhhhhgghhdhhhhhhhf
@HWUSI-EAS1795_0092:3:1:10117:2318#0/1
CGCGGGAAAGCGAGTTGATGATCAGCTTCATCA
+HWUSI-EAS1795_0092:3:1:10117:2318#0/1
a^\aZMa_\]Z\V_]ac]VaZPSVXXXaZ[ac]
@HWUSI-EAS1795_0092:3:1:10908:2319#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:10908:2319#0/1
hhhghhhhhhhhhhdhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10950:2319#0/1
CGGGCCTTGCGCGTGGGCTTGGGCAGGATCTTG
+HWUSI-EAS1795_0092:3:1:10950:2319#0/1
hhhhhhhhhhhhhhhhhhhhehhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:11833:2319#0/1
CGTTAAGACCCTCACGGGCAAGACCATCACTCT
+HWUSI-EAS1795_0092:3:1:11833:2319#0/1
fffffdcffffafff_fdff_^ffcfcffdfdf
@HWUSI-EAS1795_0092:3:1:12098:2328#0/1
TCTGTACGCTCCATTCCATTCGCTCGATCATTC
+HWUSI-EAS1795_0092:3:1:12098:2328#0/1
gafcdffffffffdaffddff]fffffgfcc_d
@HWUSI-EAS1795_0092:3:1:12299:2318#0/1
GGCGTAATACTGCTGGCGAATCTTTCCCGTGTC
+HWUSI-EAS1795_0092:3:1:12299:2318#0/1
hgdhhhhhfhghhhfhfgghfdhghhhhfhcgh
@HWUSI-EAS1795_0092:3:1:12376:2319#0/1
GTTAAAGTAACAATGTTTTAAAACAACTAAGCG
+HWUSI-EAS1795_0092:3:1:12376:2319#0/1
hhhhhhhhhhhhhfhhhhhhhhhhhheghhhhh
@HWUSI-EAS1795_0092:3:1:12583:2323#0/1
GATTTTCTTGGGAGTGGAGTAGTTCTTCTTCTT
+HWUSI-EAS1795_0092:3:1:12583:2323#0/1
gaegggffc`ffdfddfbcbffgfggfggggga
@HWUSI-EAS1795_0092:3:1:12827:2321#0/1
CGGCATTCTGATTTTCAACGCGATTTGTATGCG
+HWUSI-EAS1795_0092:3:1:12827:2321#0/1
^c^RbaX^^aa\UVYYYZTPY_]]]\]VZVWac
@HWUSI-EAS1795_0092:3:1:13486:2323#0/1
TGAGGATCTCGGATCTCGAGGTGGAGGAGCGAT
+HWUSI-EAS1795_0092:3:1:13486:2323#0/1
fhfghhfhhhhhhhhhhffffbfffffahgggh
@HWUSI-EAS1795_0092:3:1:13605:2324#0/1
CCGCATCTCCGCCGAGGAGGCCAAGTACAAGTT
+HWUSI-EAS1795_0092:3:1:13605:2324#0/1
hhhhhhhhhhghhhhfffhhgchhhahhhhhgf
@HWUSI-EAS1795_0092:3:1:13744:2326#0/1
GGAAGAAATCTACAAACCAAAGTTGCAGTACAC
+HWUSI-EAS1795_0092:3:1:13744:2326#0/1
hhhhhhhghhhhhhhgghhhhhhghhhghhhhh
@HWUSI-EAS1795_0092:3:1:13780:2319#0/1
CGACAGATCGGTGTTGGCCATCTTGGGCTGGGG
+HWUSI-EAS1795_0092:3:1:13780:2319#0/1
ggggggggaggggggfgggfgggdgggfggggg
@HWUSI-EAS1795_0092:3:1:14454:2320#0/1
CTTGATCACTATGTAGATAAAGCAAATGAGGCC
+HWUSI-EAS1795_0092:3:1:14454:2320#0/1
^a^^aaadcdcd^^a^^aa]^^fddffaff\\d
@HWUSI-EAS1795_0092:3:1:14574:2319#0/1
CTTGGCCATTGTTGTGCCTTCAATAGTTCGATG
+HWUSI-EAS1795_0092:3:1:14574:2319#0/1
hhhhehhhhhhhhfhhhhhhhhhahghhhhghh
@HWUSI-EAS1795_0092:3:1:14748:2319#0/1
AAGCCATCAATCGAGCGGCTCGAACTGACAATA
+HWUSI-EAS1795_0092:3:1:14748:2319#0/1
hhhhghhghhhhhhhhhhhhhghhhhhhghhdf
@HWUSI-EAS1795_0092:3:1:15834:2320#0/1
GGCGGTTACAAACAAATTCTCCAGTACAAAATG
+HWUSI-EAS1795_0092:3:1:15834:2320#0/1
fffff_fcaddd]d__YaZ^aa`fffcfffcU`
@HWUSI-EAS1795_0092:3:1:16312:2320#0/1
GGATATTATAGTTTTAGATCAGTCTCTTAGACG
+HWUSI-EAS1795_0092:3:1:16312:2320#0/1
hhhhghhhfhhhhhhhfhhhhhhhhhhhghhhf
@HWUSI-EAS1795_0092:3:1:16389:2324#0/1
TGTCACCGGACTCGCCCACGCAGATGTTCAGGC
+HWUSI-EAS1795_0092:3:1:16389:2324#0/1
f[dacac\ZXZX]^]`]\aZV\QQMTM_XTVXT
@HWUSI-EAS1795_0092:3:1:16508:2321#0/1
GCGAGCGTGGTATCACCATCGATATCGCCCTGT
+HWUSI-EAS1795_0092:3:1:16508:2321#0/1
e_ggdggfffffcdfffgggg]fgfgcff_afb
@HWUSI-EAS1795_0092:3:1:16556:2319#0/1
CGCGCCTTCCAAAAACAATTCGGTGTCAACCTA
+HWUSI-EAS1795_0092:3:1:16556:2319#0/1
fcffaffcggggfgg_gg]gggfgagggagcgf
@HWUSI-EAS1795_0092:3:1:16644:2321#0/1
AAATATAGTGTGAGCATTTAGAACAACTTTATT
+HWUSI-EAS1795_0092:3:1:16644:2321#0/1
eggfgg_fcfffgggggggggggggggggfggg
@HWUSI-EAS1795_0092:3:1:16967:2318#0/1
GCGGATATTGGTACGGCCTGTTGAGAAGTTTGC
+HWUSI-EAS1795_0092:3:1:16967:2318#0/1
hhhhhghhghhhghhhhhhfhhcgghghhhffg
@HWUSI-EAS1795_0092:3:1:17520:2322#0/1
GCTTGCAATGGCATTTTACGCCACGGTGCGTAT
+HWUSI-EAS1795_0092:3:1:17520:2322#0/1
hghhhhghhhhhhhhhhghgfhehhhghfhcgh
@HWUSI-EAS1795_0092:3:1:18151:2323#0/1
GTTCCGGCAATTGAAACTGGCGCTGCGAAATAA
+HWUSI-EAS1795_0092:3:1:18151:2323#0/1
da[da^daddadWWcddadd[daaccc^[^Wd^
@HWUSI-EAS1795_0092:3:1:18692:2323#0/1
GCCGCAGCAGGACAACGGTGAGGTTGTCGACCG
+HWUSI-EAS1795_0092:3:1:18692:2323#0/1
hhhhhhhhhhhhhhhhhhbghhfdffdffeffh
@HWUSI-EAS1795_0092:3:1:18942:2328#0/1
CACCCAAGGGCGCAGACATTCTGGAAGCTACAG
+HWUSI-EAS1795_0092:3:1:18942:2328#0/1
ccacaaab]K\]MQP[[]a]c]KRU_Q`W^BBB
@HWUSI-EAS1795_0092:3:1:19503:2318#0/1
GCCCATTTTATGTTGCTGTACTTGCACTTTTTA
+HWUSI-EAS1795_0092:3:1:19503:2318#0/1
gdgggggggcgcffefffggggggggggggggg
@HWUSI-EAS1795_0092:3:1:1775:2331#0/1
GTCGGCATGCGCGCGGGGGCCTTGAGGCGGAGG
+HWUSI-EAS1795_0092:3:1:1775:2331#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:1897:2337#0/1
TGTGTACAAAGGGCAGGGACGTAATCAATGCGA
+HWUSI-EAS1795_0092:3:1:1897:2337#0/1
f_fbeebfffcaccff_aaa`efffcf_ffffa
@HWUSI-EAS1795_0092:3:1:2132:2338#0/1
AGCTGCGATCTGAACAGGGCGAAGTCCGGCGCA
+HWUSI-EAS1795_0092:3:1:2132:2338#0/1
_ffffff_fffffafaffcf^fffcffcffac]
@HWUSI-EAS1795_0092:3:1:2176:2335#0/1
CCATAAGCACGACGGCCAGTCCACGCAGGCTGG
+HWUSI-EAS1795_0092:3:1:2176:2335#0/1
hhfhhafhhhhhhhghhhhhhhghhhhgfhfhh
@HWUSI-EAS1795_0092:3:1:2444:2339#0/1
GGGCAAGAAGTAGCTGGTTTGCTTCCACTCAAC
+HWUSI-EAS1795_0092:3:1:2444:2339#0/1
ggggggggfggggcegfggggfgggfggfdcag
@HWUSI-EAS1795_0092:3:1:2547:2339#0/1
GCGCATCACAGTCTTCAGCAGAGCTTTGCCATC
+HWUSI-EAS1795_0092:3:1:2547:2339#0/1
ggggegggggggggfggggg_eceffdggg]gc
@HWUSI-EAS1795_0092:3:1:2611:2339#0/1
TGTCTCTTCATAGTCTATTTGGTATTTTTGAGT
+HWUSI-EAS1795_0092:3:1:2611:2339#0/1
hhhhhghhhhhghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:2652:2338#0/1
CGGGATTTAATCCATTTGAGGTTCATGAAGGGC
+HWUSI-EAS1795_0092:3:1:2652:2338#0/1
fggggggggggeggfggcfggfgggffgggggc
@HWUSI-EAS1795_0092:3:1:4689:2335#0/1
CAGATCCTTACGGATATCCACATCACACTTCAT
+HWUSI-EAS1795_0092:3:1:4689:2335#0/1
cYcaa__a^a\ZPJQSQUYYO_]Z]Jb\T\\Y_
@HWUSI-EAS1795_0092:3:1:4887:2337#0/1
GGGCAGATCAGTGACATGGACGAAGGTGTCGTT
+HWUSI-EAS1795_0092:3:1:4887:2337#0/1
hhhhhhfhhhhhghhhhhhhhhghhhghhhghh
@HWUSI-EAS1795_0092:3:1:5804:2330#0/1
ACTGCTTCTATTAATCATTACCTCTTGATCTGA
+HWUSI-EAS1795_0092:3:1:5804:2330#0/1
geffffffggggccfffgfgggggggggggdge
@HWUSI-EAS1795_0092:3:1:6175:2340#0/1
CGGAGCGATCCTCTCCGGTCTTGGAGGCGTCAC
+HWUSI-EAS1795_0092:3:1:6175:2340#0/1
ggfdcggcdfeafcfffac_afgggcdfffffg
@HWUSI-EAS1795_0092:3:1:7055:2330#0/1
CGGAGATTTAAACAAAACTAGTGCTTTAACAAA
+HWUSI-EAS1795_0092:3:1:7055:2330#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7428:2337#0/1
CGGCTTCTTTATGGTCGTTCCTGTTGCCAGGAT
+HWUSI-EAS1795_0092:3:1:7428:2337#0/1
hhhhhhhhhhhhhhhhhhhhhhehhhhhhhhcd
@HWUSI-EAS1795_0092:3:1:7602:2330#0/1
GCGGGGTCCTTATCCCCTGTATCTTTATCCATT
+HWUSI-EAS1795_0092:3:1:7602:2330#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7773:2339#0/1
GAAACGTGTTGATGCTCTCGGTGCCGCGCCGGG
+HWUSI-EAS1795_0092:3:1:7773:2339#0/1
hhhhghhhhfhhehhghhhhhgghhghhhghhc
@HWUSI-EAS1795_0092:3:1:7911:2330#0/1
CCCATACCTACCTTTTTTGTAAACAAGTGAACA
+HWUSI-EAS1795_0092:3:1:7911:2330#0/1
ce`fdfff_fffcffffgcgggdfffcdfffff
@HWUSI-EAS1795_0092:3:1:8065:2329#0/1
CGACCAGAAGAAGGCGGCCCAAAAGGCACTTGT
+HWUSI-EAS1795_0092:3:1:8065:2329#0/1
W`dd``^KaYY^W]__SaYaaada[ddddRdaf
@HWUSI-EAS1795_0092:3:1:8886:2329#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8886:2329#0/1
egffdaffdfaffaddfaeecefff_cfacfff
@HWUSI-EAS1795_0092:3:1:9065:2339#0/1
CGAGGACGTTCCAACCACTCGCTTCAGGGCCTT
+HWUSI-EAS1795_0092:3:1:9065:2339#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9189:2332#0/1
GGTTGTTCACCTTGCCGTTGACCTTAAGGCGGG
+HWUSI-EAS1795_0092:3:1:9189:2332#0/1
^O]a]Zaacac[[J[aaaaPa]c]^caccc_QU
@HWUSI-EAS1795_0092:3:1:10339:2330#0/1
CGTAACGACCCTACACACAAGGTCACCGCTAAG
+HWUSI-EAS1795_0092:3:1:10339:2330#0/1
hhhhhhhhhhhfhhhhhhhhhhhghhhfgfhhh
@HWUSI-EAS1795_0092:3:1:11013:2331#0/1
CGGGGAGTTTTTGTCCATCTGCAACAGATTCCG
+HWUSI-EAS1795_0092:3:1:11013:2331#0/1
fcffa[c`efffccccaf_]dffffcf_ffcea
@HWUSI-EAS1795_0092:3:1:11175:2329#0/1
CTCCCGTTCATCATTGTTATTGTTGTTGTTGCT
+HWUSI-EAS1795_0092:3:1:11175:2329#0/1
ggggggggggKgfffffgfggfgggggggggce
@HWUSI-EAS1795_0092:3:1:11406:2332#0/1
CACAGCATAAGCATGCATACGAAATCCAAAACC
+HWUSI-EAS1795_0092:3:1:11406:2332#0/1
YWacccacccacSWO^Wa]Xaaa]aY^]VX]X]
@HWUSI-EAS1795_0092:3:1:11439:2333#0/1
GCCAACCAGCTGGCTGACAAGGAGGAGTACGAG
+HWUSI-EAS1795_0092:3:1:11439:2333#0/1
ec_fcff[ffcdffdffc[]fecf_ffWcedc]
@HWUSI-EAS1795_0092:3:1:12567:2332#0/1
ATTTGGGGAAGACTCTCTTGTACAGGTACATGA
+HWUSI-EAS1795_0092:3:1:12567:2332#0/1
hhhhhghhhhhhhhhhhhhghhhhhhhhhgheg
@HWUSI-EAS1795_0092:3:1:13181:2333#0/1
GAACAAGATCACCATTACCAACGACAAGGGTCG
+HWUSI-EAS1795_0092:3:1:13181:2333#0/1
hhhhhhgfhhhhhhhhhhhhhhhhhhghhaghh
@HWUSI-EAS1795_0092:3:1:13263:2334#0/1
CTCTAGCTCATGTAAAAAACTCATATTCCCAGA
+HWUSI-EAS1795_0092:3:1:13263:2334#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhgfhf
@HWUSI-EAS1795_0092:3:1:13981:2339#0/1
CGGAAGATGAGATCGGCCGACATTATATCGATG
+HWUSI-EAS1795_0092:3:1:13981:2339#0/1
hhhhhhhhffhhffhehhe]hehhachhhhhgf
@HWUSI-EAS1795_0092:3:1:14067:2338#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAAGGCCG
+HWUSI-EAS1795_0092:3:1:14067:2338#0/1
ccccca_c]a[PNJJJQc^^VacccaaBBBBBB
@HWUSI-EAS1795_0092:3:1:14176:2331#0/1
TCGTCTGTTCAGGTTCAGGTCTGGGTTGTGTCT
+HWUSI-EAS1795_0092:3:1:14176:2331#0/1
hhhhhhhhhhghhhhhhhhghhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:14299:2331#0/1
GTCAAATGTGATGTTGATCGAATGGAAGCTGTG
+HWUSI-EAS1795_0092:3:1:14299:2331#0/1
gggggfff_fffadffdgdgafdfaffa_ffdd
@HWUSI-EAS1795_0092:3:1:14349:2332#0/1
GGGTGATACCAAGACCGCTGCCGCTAAGCCAGC
+HWUSI-EAS1795_0092:3:1:14349:2332#0/1
hhhghhhhhhhhfhhhghhhhhgghhhhhhhhd
@HWUSI-EAS1795_0092:3:1:14501:2333#0/1
GTGATCTACGAGGTGTACGGAAAGCTGATCACC
+HWUSI-EAS1795_0092:3:1:14501:2333#0/1
hhhhhhhhhhhheghhhhhhhhgghfcghghhg
@HWUSI-EAS1795_0092:3:1:14519:2329#0/1
CAGGTTTATTCTATTCAATAACAATGATCAATT
+HWUSI-EAS1795_0092:3:1:14519:2329#0/1
hghhhhhhhhhhghhhhhfhhhhghgfhhhhhh
@HWUSI-EAS1795_0092:3:1:14684:2340#0/1
CGGGGATCTACGTTAAGTGAGCAAATCATTGAG
+HWUSI-EAS1795_0092:3:1:14684:2340#0/1
ffc^afcc^cedcaaadZ_\]_a^^cceeccaf
@HWUSI-EAS1795_0092:3:1:15363:2336#0/1
GTGAGAAAAATGAGTAGAAAATATAATTAGTTG
+HWUSI-EAS1795_0092:3:1:15363:2336#0/1
hhhhhhhhhhhhhhhhfhhhhffhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:15790:2331#0/1
GGCGTTTCTTTTGCGACTGGCCGGGCTCATACT
+HWUSI-EAS1795_0092:3:1:15790:2331#0/1
hhhhhhhhhhhhhhhhhhghfhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15941:2334#0/1
ATCGGGATTGCGGGTCCAGATGGGCTTGGTCTT
+HWUSI-EAS1795_0092:3:1:15941:2334#0/1
hhhhhhhhhhhhhhhhhhfghhhhghghhhhhh
@HWUSI-EAS1795_0092:3:1:15990:2333#0/1
GATCTTCTTCTGGACCTTCTTGGCGTTCAGCAG
+HWUSI-EAS1795_0092:3:1:15990:2333#0/1
hfhhhhhhhhhhhghhhhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16219:2331#0/1
TTAAGGAGGAAAACATCTTGCCATACTTTGGAG
+HWUSI-EAS1795_0092:3:1:16219:2331#0/1
fceaec[cfcfffd]dcffafcffdfffcfffc
@HWUSI-EAS1795_0092:3:1:16280:2338#0/1
CCGCGGCCTTCTTGCCACCCTTGGCCTTCTCGG
+HWUSI-EAS1795_0092:3:1:16280:2338#0/1
hhhhgghhhhhhhhhhghhhhhehhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:16404:2336#0/1
TCTAGGTTCTAGGTTCTAGTTGGAAAAACTCAC
+HWUSI-EAS1795_0092:3:1:16404:2336#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16900:2334#0/1
TGAACGTCCAACATGAGAGCCAAGGGATTGTTG
+HWUSI-EAS1795_0092:3:1:16900:2334#0/1
ggggfggggggggggcggggggfggggaaffff
@HWUSI-EAS1795_0092:3:1:16950:2333#0/1
ATGAAAATGAGCGAAAATGCATATTCTGCCATT
+HWUSI-EAS1795_0092:3:1:16950:2333#0/1
hhhhhhhhghhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17070:2339#0/1
CGGCGGAACACCAGTGTCGCCAGAGTCATCGGT
+HWUSI-EAS1795_0092:3:1:17070:2339#0/1
f^dfffffggggcagdgcfffRfffffffffa^
@HWUSI-EAS1795_0092:3:1:17215:2334#0/1
CGATGGGATGCCGTCGAACACACGCAGACGGGC
+HWUSI-EAS1795_0092:3:1:17215:2334#0/1
fdggggefafa_f]ff_dffcfaffadffffcd
@HWUSI-EAS1795_0092:3:1:17598:2335#0/1
TGCAGATTGATTGTTGGCCCGGCGGGCCGCGTC
+HWUSI-EAS1795_0092:3:1:17598:2335#0/1
ggggfggggggegggcefgfggggggggg]g[f
@HWUSI-EAS1795_0092:3:1:17855:2334#0/1
GCGCACGGTCTTGGAGGCGGGGCCCCCTTTGGG
+HWUSI-EAS1795_0092:3:1:17855:2334#0/1
fdfdWffggfggggggfaddBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:18587:2334#0/1
CCGACTGACGGAGTGCTTCGCCTTCGGCGACAA
+HWUSI-EAS1795_0092:3:1:18587:2334#0/1
hhhhhhhhhhhhfdhghhhghhfhhhdhhdhgg
@HWUSI-EAS1795_0092:3:1:19285:2335#0/1
GCCCAACTTGATGTATCGGCTAAACTGCCTTTT
+HWUSI-EAS1795_0092:3:1:19285:2335#0/1
daaaacaY[SY[KWa^\`YXZbdd]WabbWbb^
@HWUSI-EAS1795_0092:3:1:19469:2332#0/1
ACGGAGGCGTGATCCTTGGCGTGGATGATCCTG
+HWUSI-EAS1795_0092:3:1:19469:2332#0/1
gggfgfgafffdgggfccgegefff[dccfffg
@HWUSI-EAS1795_0092:3:1:1974:2345#0/1
AAACGATGCAAGTCGGAACCATTGGTGGAGGAC
+HWUSI-EAS1795_0092:3:1:1974:2345#0/1
ggggggggegggggggggggggggggfedgggd
@HWUSI-EAS1795_0092:3:1:2065:2350#0/1
CTGAACATTTGCTCCTTGTGGTGTTTGTTTGTT
+HWUSI-EAS1795_0092:3:1:2065:2350#0/1
ggdcadfffdfaffffcbf``ccfffdgggcge
@HWUSI-EAS1795_0092:3:1:2890:2351#0/1
ATTTACCCAATTCAACTAAATTCATCAATTGAA
+HWUSI-EAS1795_0092:3:1:2890:2351#0/1
hhhhghhhhfhhhghhhhhhhhfhhhfdhhhhg
@HWUSI-EAS1795_0092:3:1:2914:2344#0/1
GACAAGCGAGCGAAGGCCTTTTTGTTGTCGTTT
+HWUSI-EAS1795_0092:3:1:2914:2344#0/1
fYfffffff_\fRW__`fcffffacc`caffad
@HWUSI-EAS1795_0092:3:1:3034:2349#0/1
CAAAAAGATCATGGTGGTTCCGCCAGCAAAGGA
+HWUSI-EAS1795_0092:3:1:3034:2349#0/1
ggfgffffgggggfgcgcffcffaffaffcfff
@HWUSI-EAS1795_0092:3:1:3082:2351#0/1
CACCGTAGTACTCTTGACGAAGGAAGAACGTGA
+HWUSI-EAS1795_0092:3:1:3082:2351#0/1
ggggaggYffcfaffffggfgeggg_gggagge
@HWUSI-EAS1795_0092:3:1:4812:2345#0/1
TAATCCTAACGTCAGCGGCAGTCGACTATCCAT
+HWUSI-EAS1795_0092:3:1:4812:2345#0/1
hghhhhhhhhhhfhhhhhhhhgfcfdf[ffc`Z
@HWUSI-EAS1795_0092:3:1:5654:2349#0/1
CCGGCGACAAGAAGGTCAAGGGTCTGCGCGGAT
+HWUSI-EAS1795_0092:3:1:5654:2349#0/1
hhhghhghhhghhghhghhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:5916:2346#0/1
GGAAACTCCAGCCCCCTTACCAGTTGATACACC
+HWUSI-EAS1795_0092:3:1:5916:2346#0/1
dgggfgggeegeggg]fdfdcafffffgg_ggg
@HWUSI-EAS1795_0092:3:1:6697:2343#0/1
AAAACGGATGAACCCCAATCTCCTGTGTGAACA
+HWUSI-EAS1795_0092:3:1:6697:2343#0/1
hghfhhhhahhhhfhdhghhhhhhcdghhhhhe
@HWUSI-EAS1795_0092:3:1:6843:2349#0/1
GCCGGATGAGCACGTTCACCTTGGCCACCTTGA
+HWUSI-EAS1795_0092:3:1:6843:2349#0/1
cffdfffcdWdd_fcf_cd]fdfffc_ffcfff
@HWUSI-EAS1795_0092:3:1:7795:2346#0/1
CGCCGCCCTGCTGAAGGTCATCAAGGCCCATCC
+HWUSI-EAS1795_0092:3:1:7795:2346#0/1
hhhhhhhhfhhghhhghhhhhhfhhhhhhhggg
@HWUSI-EAS1795_0092:3:1:8546:2348#0/1
CAAGGATATTCCCAATACCCTGAGCAGCTTCGA
+HWUSI-EAS1795_0092:3:1:8546:2348#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8762:2345#0/1
TCCAGGATGAGATTCCGTTCGTCAAGCCCGCTC
+HWUSI-EAS1795_0092:3:1:8762:2345#0/1
hhhhhhchhhhhhhhhfhgfghghheghhfhhh
@HWUSI-EAS1795_0092:3:1:9194:2351#0/1
GCCGTGGTTGCTGCTGCGGCTGAAAGTCCTTGC
+HWUSI-EAS1795_0092:3:1:9194:2351#0/1
gggggggggeggga^fedfcdfggggagggggg
@HWUSI-EAS1795_0092:3:1:9484:2346#0/1
CGGGGCTGGAGCACCGGGCTCACCCTTCTGGCC
+HWUSI-EAS1795_0092:3:1:9484:2346#0/1
ffafacaffffafdfffc]ad]fddabcffaf\
@HWUSI-EAS1795_0092:3:1:9572:2344#0/1
GCGGAACAGGCTTTTCGGGAGAATATGACGCCG
+HWUSI-EAS1795_0092:3:1:9572:2344#0/1
^^\daaccd\ddcfffffff\fadccdaXaa]\
@HWUSI-EAS1795_0092:3:1:9674:2347#0/1
AAAAAAAGAAAATTTAGCTACTTCCTCTCGCAG
+HWUSI-EAS1795_0092:3:1:9674:2347#0/1
hhhhhghgghhhhhhhghhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10061:2344#0/1
TGGGAGTGTTGTACTTGTTCTTGTCCTGAAATG
+HWUSI-EAS1795_0092:3:1:10061:2344#0/1
hhhhhhhhhhhhhghhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10525:2343#0/1
CCTGGGATGACGAGACCGACATGAAGGAGATGG
+HWUSI-EAS1795_0092:3:1:10525:2343#0/1
hhhhhhhhhghhhchhhhhhhhfhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:11080:2350#0/1
CCGGTGTCCGGCTGCCAGATAATAATGGAACGA
+HWUSI-EAS1795_0092:3:1:11080:2350#0/1
hhhhffhhhhhhhghhfhdhehghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12266:2346#0/1
GGCGAGGCCCGCTACACGGCGGCCACGATACAC
+HWUSI-EAS1795_0092:3:1:12266:2346#0/1
fSffaff^dd]d^dc]d]cd[d^_a^^cccaWV
@HWUSI-EAS1795_0092:3:1:12491:2349#0/1
TTCGCAAGCTGTGGCCGGTTTATCAATGCATGC
+HWUSI-EAS1795_0092:3:1:12491:2349#0/1
hhhhhhhhhhghhhhhhhchhgfhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:13463:2342#0/1
GTTATTCTACAATTAGACAACAATAAACCAATC
+HWUSI-EAS1795_0092:3:1:13463:2342#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghghgh
@HWUSI-EAS1795_0092:3:1:13891:2345#0/1
CAAGCAGCAGAAATACGAGAAGATCTCCGAAAA
+HWUSI-EAS1795_0092:3:1:13891:2345#0/1
cYfcecefcf]ffccdbcffdae[deea[edWb
@HWUSI-EAS1795_0092:3:1:14411:2350#0/1
CGGGCAGCCGTGGCTTCGGCCACCAGGTCGCTA
+HWUSI-EAS1795_0092:3:1:14411:2350#0/1
hhghghhhhhhhhhhhhhghhe]^WR^BBBBBB
@HWUSI-EAS1795_0092:3:1:15290:2347#0/1
ATGGTGCGTATGAACGTATTGGCCGATGCCTTG
+HWUSI-EAS1795_0092:3:1:15290:2347#0/1
ehhhghgghhhhehhhhhhfhhhghchghhhhg
@HWUSI-EAS1795_0092:3:1:15726:2345#0/1
CTGCTGTGCATCGCTGGCTTTGGAGGGTGGCCA
+HWUSI-EAS1795_0092:3:1:15726:2345#0/1
hhfhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15936:2351#0/1
GCGCGCACCGCTGGTGCCTCCATGGGTCCCGTA
+HWUSI-EAS1795_0092:3:1:15936:2351#0/1
\T^acaca]dd^fff[fZT[XX^c^_^ZZV^^c
@HWUSI-EAS1795_0092:3:1:16451:2351#0/1
CGCCACCTTGAACCCCAAACACGATTCCAACCG
+HWUSI-EAS1795_0092:3:1:16451:2351#0/1
hfhhehhghhhhhhhhghhghhhhhhhhhhggg
@HWUSI-EAS1795_0092:3:1:16710:2349#0/1
GTTTAGCTAGTATCAGATGTATTCGATTTGGGG
+HWUSI-EAS1795_0092:3:1:16710:2349#0/1
hhhghhhhhhhghhhfehhghhhhhfhhhchhh
@HWUSI-EAS1795_0092:3:1:17244:2350#0/1
CTATCATCTGGTCCAGTAGTTCGTCGTCGTCGA
+HWUSI-EAS1795_0092:3:1:17244:2350#0/1
hhhhhhhhhhhghhhhhhhhhhghhhhhhghhh
@HWUSI-EAS1795_0092:3:1:17945:2343#0/1
AGATGATCGACTGCGTTGGCGTGACCAAGGGTA
+HWUSI-EAS1795_0092:3:1:17945:2343#0/1
hhghhhhhhhhhhhhhhhhefgfhfhhdhhhcf
@HWUSI-EAS1795_0092:3:1:18088:2346#0/1
CTCACATCAAATGCCATAAAGCTAAATGAGTCC
+HWUSI-EAS1795_0092:3:1:18088:2346#0/1
fggfggfgggg_gggggffgcdcggggfafdfg
@HWUSI-EAS1795_0092:3:1:18421:2345#0/1
TCCTGACCCTTTTGGAATCCGAACGTGAAGCCA
+HWUSI-EAS1795_0092:3:1:18421:2345#0/1
hhhhhhhhhhhhhfhgghhhhhhghghehhhfh
@HWUSI-EAS1795_0092:3:1:1766:2361#0/1
CGAAACACATCGTCCACATCCACGAGGATCATC
+HWUSI-EAS1795_0092:3:1:1766:2361#0/1
f_fffafgcgcgffcfadfffff`cfccdddec
@HWUSI-EAS1795_0092:3:1:2744:2354#0/1
TCTCCTCATCGTCGATGGGCGTGGTAAACGACT
+HWUSI-EAS1795_0092:3:1:2744:2354#0/1
ggcgggggggfggdgggggc_dffdfdfadffc
@HWUSI-EAS1795_0092:3:1:3616:2358#0/1
ACAAGTTCCGTGTTCAAGCGGTCAACGCCATTG
+HWUSI-EAS1795_0092:3:1:3616:2358#0/1
hgggghhhfhhhghhhhhhhfhhgahahhhhhh
@HWUSI-EAS1795_0092:3:1:5494:2361#0/1
TCCGCGAATTTTTTATGTTGCGATTCGATTCTG
+HWUSI-EAS1795_0092:3:1:5494:2361#0/1
hhhhfhhghhhhhhchhhhdghhfahcahhhgf
@HWUSI-EAS1795_0092:3:1:5838:2357#0/1
GTTTGCGTTACCAAACCCAGCTCAGAGATGTTG
+HWUSI-EAS1795_0092:3:1:5838:2357#0/1
ggdggegggcggggfgggggdgggggfa]ffag
@HWUSI-EAS1795_0092:3:1:5982:2353#0/1
GGTGACCAAGAAGATGGGCAAGAACAAGCTGAA
+HWUSI-EAS1795_0092:3:1:5982:2353#0/1
hghhghhghhhhhhhhgghhehefhhhgghghf
@HWUSI-EAS1795_0092:3:1:6230:2359#0/1
GCGGCAGTTGCTCTTCCAGATTTAAGCAGAGTG
+HWUSI-EAS1795_0092:3:1:6230:2359#0/1
gggggggagaggfggggcafffggggggggggc
@HWUSI-EAS1795_0092:3:1:7359:2360#0/1
CTGATTTACGTGATGAAGTGCTAGAATTCGTTG
+HWUSI-EAS1795_0092:3:1:7359:2360#0/1
hhhfhhhhhhhhhhhhhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7411:2360#0/1
CAAAGAAGAAGCCAGTGACCAAGAAGGTGGCTC
+HWUSI-EAS1795_0092:3:1:7411:2360#0/1
hfhhhhhfhfhfghhhhhhghhegfhhghfggh
@HWUSI-EAS1795_0092:3:1:7496:2360#0/1
ACGGATACGACCTTAGAGGCGTTCAGGCATAAT
+HWUSI-EAS1795_0092:3:1:7496:2360#0/1
hhhhhhhhhhhhhhghdhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8352:2357#0/1
TCTGTTGCATGTCCACGGTGGCGCGAATTTCCT
+HWUSI-EAS1795_0092:3:1:8352:2357#0/1
hhhhhhhhhhhhhhhhhhehhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8826:2353#0/1
CTGGGAGGCACGGTTCGGTTATCCATTTTTGAG
+HWUSI-EAS1795_0092:3:1:8826:2353#0/1
fcfffcfc]ffcafccca`dd`Z^Y^`ffcffa
@HWUSI-EAS1795_0092:3:1:8893:2363#0/1
CAGGACGGGTCCCTTAAGCTGGGTAGCCAGCTT
+HWUSI-EAS1795_0092:3:1:8893:2363#0/1
hhhhghhhhhhhhhhhhfhhhhhgfhhhhfhhh
@HWUSI-EAS1795_0092:3:1:10249:2363#0/1
GAAAACTTCTCGACAACCGGACATCCGTTGTGT
+HWUSI-EAS1795_0092:3:1:10249:2363#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhgdh
@HWUSI-EAS1795_0092:3:1:10359:2361#0/1
GTCCGCACTGAGCTGGCCTTGGGACACCTCCGT
+HWUSI-EAS1795_0092:3:1:10359:2361#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10812:2357#0/1
CCAAGAATGCGGACTTTGCCAACACCATCATTG
+HWUSI-EAS1795_0092:3:1:10812:2357#0/1
hhhhhhghhhhhhhhhhghhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:11020:2362#0/1
GCGCGCCATTCAGTTAGTTGATGTCATAGCGGA
+HWUSI-EAS1795_0092:3:1:11020:2362#0/1
fffffffffdfafccffgecggggeagcbddda
@HWUSI-EAS1795_0092:3:1:11642:2360#0/1
GCGCTGACCAGGATCTGCAGAGGGTTCTCCCCG
+HWUSI-EAS1795_0092:3:1:11642:2360#0/1
ggffggaggggggggggggagfgaggegggggc
@HWUSI-EAS1795_0092:3:1:11676:2356#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11676:2356#0/1
affdadd```d`^^d^^_cc^^d[d``aY^a^^
@HWUSI-EAS1795_0092:3:1:11922:2354#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11922:2354#0/1
dfcffffggcgg_ffffffff]afffffggggd
@HWUSI-EAS1795_0092:3:1:12193:2360#0/1
CCAGCATTAGGTTTTTGGCCCGTCGTTGCACCC
+HWUSI-EAS1795_0092:3:1:12193:2360#0/1
hhfhhhhghhhhhfchhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:12888:2361#0/1
GATTGAATGAATTTAATGTCAGGCTCTACTAAC
+HWUSI-EAS1795_0092:3:1:12888:2361#0/1
fcdRad\VZ\X_Z\aa[d^babBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:12996:2361#0/1
CTGAGCCGGAGCGGCGTACGGCGGCTGTGGGGG
+HWUSI-EAS1795_0092:3:1:12996:2361#0/1
gggggggfgggaggfgfggfg_fffcfBBBBBB
@HWUSI-EAS1795_0092:3:1:13206:2360#0/1
CCGCCCCATTCCAGACCAGCTGCCCAAGATCTA
+HWUSI-EAS1795_0092:3:1:13206:2360#0/1
hhhhhhhhhhhhhhhhhhghghhhhghhhhhhg
@HWUSI-EAS1795_0092:3:1:13536:2356#0/1
GCGCGGTATGATGGGTCGGAAGTGATGCGTTCT
+HWUSI-EAS1795_0092:3:1:13536:2356#0/1
gggggagaffdffffefff_ffaff_fgfggfg
@HWUSI-EAS1795_0092:3:1:13627:2357#0/1
ATGAATTCGTATGGAATCGGGGCCAGAGCAATC
+HWUSI-EAS1795_0092:3:1:13627:2357#0/1
gggggggggefgfgggegfgcffgdc_gggagg
@HWUSI-EAS1795_0092:3:1:13997:2359#0/1
CCTACGTATACAACATACTCTACGAGGTTATGC
+HWUSI-EAS1795_0092:3:1:13997:2359#0/1
gegggggfggggagecegggdeacfffgggdgg
@HWUSI-EAS1795_0092:3:1:14043:2355#0/1
AAAAGTCGAACAGACTTAAAATTTGAACGGCTA
+HWUSI-EAS1795_0092:3:1:14043:2355#0/1
YcaaaZadeaaecceecgggggfcaffgggggf
@HWUSI-EAS1795_0092:3:1:14144:2357#0/1
GCCCGCGGCGTCGTCATCGGCACTGGCCTAAGC
+HWUSI-EAS1795_0092:3:1:14144:2357#0/1
fffcfffffdd]eWeedd[][dccffffd]faf
@HWUSI-EAS1795_0092:3:1:14316:2355#0/1
CTTTGGAGGAGATCTACCTGTACTCGCTTCCCA
+HWUSI-EAS1795_0092:3:1:14316:2355#0/1
]fbcaa]YSS^^^Zb``Z]b`]cfffcacffff
@HWUSI-EAS1795_0092:3:1:14517:2363#0/1
TGCAGTGAATTTTTTGTTGCGATTGGAAGCGTA
+HWUSI-EAS1795_0092:3:1:14517:2363#0/1
hhhhhhhhhhhhhhhghhhheghhffhhghhfh
@HWUSI-EAS1795_0092:3:1:14704:2359#0/1
GTAAATTTATCTTACAAATTGCGTCAATTTTCT
+HWUSI-EAS1795_0092:3:1:14704:2359#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:14823:2362#0/1
AAAAAAGAAGGATAAGGGCAAGGACGAGGTATC
+HWUSI-EAS1795_0092:3:1:14823:2362#0/1
hhhhfhgchhgccghgghhhhhfhgfhhhfgfh
@HWUSI-EAS1795_0092:3:1:14915:2363#0/1
AGCGTGGATTCGTGAAGCATAACCGCCAGCGCG
+HWUSI-EAS1795_0092:3:1:14915:2363#0/1
\T\[UNVYTV^ZcccYcc_acac_c[caYaIa\
@HWUSI-EAS1795_0092:3:1:15247:2355#0/1
GCCGTTTGTATCTCTGTGTGTGTGTGTGTGTGT
+HWUSI-EAS1795_0092:3:1:15247:2355#0/1
hdhhhhhhhhhhhhhhhghhhhfhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:15598:2354#0/1
CTTTTTTTCATGAGTTCACATCTTTCTGTTAGC
+HWUSI-EAS1795_0092:3:1:15598:2354#0/1
gggggggggggf_afffgdggggggggggfggg
@HWUSI-EAS1795_0092:3:1:15763:2359#0/1
GTCAGATCGTACTCGGTGGAGGCGTTGTTCTTG
+HWUSI-EAS1795_0092:3:1:15763:2359#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhg
@HWUSI-EAS1795_0092:3:1:15858:2362#0/1
CCACAATCGATGGGAAGACGGCGCGGGGAGCAT
+HWUSI-EAS1795_0092:3:1:15858:2362#0/1
hhhhhhhhhghhhhhhhgfhhedfhhgeggefh
@HWUSI-EAS1795_0092:3:1:16147:2352#0/1
CACGTATCCGTTGGCCAGCAGGGCGTGTGCTCC
+HWUSI-EAS1795_0092:3:1:16147:2352#0/1
hghhhhchhhhghhhhhgdfhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:16326:2354#0/1
TACAGAACAGAACAGAACAGCGGAGACGCCAAC
+HWUSI-EAS1795_0092:3:1:16326:2354#0/1
hhhhhhhhhhhhhhfhhhhhhhfhghhfhhhch
@HWUSI-EAS1795_0092:3:1:16726:2361#0/1
GCGGTTTCACTTTTAATTCGTGTGTACTTAGAC
+HWUSI-EAS1795_0092:3:1:16726:2361#0/1
hhhhhhhhhhhhhhghhhhghghfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16991:2361#0/1
CAAGCATTCGCTGCGATGGCCACCTCATCGATA
+HWUSI-EAS1795_0092:3:1:16991:2361#0/1
hhhhhhhhhehhhfhhhhfhhfhhchhhhhfgh
@HWUSI-EAS1795_0092:3:1:17205:2355#0/1
CACAAATCTCGCAGCAGGCAACGGTTTTGTAAA
+HWUSI-EAS1795_0092:3:1:17205:2355#0/1
hghhhhhhhhhhhhhehhfhhhdhhhhhhgeff
@HWUSI-EAS1795_0092:3:1:17414:2363#0/1
TTTAAGTATCTTTGCAACAATTGCTAATCAATG
+HWUSI-EAS1795_0092:3:1:17414:2363#0/1
hhhhhhhhhhhhhhhhhhhhhhghghhhfhfhh
@HWUSI-EAS1795_0092:3:1:17579:2359#0/1
AGAGGACTGGTTTTAGCTGTGGGCACGCTCAAG
+HWUSI-EAS1795_0092:3:1:17579:2359#0/1
Ya_SW\_V^_]bccYcaacQcYccca_ccccYZ
@HWUSI-EAS1795_0092:3:1:17645:2355#0/1
GGCGAGGACGACAGCTGCGCCTGGCATGCCGGA
+HWUSI-EAS1795_0092:3:1:17645:2355#0/1
dfdgggggggeggggagffdfdacfffgecgga
@HWUSI-EAS1795_0092:3:1:17662:2361#0/1
CTGACTACCAAATGTCGTGTAGTTTTTGATGGA
+HWUSI-EAS1795_0092:3:1:17662:2361#0/1
hhhhhghhhhghfhhhhhhhchghhhhhfhhgh
@HWUSI-EAS1795_0092:3:1:18784:2354#0/1
CCCTGATCTCCGGCACCGATCTCTTCCTCGGCA
+HWUSI-EAS1795_0092:3:1:18784:2354#0/1
ggggggggeggccggggggegfff]fc`bb[b`
@HWUSI-EAS1795_0092:3:1:19799:2354#0/1
GCAGGATTGAGACCAATATGTTGTTAAAAGTGC
+HWUSI-EAS1795_0092:3:1:19799:2354#0/1
f\caaaK^\aaadd]ddcRc^cZ]\__cd[dd_
@HWUSI-EAS1795_0092:3:1:1106:2370#0/1
AAAAAGTAGAGATTGGCTAGAAGCAAAAAGAGC
+HWUSI-EAS1795_0092:3:1:1106:2370#0/1
aaYZYRa\^aW\c][aSaaa^\^Laaaa[Y_\c
@HWUSI-EAS1795_0092:3:1:1359:2367#0/1
GCCTGCTGGGAGCTCTACTGCTTGGAGCACGGC
+HWUSI-EAS1795_0092:3:1:1359:2367#0/1
VbccfcYddaf_cfaf\fffffgcadc^aaBBB
@HWUSI-EAS1795_0092:3:1:1813:2369#0/1
GTTTTTCTTATCGACAACGTCATGCTGACGATT
+HWUSI-EAS1795_0092:3:1:1813:2369#0/1
hhhhhhhhhhhhhhhhgahhhehhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:1884:2369#0/1
CCTCGGGCTACCAGATTGTGGACACAGTAGACG
+HWUSI-EAS1795_0092:3:1:1884:2369#0/1
gehchgghhhhfhh[hhffhhdcWcf_aacffh
@HWUSI-EAS1795_0092:3:1:3423:2367#0/1
CCTGGCAGCACATACATACTCACATGCAATAGA
+HWUSI-EAS1795_0092:3:1:3423:2367#0/1
hhhghhhhhhhhhhhhhhhhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:4209:2367#0/1
GGAAGATTTTGTTGCTCTGCTCGGCCGGGACGG
+HWUSI-EAS1795_0092:3:1:4209:2367#0/1
hhhhhhhhhhfhhhhhhhhhghhhhhhhgghhf
@HWUSI-EAS1795_0092:3:1:4692:2368#0/1
ATTCAAGTTTAACTTTTTGCCGTCAAACTCAGG
+HWUSI-EAS1795_0092:3:1:4692:2368#0/1
ggggggggggggcgdfggfggggegggcggfgf
@HWUSI-EAS1795_0092:3:1:4777:2372#0/1
CGGCGGCGTACAGACAACGACGAGTGGTTGGAA
+HWUSI-EAS1795_0092:3:1:4777:2372#0/1
ggfgggaffffffffffWda[cQ_S_\eceedU
@HWUSI-EAS1795_0092:3:1:4866:2365#0/1
CAGCGGATTAAAACTTCGTCACTCTAGCAACAA
+HWUSI-EAS1795_0092:3:1:4866:2365#0/1
hhhhhhchhhhhhghhhghhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:4989:2370#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4989:2370#0/1
faaffffggeacaeaeafffcffdfff_ffffg
@HWUSI-EAS1795_0092:3:1:5006:2375#0/1
GTTCAAACCGGTGTAAGCCAGGTTGGTTTCTAT
+HWUSI-EAS1795_0092:3:1:5006:2375#0/1
hhhhhhhhhhhhcghghhghhhhdhhghhghfh
@HWUSI-EAS1795_0092:3:1:5438:2369#0/1
AGAAGAAGTTCAAGGCCTTCGCCACGCTGCGCA
+HWUSI-EAS1795_0092:3:1:5438:2369#0/1
gggggfgggggggfcggggggfggfggggagdg
@HWUSI-EAS1795_0092:3:1:5606:2369#0/1
AGTTCATCTAAGTAACAAATAGCTGCATTGCCA
+HWUSI-EAS1795_0092:3:1:5606:2369#0/1
ggggfgggggggggg_gggcgggggggfgggag
@HWUSI-EAS1795_0092:3:1:6042:2371#0/1
GGCGGATCTTGCAGGTGTCGCGGTGCTGTGTGT
+HWUSI-EAS1795_0092:3:1:6042:2371#0/1
ff_ffffgggggfff_ffffdffdfffffffdg
@HWUSI-EAS1795_0092:3:1:6512:2375#0/1
GCGGGTTTGGATGTTCTTCAAGCGCGATCCGCG
+HWUSI-EAS1795_0092:3:1:6512:2375#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6637:2370#0/1
CGAAAAAATATATATTGCGCCTATGCGAGGTAG
+HWUSI-EAS1795_0092:3:1:6637:2370#0/1
ghhghhehhghhggghffhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6795:2367#0/1
CACATGATGGTTGTACATACCAATTGCGATCTC
+HWUSI-EAS1795_0092:3:1:6795:2367#0/1
hhhhhhhhhhhhhhghehhhhhhhhhhgdhhhh
@HWUSI-EAS1795_0092:3:1:8427:2372#0/1
GGGCAACGGCCGATGCTGGATGAAGGCGAAGGC
+HWUSI-EAS1795_0092:3:1:8427:2372#0/1
ggggggggggggaWff_gggggaegggggggad
@HWUSI-EAS1795_0092:3:1:8503:2365#0/1
CATCACTCTGGCCAACGAGACTCCCGTGACCGC
+HWUSI-EAS1795_0092:3:1:8503:2365#0/1
hghhhhhhhhhhghhhgfghhhhhhhhchhhgh
@HWUSI-EAS1795_0092:3:1:8542:2372#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8542:2372#0/1
fffaacfdf_ff[`decVY\\Yfafa]ffdafa
@HWUSI-EAS1795_0092:3:1:8808:2366#0/1
GCAGGTTAGACTTTATATATAATTCAAAAAGAC
+HWUSI-EAS1795_0092:3:1:8808:2366#0/1
ghhhhghhhhhhhhhhghhghhhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:10190:2368#0/1
GACATTCTGGTGCAGTACGACAGAACCCTGCTG
+HWUSI-EAS1795_0092:3:1:10190:2368#0/1
hhhhhhhhhhhhhhhhhhhghhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10690:2369#0/1
GTGGAGCCCAAGCGCGCCGTTCCCCGTCAGGAC
+HWUSI-EAS1795_0092:3:1:10690:2369#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:11387:2373#0/1
TGTGATTTCCGTACACCTCGGGAGGGGGCTCCA
+HWUSI-EAS1795_0092:3:1:11387:2373#0/1
hhhhhhhhhhhhhfhhhhhhhhghhhghhhhhf
@HWUSI-EAS1795_0092:3:1:12152:2371#0/1
ACGGTTTTGTAAATATGTCAGCCAGTTGATTCT
+HWUSI-EAS1795_0092:3:1:12152:2371#0/1
hhhhhghhhhhhhhfhhhhhhhhgfhgdhhhgh
@HWUSI-EAS1795_0092:3:1:12210:2371#0/1
ACCTATTCTGAAAGGAGGTCTTAATTCAATGCC
+HWUSI-EAS1795_0092:3:1:12210:2371#0/1
ccfccfffff[f_ffScd^ddacfffffffff]
@HWUSI-EAS1795_0092:3:1:12565:2368#0/1
CGGGCATACCTCCGGGACCGCCGGGCATGCCAC
+HWUSI-EAS1795_0092:3:1:12565:2368#0/1
hghhhhhhhhhhhhhhhhhhchfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12675:2369#0/1
GTCTGATTGCCTACTCTAATCCTTGGTCCAGTC
+HWUSI-EAS1795_0092:3:1:12675:2369#0/1
hhhhghhhhhhhhhhhhhfhhghhhhhhdhggh
@HWUSI-EAS1795_0092:3:1:12845:2369#0/1
CGGGCGTGGGCACGAACACTGAAATCTAGCTCA
+HWUSI-EAS1795_0092:3:1:12845:2369#0/1
hhhhhhhhhghhhhhhhghhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:13511:2366#0/1
GCAAGATGTTCATCGAAGACGATGCGCAAATGG
+HWUSI-EAS1795_0092:3:1:13511:2366#0/1
hhhhhhhhhhhhhhhhhdhhghahhghhhhhhf
@HWUSI-EAS1795_0092:3:1:13697:2368#0/1
AAGAAGTTTAAATTTAAAGCGTAGTTCGCGAAC
+HWUSI-EAS1795_0092:3:1:13697:2368#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhhg
@HWUSI-EAS1795_0092:3:1:14303:2371#0/1
TAGAAAGCCGGATGCCTTAAAGCACACATCGAA
+HWUSI-EAS1795_0092:3:1:14303:2371#0/1
hhghghghhhhhfehghhghgfhghhhghhhhh
@HWUSI-EAS1795_0092:3:1:15012:2367#0/1
AAAGTTTTGGGCAGCGTGGGTGAGCCCATCAAC
+HWUSI-EAS1795_0092:3:1:15012:2367#0/1
gggggggggggggggggggggfcgggggggggg
@HWUSI-EAS1795_0092:3:1:15913:2369#0/1
CTTCAAGAAGTTCTTCACCCGTTCGGGATTGTA
+HWUSI-EAS1795_0092:3:1:15913:2369#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:16658:2367#0/1
GATCATCAAGGGCGCCTTCGGCACCCGTGCCCG
+HWUSI-EAS1795_0092:3:1:16658:2367#0/1
gggfeggggggcfffffafcffgfagdgcggga
@HWUSI-EAS1795_0092:3:1:16783:2373#0/1
TTTCTACTATAAAAGCCGATGAAAAACGATCCG
+HWUSI-EAS1795_0092:3:1:16783:2373#0/1
ggfgggfgf_ggfggfggcggggggfgeggggf
@HWUSI-EAS1795_0092:3:1:17048:2370#0/1
CGAAACACATCGTCCACATCCACGAGGATCATC
+HWUSI-EAS1795_0092:3:1:17048:2370#0/1
hhghhhhhhhhhhhhhhghhhhhhhhhhhfhhf
@HWUSI-EAS1795_0092:3:1:17271:2365#0/1
GAAAAGTTTAAATAAAGAATTCGGCAAAAATAA
+HWUSI-EAS1795_0092:3:1:17271:2365#0/1
QR]]a^cccc^c^a]__R[[^a_\Y__^]__V[
@HWUSI-EAS1795_0092:3:1:17555:2365#0/1
TAAATGGAAACCCACAGCATACCACAGCAGCGC
+HWUSI-EAS1795_0092:3:1:17555:2365#0/1
fgggfdgfffffggggg_ffdcdfbddfgeggg
@HWUSI-EAS1795_0092:3:1:17966:2374#0/1
CAACGCCTTCTTGTTGAAGAAGCGCGATGTGAA
+HWUSI-EAS1795_0092:3:1:17966:2374#0/1
hhhhhhhhhhhhghhhhhfhhhhhhhgggghhh
@HWUSI-EAS1795_0092:3:1:18074:2364#0/1
GCGAACGAAAAAAAAACCTACTTCACTTTATAC
+HWUSI-EAS1795_0092:3:1:18074:2364#0/1
c]fff_[dcedcc]_c]bRab`d]dcfdcRb^\
@HWUSI-EAS1795_0092:3:1:18135:2375#0/1
ATGAAAACAATCATAACGGACATGGGAACGGAA
+HWUSI-EAS1795_0092:3:1:18135:2375#0/1
hhhhhhhhhhhhhhhhhggghhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:19381:2369#0/1
TGCTCTTGAAGCCGCTACCCGAGGTATTCGCCT
+HWUSI-EAS1795_0092:3:1:19381:2369#0/1
ggggdgggggfggcggfdffdfffdffggegge
@HWUSI-EAS1795_0092:3:1:19555:2368#0/1
CAGGTGACCAAGGTTCACTTCCGCAAACACACG
+HWUSI-EAS1795_0092:3:1:19555:2368#0/1
adaa^aWccaYcf]ffdc[Wcccfdfdffaff\
@HWUSI-EAS1795_0092:3:1:1913:2384#0/1
TGACTGGCAACGATGGACCTGTGGGAGGCCGCG
+HWUSI-EAS1795_0092:3:1:1913:2384#0/1
ffcffffffff_dfffcfffffgdagg`ggcaf
@HWUSI-EAS1795_0092:3:1:2465:2377#0/1
GGGGACCGGCCTTGAAGTCAACACGCACGGTGT
+HWUSI-EAS1795_0092:3:1:2465:2377#0/1
ggfgggfgcgggggdggfdYdfcfdf[dfc`ff
@HWUSI-EAS1795_0092:3:1:2727:2385#0/1
TGACCTCCAGGCCCTCGAAGCGACCGTTGTAGT
+HWUSI-EAS1795_0092:3:1:2727:2385#0/1
hhhhhhhhghhghhhhhhhhhfhhgghhhfhhh
@HWUSI-EAS1795_0092:3:1:4286:2386#0/1
CGCCGCAAGGAGCACGGATCCTTCTACGTTGGG
+HWUSI-EAS1795_0092:3:1:4286:2386#0/1
hhfhhhhghhghehhhh_hhhgghfghfhcahh
@HWUSI-EAS1795_0092:3:1:4341:2383#0/1
CAGGACGCGAGCATGATGGATGGACTTGGCAAG
+HWUSI-EAS1795_0092:3:1:4341:2383#0/1
hhhhhhhhhgghhhhchghdgghhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:4471:2377#0/1
CGCTTGGCCATTTTGCTGTTGTTGTTGGTGTGT
+HWUSI-EAS1795_0092:3:1:4471:2377#0/1
fcccfffddfdfggg_gfffaffffadafdcff
@HWUSI-EAS1795_0092:3:1:4498:2381#0/1
TTGCGCACAAGTGAAGGCCAGCCCAGTTGTCCA
+HWUSI-EAS1795_0092:3:1:4498:2381#0/1
cdgcgag]ffffffffa]affff_dffdffffg
@HWUSI-EAS1795_0092:3:1:5123:2387#0/1
GCTTTCGCCCACCTGAACGATCTGTTCGGCACC
+HWUSI-EAS1795_0092:3:1:5123:2387#0/1
hhhhhhhhhhhhhghhhhhhgghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5147:2383#0/1
CAACCAACCCACAAAAACTACAAGAAGGAGGAA
+HWUSI-EAS1795_0092:3:1:5147:2383#0/1
hhhgfghhhhhhhhhhhhghhhhhhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:5260:2387#0/1
CGCCTTAGTGGGTCTTGGCGGCCAGACGCTTGT
+HWUSI-EAS1795_0092:3:1:5260:2387#0/1
hhhhhhhhhhhhghhhhgghhfhhahec]bd`c
@HWUSI-EAS1795_0092:3:1:5372:2384#0/1
TCCCTCCTTATCCTGAATCTTGGCCTTCACATT
+HWUSI-EAS1795_0092:3:1:5372:2384#0/1
hhhghhhhhhhhhhhhhhhhhhhhghhhhhfhg
@HWUSI-EAS1795_0092:3:1:5620:2381#0/1
GGTGGCACTAATCAGGGCAAAGTCATCGGCATC
+HWUSI-EAS1795_0092:3:1:5620:2381#0/1
^fbcfdccfffdeecgggggggggggggggfga
@HWUSI-EAS1795_0092:3:1:5976:2385#0/1
GCGGGACGCAAAATCGTAAAAGATTTACATTTA
+HWUSI-EAS1795_0092:3:1:5976:2385#0/1
ffc[dd]b`b_[RQ]QPddadWNQ^PVff`ccW
@HWUSI-EAS1795_0092:3:1:6669:2383#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6669:2383#0/1
ff_ffccfffccdfYffffafffaffdd[afcb
@HWUSI-EAS1795_0092:3:1:7548:2384#0/1
AAGAACTGCTCATTCCGAACATACACCGACAAA
+HWUSI-EAS1795_0092:3:1:7548:2384#0/1
da]Zb]Vb]^]^aacaccaff[`^]^ZZUYZWa
@HWUSI-EAS1795_0092:3:1:7644:2387#0/1
ACAGCTTTCTTAAATGGCACGTTAAAAGAGGAA
+HWUSI-EAS1795_0092:3:1:7644:2387#0/1
hhhhhhhhhhhhhhhhhhhhhhchhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7702:2384#0/1
CGCGGATTGCAGGGACCACCAGGTGCAAGCGGA
+HWUSI-EAS1795_0092:3:1:7702:2384#0/1
gggggggggggcffcgggggfggfffggggged
@HWUSI-EAS1795_0092:3:1:8277:2377#0/1
AGCAGCTTCCTTACAAAAGAGTACATCCTCCAG
+HWUSI-EAS1795_0092:3:1:8277:2377#0/1
]ff]ff]XV_ZV^]b^]QXSQR\YYU\^^^^OX
@HWUSI-EAS1795_0092:3:1:9618:2376#0/1
CAATCCGAATGTGCTGCGGCAGCTCCATACGCT
+HWUSI-EAS1795_0092:3:1:9618:2376#0/1
ggggfeggggggggggggfeggecggg]cc`fa
@HWUSI-EAS1795_0092:3:1:10228:2385#0/1
TGTAACTCCAACACATACTTACATCCAATGATA
+HWUSI-EAS1795_0092:3:1:10228:2385#0/1
fcffddfgggggggggcffffefgggggggfgg
@HWUSI-EAS1795_0092:3:1:10535:2376#0/1
GAACAACTCAAGCAGCAAAAACTTGTTGAAGAG
+HWUSI-EAS1795_0092:3:1:10535:2376#0/1
hhhhhhhhhhhghhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10814:2377#0/1
CAAAACCGTTGCCTGCTGCGAGATTTGTGGAGT
+HWUSI-EAS1795_0092:3:1:10814:2377#0/1
ccccaccc[ccac^aYaR^VSVO]^BBBBBBBB
@HWUSI-EAS1795_0092:3:1:11271:2387#0/1
TGGCTGTTGGCCCGCGAGGTGCTCCGCCTGCGT
+HWUSI-EAS1795_0092:3:1:11271:2387#0/1
d`ddedbf]daffdaffdf`[fU\\\Yfce_ac
@HWUSI-EAS1795_0092:3:1:12308:2383#0/1
GGGCAACAGGAAGCAATGGTGGGTAGCAAGCAG
+HWUSI-EAS1795_0092:3:1:12308:2383#0/1
hhhhhhhhhhhhhhhhhhhghhhhhhhhhfffh
@HWUSI-EAS1795_0092:3:1:12610:2383#0/1
GCTGACACCGCGTGGTGTTTTTGCTTTCGATTC
+HWUSI-EAS1795_0092:3:1:12610:2383#0/1
gcggcfgfgggegggfcggggggeggfffccfg
@HWUSI-EAS1795_0092:3:1:12815:2385#0/1
GCCGGAAGCTGCACCCGCTGGCAGCCCATTTCC
+HWUSI-EAS1795_0092:3:1:12815:2385#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12879:2381#0/1
CCGGCTGGACGAGACCTCTACTTCCTGAGGAGA
+HWUSI-EAS1795_0092:3:1:12879:2381#0/1
acccca_UaWaU_BBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:13802:2376#0/1
CGAGAGAGAAACATACAAAGTTCGATGGAGTCG
+HWUSI-EAS1795_0092:3:1:13802:2376#0/1
UV]b^bPZWVTV\^BBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14003:2377#0/1
CCTACGTATACAACATACTCTACGAGGTTATGC
+HWUSI-EAS1795_0092:3:1:14003:2377#0/1
fgfffffggcfgfggadfaddfggggdgffeaf
@HWUSI-EAS1795_0092:3:1:14025:2387#0/1
GCCGTTTGAATGGGAGCCTGCTGGGGCTCGTAG
+HWUSI-EAS1795_0092:3:1:14025:2387#0/1
ad^aaadc\add^_aY\daadSaaaBBBBBBBB
@HWUSI-EAS1795_0092:3:1:15180:2383#0/1
AAGCGCAGCAGCATTGCCCACTAAATGGAACTC
+HWUSI-EAS1795_0092:3:1:15180:2383#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16099:2384#0/1
GTCATAGATCTGATTCACTCGCCAGCCGACCAG
+HWUSI-EAS1795_0092:3:1:16099:2384#0/1
fhhhhhhhhghfhhhhhhhhhhhhhhhchhhhg
@HWUSI-EAS1795_0092:3:1:16304:2378#0/1
GCTTAACTGGGGATGACAATTTTTTCACAGGCA
+HWUSI-EAS1795_0092:3:1:16304:2378#0/1
hhhhhhhhhhhhhhhhhhehhhhhhhhhfhggh
@HWUSI-EAS1795_0092:3:1:16737:2385#0/1
GGGAGGCGTGCTTCTCGACCTTTTCGACGTGGT
+HWUSI-EAS1795_0092:3:1:16737:2385#0/1
hhhhgghhghhhhhfggfhhhghghhhhhghcg
@HWUSI-EAS1795_0092:3:1:17436:2377#0/1
AACTCAATCAAGATGCCTTGCCCATGCGGAAGC
+HWUSI-EAS1795_0092:3:1:17436:2377#0/1
bccaadddabbbZKa^]^\Ycd`aa`cdcdYcf
@HWUSI-EAS1795_0092:3:1:17500:2378#0/1
TTTCGATTTGTTTGCCCTTGGCGCGGTAGTGCT
+HWUSI-EAS1795_0092:3:1:17500:2378#0/1
hhhhhhhhhfhhhhhhhhhghhfhhghhhghhh
@HWUSI-EAS1795_0092:3:1:17985:2380#0/1
AGGCCACCTACGAGAAGCTGTACAAGGAAGTGC
+HWUSI-EAS1795_0092:3:1:17985:2380#0/1
hhhhghhhhhhhhghgghhhhhghhhhgfcchh
@HWUSI-EAS1795_0092:3:1:18154:2377#0/1
GCGACCTCGATGTTGGATTAAGATATAATTTTG
+HWUSI-EAS1795_0092:3:1:18154:2377#0/1
ggfgggdgeggaffffafcfcd_afffcgacgg
@HWUSI-EAS1795_0092:3:1:18178:2384#0/1
ATGGAAACAGTACTTAACATATACAATCATAAA
+HWUSI-EAS1795_0092:3:1:18178:2384#0/1
gdggaggfffcfffffffgegggggggagggfg
@HWUSI-EAS1795_0092:3:1:18422:2385#0/1
AATGGATTAACGAGATTCCTACTGTCCCTATCT
+HWUSI-EAS1795_0092:3:1:18422:2385#0/1
ehhhhhghfhhhhggghhghghhghhhggghhh
@HWUSI-EAS1795_0092:3:1:18612:2384#0/1
TGTGTGTAAAAAGGTCTTCTCGAGTTTGGTCGC
+HWUSI-EAS1795_0092:3:1:18612:2384#0/1
hghhhhhhhhhfghhhhhhhhhdfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18882:2382#0/1
CTGGTAGTTTCCTCTGTTCATCTGCTGCGCATT
+HWUSI-EAS1795_0092:3:1:18882:2382#0/1
egfggggggggggggegggggfggggggfgggg
@HWUSI-EAS1795_0092:3:1:18945:2377#0/1
CGGATGCTTCGGTTTTCTGCTCAATGGAGGAGA
+HWUSI-EAS1795_0092:3:1:18945:2377#0/1
`^aabaab__aaadddcYR^Y\I\Y\\aa^BBB
@HWUSI-EAS1795_0092:3:1:19027:2381#0/1
ATAGAATTGGTCGCGGTGGTCGTTTCGGTCGCA
+HWUSI-EAS1795_0092:3:1:19027:2381#0/1
hhhhhhhhghhhhhhhhhhghhhhhhhhfhdhh
@HWUSI-EAS1795_0092:3:1:19091:2378#0/1
ATAAGTGCTTGTTCGCTGGTATATCGGCTGGGG
+HWUSI-EAS1795_0092:3:1:19091:2378#0/1
hhhhffhhhfhhghhfhfhfghfhfgghghhBB
@HWUSI-EAS1795_0092:3:1:19472:2378#0/1
GCTCGCTGGAGTCCTTGGTCAGGCTCTTGTAGA
+HWUSI-EAS1795_0092:3:1:19472:2378#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhchh
@HWUSI-EAS1795_0092:3:1:19604:2380#0/1
TGATTCTGCTGCGACAGAGTCGCGTGCTGTGGT
+HWUSI-EAS1795_0092:3:1:19604:2380#0/1
ggggcggfaffff]fffgcggfggggagggdfg
@HWUSI-EAS1795_0092:3:1:19718:2381#0/1
TTTGCAGACATCAGCTGATTTTTTTTCGCTTCC
+HWUSI-EAS1795_0092:3:1:19718:2381#0/1
hhhhhhhhhdghhhhhhhhhhhhhhghdghhhg
@HWUSI-EAS1795_0092:3:1:1506:2388#0/1
GCGAAAACCGAAAAGTCTGTGCTTTGTTCTTAA
+HWUSI-EAS1795_0092:3:1:1506:2388#0/1
bfTaccdcaaYcea`d^cdeddcf\cfccedff
@HWUSI-EAS1795_0092:3:1:1822:2390#0/1
GGTCACATCCTCGATGCGGCCAATCTTCATGGA
+HWUSI-EAS1795_0092:3:1:1822:2390#0/1
ffff[a[d[adddcadR_b`b`afffcTUWZ\^
@HWUSI-EAS1795_0092:3:1:2062:2388#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:2062:2388#0/1
_\\`Zb_ccccad\cdd^aXa\aYcScaKcaaX
@HWUSI-EAS1795_0092:3:1:2202:2390#0/1
TATCGAACGAAGCAATGATCTATTTGTAACGAC
+HWUSI-EAS1795_0092:3:1:2202:2390#0/1
ee\cdeddbced\e\eafffaddccdccdccaX
@HWUSI-EAS1795_0092:3:1:2367:2392#0/1
GCTGAAGACCACAATGTCGGCCAATGTGATCCT
+HWUSI-EAS1795_0092:3:1:2367:2392#0/1
hhghhhhhhhhhghhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:3466:2393#0/1
TGAAAATCAAGGACAAACCCGCAGTTGTCCATC
+HWUSI-EAS1795_0092:3:1:3466:2393#0/1
hhhhhhhghhhhhgghhhhghafhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3900:2396#0/1
AGGTACGTTGCGTTTGGCTCGGTGCCTTGCACA
+HWUSI-EAS1795_0092:3:1:3900:2396#0/1
gggggggggggggggeggdggaccfffgcgggg
@HWUSI-EAS1795_0092:3:1:4437:2396#0/1
GTTTAAAACCACAAACCAACTACAACTACAACA
+HWUSI-EAS1795_0092:3:1:4437:2396#0/1
gggggggcffadgggffggffgaggggggdgge
@HWUSI-EAS1795_0092:3:1:4773:2397#0/1
GTCGTAGTGGGCGTTGTGGGCGGTAGTGTGCTT
+HWUSI-EAS1795_0092:3:1:4773:2397#0/1
gggggggggggdfffcfgggdgfc]fdfbdbdg
@HWUSI-EAS1795_0092:3:1:4788:2387#0/1
AAATGAGCTTAGGCAACGCCAGGCCATTGGTCT
+HWUSI-EAS1795_0092:3:1:4788:2387#0/1
gdgefggggegggfggefff_fgggaggggccf
@HWUSI-EAS1795_0092:3:1:5559:2397#0/1
CTTAGAAGCAGTTTACATTTGTTTAGAACATTA
+HWUSI-EAS1795_0092:3:1:5559:2397#0/1
_ffaf^fff_fffff]^addeegfgfafcffcf
@HWUSI-EAS1795_0092:3:1:5586:2397#0/1
CAAAATCACAGAACCAAAATTTGTTTTTCACTT
+HWUSI-EAS1795_0092:3:1:5586:2397#0/1
gggggdggggdcggggfggggggggggcfdfff
@HWUSI-EAS1795_0092:3:1:6220:2391#0/1
GTCAAGCATTTGTTAGCAATCAAAAATTGATAC
+HWUSI-EAS1795_0092:3:1:6220:2391#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhghghh
@HWUSI-EAS1795_0092:3:1:6267:2390#0/1
GGCAAATAGACCGGCACATCGTGTTGCATTGTG
+HWUSI-EAS1795_0092:3:1:6267:2390#0/1
hhhhhhhhhhhhhhhfhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6292:2389#0/1
GACATTCTCTTCTTCTGGGTGGCTCGCATGGTA
+HWUSI-EAS1795_0092:3:1:6292:2389#0/1
hhfafffcffffhhhgghhghhhhhhhcfhhhh
@HWUSI-EAS1795_0092:3:1:6802:2390#0/1
AGCAGATCCGCCTGATGCGCCAAGAGACCGTCA
+HWUSI-EAS1795_0092:3:1:6802:2390#0/1
hghhgghhhhhhhefhghhhhfhhhgfghdggf
@HWUSI-EAS1795_0092:3:1:7241:2394#0/1
ACGATTTTGACATTGTCAAGCTGATCTCAAATG
+HWUSI-EAS1795_0092:3:1:7241:2394#0/1
cgggggggaggafffffggfgggeggggggffg
@HWUSI-EAS1795_0092:3:1:7307:2389#0/1
CTGACCCTTTTGGAATCCGAACGTGAAGCCAGG
+HWUSI-EAS1795_0092:3:1:7307:2389#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:7460:2394#0/1
ATTTCCCCCAGTCCCAAGAAGGCCAAGAGCAAC
+HWUSI-EAS1795_0092:3:1:7460:2394#0/1
hhhhhhhhhhhehhhhhdhgfghdgh_fhhhhh
@HWUSI-EAS1795_0092:3:1:7509:2388#0/1
CGACGGCTTCTTTATGGTCGTTCCTGTTGCCAG
+HWUSI-EAS1795_0092:3:1:7509:2388#0/1
dgggggaggccgcXf\fa\aac\^T\Va\daaa
@HWUSI-EAS1795_0092:3:1:7925:2388#0/1
GGCGAACACATGACCTTGCGAGTCCTTAATGTG
+HWUSI-EAS1795_0092:3:1:7925:2388#0/1
ggggggggggfegggggfggggggggggggggg
@HWUSI-EAS1795_0092:3:1:8255:2397#0/1
CACAATGTGATTTCTGCCCAGTGCTCTGAATGT
+HWUSI-EAS1795_0092:3:1:8255:2397#0/1
gfhhhhhhhhhhhhffhhhhhhfghhhfhhhdg
@HWUSI-EAS1795_0092:3:1:8391:2395#0/1
CCGAGAAATTGCGGCTTCGAAATCACGATCTTG
+HWUSI-EAS1795_0092:3:1:8391:2395#0/1
hghhfhhhhghhhhhhggghhhfghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8651:2399#0/1
CAAACTGCTTCTATTAATCATTACCTCTTGATC
+HWUSI-EAS1795_0092:3:1:8651:2399#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhehh
@HWUSI-EAS1795_0092:3:1:8691:2387#0/1
GTGAAGGCAACATAGGATGGAGTGGTACGATTA
+HWUSI-EAS1795_0092:3:1:8691:2387#0/1
ffffffaadcacVQ]ZMZ_\UUN_BBBBBBBBB
@HWUSI-EAS1795_0092:3:1:8760:2399#0/1
CGCTCCTTGAGCAAACTGTCTTTGGCCCGCTGC
+HWUSI-EAS1795_0092:3:1:8760:2399#0/1
gggcgggfgggggggggggdcggggfggfggeg
@HWUSI-EAS1795_0092:3:1:9876:2391#0/1
CCAGAACGCTGCTTTCTCGCCTCGCAAGTGTGT
+HWUSI-EAS1795_0092:3:1:9876:2391#0/1
hhhhhhhhhhhhhfhhhhhehahhhhggghggh
@HWUSI-EAS1795_0092:3:1:10016:2396#0/1
GGAAGCCAATCCCTGGTCTAATGAATATTCGTC
+HWUSI-EAS1795_0092:3:1:10016:2396#0/1
hhhhghhhhhhhhhhhhhhhhghgehhhhhcgh
@HWUSI-EAS1795_0092:3:1:10067:2398#0/1
CAGGGGCTTCTTGCCGGCGAGGACCTTCTTCTT
+HWUSI-EAS1795_0092:3:1:10067:2398#0/1
hfhhhhghhhchfRffahhffhfgfhghhhhff
@HWUSI-EAS1795_0092:3:1:10700:2390#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:10700:2390#0/1
gcfffefff_cffffffcffffafdfdfdffce
@HWUSI-EAS1795_0092:3:1:11444:2392#0/1
GCAAAAATCATTTCAAACCAAGCGAGGCTCATT
+HWUSI-EAS1795_0092:3:1:11444:2392#0/1
fffgggfggdfgggfggggaggfaffafdffda
@HWUSI-EAS1795_0092:3:1:11580:2397#0/1
GTGCAATGCTATACTCCTGATGTTACACACGCA
+HWUSI-EAS1795_0092:3:1:11580:2397#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:11789:2399#0/1
CGTCGCCTGGCGACTGGGCGACACTGGAGCACC
+HWUSI-EAS1795_0092:3:1:11789:2399#0/1
gggggfg]ffccffdeffaccfgcdgggfgfgg
@HWUSI-EAS1795_0092:3:1:12218:2389#0/1
ACCTATTCTGAAAGGAGGTCTTAATTCAATGCC
+HWUSI-EAS1795_0092:3:1:12218:2389#0/1
hhhhhhhhhhhhhhgghhhhhhhghhhghhhhh
@HWUSI-EAS1795_0092:3:1:12359:2390#0/1
CAGAGCCAAACAGGGGTTCGTGATTTATAGAAT
+HWUSI-EAS1795_0092:3:1:12359:2390#0/1
hhhhhhhhhhhhhhhhhhhhhhghhghhhhhhh
@HWUSI-EAS1795_0092:3:1:12476:2391#0/1
CGACCAGTTTGCCACCGCAAGCGGAGACAAGAC
+HWUSI-EAS1795_0092:3:1:12476:2391#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhghfhh
@HWUSI-EAS1795_0092:3:1:14421:2397#0/1
GTCGTTCCTGTTGCCAGGATGAGCACGAGGCCC
+HWUSI-EAS1795_0092:3:1:14421:2397#0/1
gggggfggcgcgggggffc_fcfffffdgg[gg
@HWUSI-EAS1795_0092:3:1:14529:2389#0/1
CATCGATCTCGTCCAAATCTTCAGCATCTTTAT
+HWUSI-EAS1795_0092:3:1:14529:2389#0/1
hhhhhhhhhhhhhhhhhhfhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:14656:2395#0/1
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTT
+HWUSI-EAS1795_0092:3:1:14656:2395#0/1
ggggggggg]gggggggggafgfgggggfgggg
@HWUSI-EAS1795_0092:3:1:16011:2396#0/1
TATGATTACGTTTAGTATTGCCCCAACCTCGGA
+HWUSI-EAS1795_0092:3:1:16011:2396#0/1
ggggggggfggggggaggggggggggggagg]g
@HWUSI-EAS1795_0092:3:1:18546:2390#0/1
TCTCCTTCTGCCCGCCGGTAGCGGCTCCGAAAA
+HWUSI-EAS1795_0092:3:1:18546:2390#0/1
dfffcafcfdfff[fccacfffbafWa]]\]`b
@HWUSI-EAS1795_0092:3:1:18679:2393#0/1
GCAACCAGCAAAGCAAAACAATTTGAAATGAAA
+HWUSI-EAS1795_0092:3:1:18679:2393#0/1
haghhghhghhhhghhhhhhhfhhhhfhgghgd
@HWUSI-EAS1795_0092:3:1:18762:2396#0/1
GAAAGATCCGTTGGATGATTCAACACTGTAATA
+HWUSI-EAS1795_0092:3:1:18762:2396#0/1
hhhhhhhhhhhhhhchhhhhghhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:19212:2390#0/1
GTCGTCGGATGTCGGGGACTCGGTAAATTAGTA
+HWUSI-EAS1795_0092:3:1:19212:2390#0/1
ffff_]cZUX\ZdacddFOQM[\HU_OTSQVJ^
@HWUSI-EAS1795_0092:3:1:19367:2395#0/1
CAAATGCCTGCTGGAGAAATTAAAACGGATGAT
+HWUSI-EAS1795_0092:3:1:19367:2395#0/1
hhhhhhhhhghhehhhhhhhhchhgghhfgfhh
@HWUSI-EAS1795_0092:3:1:19410:2396#0/1
CACGGGGAAGCTGATACTCAAGCCGCGGCAAAG
+HWUSI-EAS1795_0092:3:1:19410:2396#0/1
hhhheghghghhhhffhhhhhbhfhghgdhhha
@HWUSI-EAS1795_0092:3:1:19557:2388#0/1
CCCCACGTACGGTATGGCGGGCAACCGCAATGA
+HWUSI-EAS1795_0092:3:1:19557:2388#0/1
gggegggefdffdeffcfff`BBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:1610:2409#0/1
AAAGAAGATGGCAAAGATGAGCACGAAAAGGAC
+HWUSI-EAS1795_0092:3:1:1610:2409#0/1
f[ggafgafffff]fgdccf_fgfgfff[faff
@HWUSI-EAS1795_0092:3:1:1907:2401#0/1
GGACAGATGATCCAGTTCTAGGCACCTTTACAC
+HWUSI-EAS1795_0092:3:1:1907:2401#0/1
ZR\\_T\aacdcfdfffffcccS_aaaffaf_f
@HWUSI-EAS1795_0092:3:1:1981:2409#0/1
GCTCGCGAGCCCACTTGACCTTGTCCTCGATGG
+HWUSI-EAS1795_0092:3:1:1981:2409#0/1
ffggggcfcaggffaffgfgfgaefffegeege
@HWUSI-EAS1795_0092:3:1:2968:2404#0/1
GGTATCATCTTGAACACCAAGAAGTAGAGGAGC
+HWUSI-EAS1795_0092:3:1:2968:2404#0/1
fagggfaffafdgagagfggfgdffffffffff
@HWUSI-EAS1795_0092:3:1:3482:2408#0/1
CCCGTATTAAATCCGCTCAGGGGGTTATCGTTT
+HWUSI-EAS1795_0092:3:1:3482:2408#0/1
fgcf]ffgggg]gggfggggggaggggfJfaf`
@HWUSI-EAS1795_0092:3:1:4209:2411#0/1
AGTCAAGCCATCTTGGGCACACCCCAACCTCTC
+HWUSI-EAS1795_0092:3:1:4209:2411#0/1
ggggggggfggfggggggggggggggdfgggfg
@HWUSI-EAS1795_0092:3:1:4394:2407#0/1
GTGGAGGTGCCCTACGTCCGTTACACGCTGCCC
+HWUSI-EAS1795_0092:3:1:4394:2407#0/1
hhhgghhhhchghhhghhfhhhheh]hhhdhhh
@HWUSI-EAS1795_0092:3:1:4856:2399#0/1
GCGGCATCGGCCAATACGTTCATACGCACCATG
+HWUSI-EAS1795_0092:3:1:4856:2399#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4907:2403#0/1
TGGAATCGGTTGAACTCGTCCCTGCTTATATCG
+HWUSI-EAS1795_0092:3:1:4907:2403#0/1
hhaM_a`cdcdchhfhghhhhhfhhhhhghggg
@HWUSI-EAS1795_0092:3:1:4934:2403#0/1
CACAACGGCTACCTGAACACGGTGACCGTCTCG
+HWUSI-EAS1795_0092:3:1:4934:2403#0/1
gdgfggggagfaa[dcedc[fe\e_Wd_^b^af
@HWUSI-EAS1795_0092:3:1:5492:2411#0/1
TTAAGCAATTAAGTACACTTTCAGTTTCCCAAA
+HWUSI-EAS1795_0092:3:1:5492:2411#0/1
hhhhhhfhhhffhghghhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:5659:2400#0/1
AACGGATCTGTTCTGCTTCAGCTTCTTAGCCAG
+HWUSI-EAS1795_0092:3:1:5659:2400#0/1
gggggfgggfgggggagggggaggdggggcggg
@HWUSI-EAS1795_0092:3:1:5829:2408#0/1
CACAAATTCAAACAAATTAAAAGTGTATTTCGT
+HWUSI-EAS1795_0092:3:1:5829:2408#0/1
hhhhhhhhhhhhhhhghhhhhhhghghhhhhhh
@HWUSI-EAS1795_0092:3:1:6108:2407#0/1
AGAAAAGAAAGCGAGATGATCACCTGAATGAAA
+HWUSI-EAS1795_0092:3:1:6108:2407#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:6151:2402#0/1
GTAAAACTAGAAATCTAACTGTAAAGATCATCG
+HWUSI-EAS1795_0092:3:1:6151:2402#0/1
^\aaa``a_a_acdc]]add_acddaa`[]d]f
@HWUSI-EAS1795_0092:3:1:6462:2400#0/1
GGATGAGTCACCCGCACATTGTTTACACACCCC
+HWUSI-EAS1795_0092:3:1:6462:2400#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:6490:2411#0/1
GAAGCAAGCAATCGGCATCAAAATCATGTAGTA
+HWUSI-EAS1795_0092:3:1:6490:2411#0/1
gggggfgegggggggggggggfgggfg[ffffg
@HWUSI-EAS1795_0092:3:1:6567:2401#0/1
TGGCGTTCTTCGAGTCCAGCGGAATCAGAGGAC
+HWUSI-EAS1795_0092:3:1:6567:2401#0/1
hhghhhhhhhhhhhhhhghghhghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:6660:2403#0/1
CTGGCATAGTAATCGGTCTTTCCTTCGCGACGC
+HWUSI-EAS1795_0092:3:1:6660:2403#0/1
hhdhhhhhghhhghhhhhhhhhhhghhhhhfhh
@HWUSI-EAS1795_0092:3:1:7093:2408#0/1
ATCTGAGTGTACTACAAAAAGTGGTCTTTTAAT
+HWUSI-EAS1795_0092:3:1:7093:2408#0/1
hhhhhhhhhhhhhhhhhhchhehhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:7657:2403#0/1
AAGACGTGCCACATGGTCAAGGGACCCACGAAC
+HWUSI-EAS1795_0092:3:1:7657:2403#0/1
cab^\abQ\^^Q__Z_a\ccccccccKQSRGZc
@HWUSI-EAS1795_0092:3:1:7693:2401#0/1
TATGTCTTGGCAAAAGCAGTGGCCAGAGCGTTT
+HWUSI-EAS1795_0092:3:1:7693:2401#0/1
effaffcfcffffffaaffffdaaddeadcada
@HWUSI-EAS1795_0092:3:1:7775:2402#0/1
CCGTGCTCTGCGCCTGGAAACCGGAAACTTCGC
+HWUSI-EAS1795_0092:3:1:7775:2402#0/1
hhhhhhhehhghhhghhchhchhhhhgehdhfh
@HWUSI-EAS1795_0092:3:1:7992:2407#0/1
GTCCATGTGATGTATGGTGGCTGTTGGTTGGGC
+HWUSI-EAS1795_0092:3:1:7992:2407#0/1
hhhhhhhhhhhhhhghhghhhhghhhghhfhhg
@HWUSI-EAS1795_0092:3:1:8024:2401#0/1
CCGCTCGATCTTTTCGTTCTCCAAAATGGCCAG
+HWUSI-EAS1795_0092:3:1:8024:2401#0/1
hhhhhghhhhhhhhhhhhghhhhhhehhhgfhh
@HWUSI-EAS1795_0092:3:1:8172:2408#0/1
GCCACGACAGCCAACAATTGAGACACATACAAT
+HWUSI-EAS1795_0092:3:1:8172:2408#0/1
gggggggggggggggggggcgagggggdgggeg
@HWUSI-EAS1795_0092:3:1:8885:2400#0/1
GCGCCAAGCAGCTGTCGGTCCGCCTCACCAACC
+HWUSI-EAS1795_0092:3:1:8885:2400#0/1
ccadcddWdcddaa^_[\Y\^^da[dafaff]d
@HWUSI-EAS1795_0092:3:1:9287:2403#0/1
TTCACTTTCCCTACTCTCATTCGGGTTGCCTGA
+HWUSI-EAS1795_0092:3:1:9287:2403#0/1
hhhhhhhhhhhhhhhhhhhhhhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9496:2405#0/1
GGAGCAGGAGTTGATCCAGTGGCAGCAGAAGGA
+HWUSI-EAS1795_0092:3:1:9496:2405#0/1
hhhhhdfhdhhhfhghhfhdghhhfhcdfecfc
@HWUSI-EAS1795_0092:3:1:9809:2405#0/1
GTCCCAAACACCAAAGATTGTGCCCGTCCAGTG
+HWUSI-EAS1795_0092:3:1:9809:2405#0/1
hhhhhhhhhhhhhhhgfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10325:2402#0/1
GTTTCTTAGAAAGTACTAAAATATAACCGTTTA
+HWUSI-EAS1795_0092:3:1:10325:2402#0/1
hhhhghghhhhfffhgghhhgghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:12619:2403#0/1
AGCTGAAGGACATTGTTGCCAAGTTCATGTCCA
+HWUSI-EAS1795_0092:3:1:12619:2403#0/1
hhhfhhhhhhhhhhhhhhhhhhfdfe`eedeeh
@HWUSI-EAS1795_0092:3:1:12834:2399#0/1
ATGGATTCCAAAATGTAGTCCCAACGTGATGAC
+HWUSI-EAS1795_0092:3:1:12834:2399#0/1
hhfhhhghhhhhhgghhfhhghhfghhhhhhhf
@HWUSI-EAS1795_0092:3:1:12915:2410#0/1
CGAGGTTGTCGTGTCCGGCAAACTGCGTGGTCA
+HWUSI-EAS1795_0092:3:1:12915:2410#0/1
hhhhhghhhhhhhhhhhhhghhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:13015:2404#0/1
CGAGGACCTTCTTCTTGGCATCCTTGCTCTTGG
+HWUSI-EAS1795_0092:3:1:13015:2404#0/1
gggfcfgg_gdggeggegfeaggggagggg_gg
@HWUSI-EAS1795_0092:3:1:13620:2404#0/1
AATTCAAGCTGCCCAAGCGTTCCCGCAAGCGCA
+HWUSI-EAS1795_0092:3:1:13620:2404#0/1
gggcggg_fdffgcgggff_affffffWaeccb
@HWUSI-EAS1795_0092:3:1:13670:2409#0/1
GCGAAGGGTTGTAAGGTTGGGCAGCCGCAATAG
+HWUSI-EAS1795_0092:3:1:13670:2409#0/1
hhhhhhhhhhghhhhhhgghhhhhhhhhhhheh
@HWUSI-EAS1795_0092:3:1:13861:2410#0/1
GTCGTTTTCGTCGTCCGTGCACACGTCCTCGAT
+HWUSI-EAS1795_0092:3:1:13861:2410#0/1
hhhghhhhhhhgfchhghghhhehhghhghhhf
@HWUSI-EAS1795_0092:3:1:14161:2399#0/1
TGTGAGCAGCTTTCACTCCTACATACCACAATG
+HWUSI-EAS1795_0092:3:1:14161:2399#0/1
hhhfhhhhhhhhhhghhhhhhhhhhghhhhfhh
@HWUSI-EAS1795_0092:3:1:14349:2402#0/1
CCAAATTGTTGTCGTGCTCCGTTTCATCCAACC
+HWUSI-EAS1795_0092:3:1:14349:2402#0/1
gggggggggggfgggefgggfefffffggffgg
@HWUSI-EAS1795_0092:3:1:14545:2410#0/1
AACTAACCACACGATCATCACCCTCTCACAGGA
+HWUSI-EAS1795_0092:3:1:14545:2410#0/1
hhhhhhhhhhhhhghhhhhhhhhghhhhhhghg
@HWUSI-EAS1795_0092:3:1:14630:2403#0/1
CTGCGCGGGAATGGAGCGGCTCGGCGTTCCGAC
+HWUSI-EAS1795_0092:3:1:14630:2403#0/1
gggdgggaaKaa_____gggdfac[cZ_ac^R_
@HWUSI-EAS1795_0092:3:1:14859:2407#0/1
ATTGTACAAAACGCTAGTGTGTTGTTTGTGTTT
+HWUSI-EAS1795_0092:3:1:14859:2407#0/1
gcggggefeffeggcggefdcfgfggggffggf
@HWUSI-EAS1795_0092:3:1:15155:2405#0/1
CATATAACAAATATAATCTGATGAGTGCTCTAA
+HWUSI-EAS1795_0092:3:1:15155:2405#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:15200:2408#0/1
GTGGGTGGTGGTGCTCCGGCCTGCTTGGCGTTG
+HWUSI-EAS1795_0092:3:1:15200:2408#0/1
ggfffcf``ffbdfffffggggggffggagggd
@HWUSI-EAS1795_0092:3:1:15391:2404#0/1
ATCGTTAAGTAGGAAAAAAAAAGAAAAACAAAA
+HWUSI-EAS1795_0092:3:1:15391:2404#0/1
hdhhhhhhhfhhhffghhhhhhffhhhhhhghh
@HWUSI-EAS1795_0092:3:1:15617:2401#0/1
CTGCAGTTACAAAAAACCAACACAAAAATGGCC
+HWUSI-EAS1795_0092:3:1:15617:2401#0/1
hhfhchhhhhhhgghhhhfffgghhhchhfhhh
@HWUSI-EAS1795_0092:3:1:15722:2405#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:15722:2405#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:15872:2401#0/1
ACGGACTTGACCTCAGTGGTGATGTTAGCAGGG
+HWUSI-EAS1795_0092:3:1:15872:2401#0/1
hhhhhhhhhhhhhhghhhhghhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:16502:2403#0/1
GGCGGTGTTTTTTTTTTTTTTTTTTTTTTTTTT
+HWUSI-EAS1795_0092:3:1:16502:2403#0/1
ffdddT`KSXVVcdddccccccccccccccccc
@HWUSI-EAS1795_0092:3:1:17090:2401#0/1
GCCTAGAGCAAGAGTTGGTCAAGATTGGCCGCG
+HWUSI-EAS1795_0092:3:1:17090:2401#0/1
hgghhhhhfhhghhhhhhahhfhhhhhhhhhdh
@HWUSI-EAS1795_0092:3:1:17119:2400#0/1
CTTTATGGTCGTTCCTGTTGCCAGGATGAGCAC
+HWUSI-EAS1795_0092:3:1:17119:2400#0/1
hfhhhhhhhhhhhhhhhhhghhhhhhdhghhhh
@HWUSI-EAS1795_0092:3:1:17749:2400#0/1
AAGCGAGATGATCACCTGAATGAAAGTAAGGGA
+HWUSI-EAS1795_0092:3:1:17749:2400#0/1
hhhhhhhhhhhhhfhhhghhdhhhffdhghhhg
@HWUSI-EAS1795_0092:3:1:17773:2400#0/1
CCCACCTCGCACAGGGAAAACAGCTCCGAGAAG
+HWUSI-EAS1795_0092:3:1:17773:2400#0/1
ff]_c_VaU^ZaVPSSSa^^\WUZUZVc]^^^V
@HWUSI-EAS1795_0092:3:1:19060:2408#0/1
CTTGTCCCGAGAGCCGGACACGATCTGACGGTT
+HWUSI-EAS1795_0092:3:1:19060:2408#0/1
ggggggggggfggggfgggfgggfgggeggggg
@HWUSI-EAS1795_0092:3:1:19322:2407#0/1
GTTTCCGATTCGACGTCAAAATGAATGCGAACC
+HWUSI-EAS1795_0092:3:1:19322:2407#0/1
fggfcgecgggagggggggfcedgfgggg_dgf
@HWUSI-EAS1795_0092:3:1:19447:2411#0/1
ATGGATTCGTGTTGAAGAAATACATGGCAGCCC
+HWUSI-EAS1795_0092:3:1:19447:2411#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhffhhhh
@HWUSI-EAS1795_0092:3:1:19730:2404#0/1
CCGGAGTAGTGATGGACACATGCTTAAGCAGGC
+HWUSI-EAS1795_0092:3:1:19730:2404#0/1
cggggggffdffgfggfcacggggggggfagfg
@HWUSI-EAS1795_0092:3:1:1427:2421#0/1
CGAGTTGTTTTGGTCTTGGTAAAATGGGAGGTC
+HWUSI-EAS1795_0092:3:1:1427:2421#0/1
cPcWfaWfdc`Q[fcfa_Xfcffff__`a\Z_f
@HWUSI-EAS1795_0092:3:1:2549:2418#0/1
CGTGACCATCTTCTTCATTCGTCGTAGCCATCG
+HWUSI-EAS1795_0092:3:1:2549:2418#0/1
hhhhghghhfhhhhhhchhhhhhhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:2606:2422#0/1
ACAACACACGCTCCAACAAGCGGCGCATTGTTC
+HWUSI-EAS1795_0092:3:1:2606:2422#0/1
ggggggcffdfdgggggfgeggcfgggggggfg
@HWUSI-EAS1795_0092:3:1:2815:2412#0/1
GTGAGAGATTAAAGACTAAGCCTCAGATATCCT
+HWUSI-EAS1795_0092:3:1:2815:2412#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhchhhhhh
@HWUSI-EAS1795_0092:3:1:3830:2416#0/1
GCATATTCTGCCATTCCACACACACACCAACAA
+HWUSI-EAS1795_0092:3:1:3830:2416#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhcacffffh
@HWUSI-EAS1795_0092:3:1:3861:2419#0/1
GTTCCACCAATCGCATTAACATACCCATAATGG
+HWUSI-EAS1795_0092:3:1:3861:2419#0/1
gggegggfggfgggggefgggfgffegfggagg
@HWUSI-EAS1795_0092:3:1:4100:2418#0/1
GCCGAAAATGCGCGACCAATTCATCAGCCTGGC
+HWUSI-EAS1795_0092:3:1:4100:2418#0/1
e_fffcfdfdffdffffgggggfe]ffffffcg
@HWUSI-EAS1795_0092:3:1:4419:2422#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4419:2422#0/1
c^cfcffff__faaa^aNQZ^\Q\Z^\acdd[f
@HWUSI-EAS1795_0092:3:1:5451:2418#0/1
TGCCCGATCTGGTCGAGAACTTCGAGGAGGTGG
+HWUSI-EAS1795_0092:3:1:5451:2418#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhfhhehf
@HWUSI-EAS1795_0092:3:1:5517:2419#0/1
CGAAATTGAGAGCACTGGCAGGGAGCCCACTAG
+HWUSI-EAS1795_0092:3:1:5517:2419#0/1
hhhhhfhhhghhchhhhhhhhhh_hhdfheeff
@HWUSI-EAS1795_0092:3:1:7195:2415#0/1
GGTTTTCAATCTTGGGAATGAGGCGCTCTGGAG
+HWUSI-EAS1795_0092:3:1:7195:2415#0/1
hhhhhhhhhhhhhhhhhhhghghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7475:2422#0/1
AACACCGCGACACGGAACCCACATTCTTCGTTT
+HWUSI-EAS1795_0092:3:1:7475:2422#0/1
ehhhhhehhhhhgghehhhhfhchhhhghfhgg
@HWUSI-EAS1795_0092:3:1:8899:2414#0/1
CAACGAAAAGGACTCGTACGAGCTGCGCTACTT
+HWUSI-EAS1795_0092:3:1:8899:2414#0/1
bacdd[adadK\aZaZ^caccaacaWWaZ\aaY
@HWUSI-EAS1795_0092:3:1:9025:2422#0/1
CAGAGTTCCGCAGCAGTTACAAAAAACCAACAC
+HWUSI-EAS1795_0092:3:1:9025:2422#0/1
hhhfghhhhhhhhhhhhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:9211:2420#0/1
CCGTTGTGTTCGAGGACGTGGGCCGCCAAGTGC
+HWUSI-EAS1795_0092:3:1:9211:2420#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhghg
@HWUSI-EAS1795_0092:3:1:9440:2418#0/1
GTCAAGACCGGTCGCCAGATGCTCGGCGCCACC
+HWUSI-EAS1795_0092:3:1:9440:2418#0/1
ggfaf]fgggdgcgggcaffffcf]edffe[fg
@HWUSI-EAS1795_0092:3:1:9504:2421#0/1
AACAAGATGGACTCCTCCGAGCCACCATACAGC
+HWUSI-EAS1795_0092:3:1:9504:2421#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9634:2418#0/1
GGACAAGAACATCTGCCTGCCGGCAGTGTTCAA
+HWUSI-EAS1795_0092:3:1:9634:2418#0/1
gggfggd]fffcfcffdfffff^a^cZcc`f_f
@HWUSI-EAS1795_0092:3:1:9882:2416#0/1
CTTGCCTCTGCCTCCAGCAGCAGCATGTCGAAG
+HWUSI-EAS1795_0092:3:1:9882:2416#0/1
hghfhhhhhhhhhhhhhhgfhhhhhgfhhhfhf
@HWUSI-EAS1795_0092:3:1:10155:2411#0/1
GCAGGACAGGTGTTGGTGTTATACTACTATTGT
+HWUSI-EAS1795_0092:3:1:10155:2411#0/1
hhhhhhhhhhehfffffehhhhhdhhchghhfh
@HWUSI-EAS1795_0092:3:1:10195:2412#0/1
CGCGTCAGTTTGGTTACGTTGTGCTCACCACCT
+HWUSI-EAS1795_0092:3:1:10195:2412#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11406:2421#0/1
ATTTACGGTGGCAAAGGAGCCTTGGGTTCGGCC
+HWUSI-EAS1795_0092:3:1:11406:2421#0/1
gggggggfggcggggggcgggggcgcgcffffg
@HWUSI-EAS1795_0092:3:1:11617:2414#0/1
TGATGATCTCAGTGCGGGAGGGGGTCACACGGA
+HWUSI-EAS1795_0092:3:1:11617:2414#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11718:2415#0/1
AAGTAAGGGATCAGGCAACCCGAATGAGAGTAG
+HWUSI-EAS1795_0092:3:1:11718:2415#0/1
hhhhhhhhfhhhhhhghhhhhfehhhghhhahh
@HWUSI-EAS1795_0092:3:1:11885:2419#0/1
CGGTCCTGTATTTGGTGTGTTAACCGAGTTGGT
+HWUSI-EAS1795_0092:3:1:11885:2419#0/1
hhhhhhhghhhghfhhhghhhdhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11936:2412#0/1
GAGAAAGATCACAACAGCAAAAGATAATACTAC
+HWUSI-EAS1795_0092:3:1:11936:2412#0/1
hghfhddhhfghhhhh]hhhghgggghhghggg
@HWUSI-EAS1795_0092:3:1:12203:2416#0/1
GCCTGCTCCACGAGCTCGCCGAAAGTGTAGCCA
+HWUSI-EAS1795_0092:3:1:12203:2416#0/1
hhhhhhhhhghhefhhhchhhghhgdhhhghhh
@HWUSI-EAS1795_0092:3:1:12247:2412#0/1
GTAGAAGTAGGCGTTCGACGGCCTAGTTGAACT
+HWUSI-EAS1795_0092:3:1:12247:2412#0/1
hhgghhhghhhhhhhhhfhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:12469:2421#0/1
TGGCCAGTCGCCGACTTGGCTAGTGATGATTTA
+HWUSI-EAS1795_0092:3:1:12469:2421#0/1
hhhhhhhhhhhhhhhhhgeeghhghhff[fffh
@HWUSI-EAS1795_0092:3:1:12577:2422#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12577:2422#0/1
hhhhhhhhhhhhhhhhhhhhhgghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12710:2421#0/1
GGGCAAAGAAGGTGCCACTCTTTGCGGCCGGAA
+HWUSI-EAS1795_0092:3:1:12710:2421#0/1
hhhfhhhhhhhhehhhhhhhghhhhhhhedh]c
@HWUSI-EAS1795_0092:3:1:12788:2418#0/1
CCGAGGGGCAGCTGGTCACCTAGCATTAACGAT
+HWUSI-EAS1795_0092:3:1:12788:2418#0/1
gggg_fgccfffffadffffdedcfcfgffggg
@HWUSI-EAS1795_0092:3:1:13431:2420#0/1
TGGTGATCTCCTCGTCGGTGTGAATGCCCACAA
+HWUSI-EAS1795_0092:3:1:13431:2420#0/1
gggfgggfggggggggggggeffffffgggggc
@HWUSI-EAS1795_0092:3:1:13564:2419#0/1
GATGAAATACCTGGAGCAGGTTGTGATGGAAAC
+HWUSI-EAS1795_0092:3:1:13564:2419#0/1
hhhhhhhhhhhhhehhhhhhhgghhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:13913:2411#0/1
CGCATGCTGGCAGAGGACGAGCTGAGGGATGCA
+HWUSI-EAS1795_0092:3:1:13913:2411#0/1
cdcfcdcfffcff]fffacfffV^Z^`ggggg]
@HWUSI-EAS1795_0092:3:1:14234:2411#0/1
GGGATAATGAAATAAGACCTCTGTTCTGCTTTC
+HWUSI-EAS1795_0092:3:1:14234:2411#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:14260:2419#0/1
GTTACAATTACGATTAGGCTGTTCGCTTTAAAA
+HWUSI-EAS1795_0092:3:1:14260:2419#0/1
hhhhhgfhhhhhhhhhhhhhghhhhghhhhhhg
@HWUSI-EAS1795_0092:3:1:14327:2411#0/1
CAATGCTTAACCTTAATCGTTGTCTCTCTCACA
+HWUSI-EAS1795_0092:3:1:14327:2411#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14380:2415#0/1
GGAGCCGCCGACTTCACCGCCCAGGTCATCGTG
+HWUSI-EAS1795_0092:3:1:14380:2415#0/1
hghhhghhhhhghhhfhghhhh_ffcfhghcgh
@HWUSI-EAS1795_0092:3:1:14465:2414#0/1
TCCACAGCCTTTTACGTTCGCATTCCATTCGGT
+HWUSI-EAS1795_0092:3:1:14465:2414#0/1
hfhhhhhhhhhhhghhhhhehhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:14583:2413#0/1
CTCGTCCCAAGATGAAGGTGTGCATCCTTGGCG
+HWUSI-EAS1795_0092:3:1:14583:2413#0/1
hhhfhhhhhhhhhhhghhhghghhghhhhhhgg
@HWUSI-EAS1795_0092:3:1:14758:2416#0/1
CGGGCACTTCCTTGTACAGCTTCTCGTAGGTGG
+HWUSI-EAS1795_0092:3:1:14758:2416#0/1
hhhhhhhhhhhhhchhhhhhhgfhhghhhghhh
@HWUSI-EAS1795_0092:3:1:15091:2412#0/1
AGTGAACCTATTGACCAGATCACAGCCGATGAA
+HWUSI-EAS1795_0092:3:1:15091:2412#0/1
hghhhhhhhhhhhhhhhfhhhhhhhhhghhghh
@HWUSI-EAS1795_0092:3:1:16578:2420#0/1
CCGCGGAGTACAAACTAAAGTTAGCAAAACTAG
+HWUSI-EAS1795_0092:3:1:16578:2420#0/1
hhhhhhhhhhhhhhhhffhhhghhchhhghhgh
@HWUSI-EAS1795_0092:3:1:16678:2413#0/1
GAGGTGGCCCGCATCGGTGACCTGATTAAGGAG
+HWUSI-EAS1795_0092:3:1:16678:2413#0/1
gffggggggggggdffgdfaffggggggcgfcg
@HWUSI-EAS1795_0092:3:1:17401:2420#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17401:2420#0/1
a[\^a\abddd^fffd_dc[dddcddS\\\_^d
@HWUSI-EAS1795_0092:3:1:17895:2422#0/1
TGGGTCTCCACCTTGGCCACCACCATGGCGCCA
+HWUSI-EAS1795_0092:3:1:17895:2422#0/1
hhhhhhhhhhhhhhhhhhhhhfhhdhhhgghhg
@HWUSI-EAS1795_0092:3:1:17936:2418#0/1
TCGTGGTGCATCTCCACGGACTTGACCTCAGTG
+HWUSI-EAS1795_0092:3:1:17936:2418#0/1
hhfhghcchhhfhghchgchhghhhgcgfghhg
@HWUSI-EAS1795_0092:3:1:18334:2412#0/1
TGTCAGAAGAAACTTTGTACATTTGCATTGAGC
+HWUSI-EAS1795_0092:3:1:18334:2412#0/1
hhhfhhhhh_hfghghghhgchhgfhhhhhfhh
@HWUSI-EAS1795_0092:3:1:18496:2415#0/1
GCGAATTTGATGTCTGTCTACTTTTTCGTGCAG
+HWUSI-EAS1795_0092:3:1:18496:2415#0/1
hhhdghhhhhgghhhhhghfhhhhhhhghhhcf
@HWUSI-EAS1795_0092:3:1:18527:2419#0/1
GGAGGCGTAGCGGGCCAGGACACCCCATCCTAC
+HWUSI-EAS1795_0092:3:1:18527:2419#0/1
hhdhhhhhhhhghhhhhgggghhhhhhhhhehh
@HWUSI-EAS1795_0092:3:1:18706:2417#0/1
GAATATCAGAGGCCTCGCCGTCCGTCCGTCCGT
+HWUSI-EAS1795_0092:3:1:18706:2417#0/1
gcggegedgfcgffcf[fffffffdfffaccd_
@HWUSI-EAS1795_0092:3:1:3678:2425#0/1
CCGCTTTTGTCAAATTCGATCGACATTCCTGCC
+HWUSI-EAS1795_0092:3:1:3678:2425#0/1
gaggggggggggggggggggafggcgddfffff
@HWUSI-EAS1795_0092:3:1:4474:2423#0/1
GTTCTCCTCCTGCCTCAACTCCACCTGCCCATC
+HWUSI-EAS1795_0092:3:1:4474:2423#0/1
gggadggggc]gfggggggfgggggfgggggeg
@HWUSI-EAS1795_0092:3:1:4630:2428#0/1
AAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGC
+HWUSI-EAS1795_0092:3:1:4630:2428#0/1
ff\fafafYffdadfafaff_f_fcdfd`]fcg
@HWUSI-EAS1795_0092:3:1:5101:2432#0/1
CGCGGATCTTCAGACGCTCGGAGACCACCGATG
+HWUSI-EAS1795_0092:3:1:5101:2432#0/1
ggfggagggggggggedffffcggggcfcfeff
@HWUSI-EAS1795_0092:3:1:5269:2434#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:5269:2434#0/1
hhhghhhhhhhhhhdhhhhhhfhhhhhfhhhch
@HWUSI-EAS1795_0092:3:1:5349:2431#0/1
GTTTGGAGTGCAGCACAACAAAATCAACAACAA
+HWUSI-EAS1795_0092:3:1:5349:2431#0/1
gfgggggggggggfggggggggggfgggggggg
@HWUSI-EAS1795_0092:3:1:5503:2434#0/1
AACCAGTCCGCGAGCAGCAAAATGTCGAAGAGA
+HWUSI-EAS1795_0092:3:1:5503:2434#0/1
hhhhhhhhhhhhhhhhhhhhhghhfghefhhhg
@HWUSI-EAS1795_0092:3:1:5677:2424#0/1
TGAAATTGAAAATCTAGCTGCCTTTACACACAC
+HWUSI-EAS1795_0092:3:1:5677:2424#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:6185:2432#0/1
GCACACTGGGAAAACACTTGCATTTATGCATCC
+HWUSI-EAS1795_0092:3:1:6185:2432#0/1
hhhhhhhhhhhfhhhhhhhhhhhhhhghhghhh
@HWUSI-EAS1795_0092:3:1:6632:2425#0/1
CTCGATAATGACGCGACCGGCCTTGATGGGGGT
+HWUSI-EAS1795_0092:3:1:6632:2425#0/1
ggggfgffffffgggfgggdgfgggafffffc^
@HWUSI-EAS1795_0092:3:1:7274:2426#0/1
GGCCAGAATGCCTACAAGGTGGCCAAGGGCGCA
+HWUSI-EAS1795_0092:3:1:7274:2426#0/1
hhhhhhhhhhhhhhhhhfhdhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:7316:2425#0/1
GGGAGCTTGCTCCCAACTCGTATCTAATGCTTA
+HWUSI-EAS1795_0092:3:1:7316:2425#0/1
hhhhhhhhhhhhhhhhhhhghhghhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:7392:2432#0/1
GGAAAAGTCAGGGACAAGCTGAACAACCAGGTG
+HWUSI-EAS1795_0092:3:1:7392:2432#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:7959:2431#0/1
CGAGAATCTCCTTTGGCGCCAAAAATGACCACA
+HWUSI-EAS1795_0092:3:1:7959:2431#0/1
hhhghhhhghhhhhhghhhhhhhhhhgghgdhh
@HWUSI-EAS1795_0092:3:1:8223:2430#0/1
CTTCTCGTCTTTTAAATAAATTTTAGCTTTTTG
+HWUSI-EAS1795_0092:3:1:8223:2430#0/1
aabeddbbddfdcccdffcccffcdfffacf_d
@HWUSI-EAS1795_0092:3:1:8478:2433#0/1
GGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAA
+HWUSI-EAS1795_0092:3:1:8478:2433#0/1
dcefcccbceddfdd[fa_da[afffffaffe^
@HWUSI-EAS1795_0092:3:1:8706:2428#0/1
TTTGTTCTCATTGTCGTTCGTTGTTGATGTTCT
+HWUSI-EAS1795_0092:3:1:8706:2428#0/1
hhhhhhhhhhhhfhhhhhhhhhghhhdgghhhh
@HWUSI-EAS1795_0092:3:1:9265:2426#0/1
CAACTCTCTTGCTTTTGAGCGTTCTTGTTGCGG
+HWUSI-EAS1795_0092:3:1:9265:2426#0/1
dffcfdffafaafffdaaeedffdff]ffS]a_
@HWUSI-EAS1795_0092:3:1:9368:2429#0/1
TGCATTTTAAGCACTCGCCCGTAGTCCGGTTGC
+HWUSI-EAS1795_0092:3:1:9368:2429#0/1
gggggggggggggggggggggfgfggggggggg
@HWUSI-EAS1795_0092:3:1:9685:2426#0/1
GGTAGACGATGTAGGCTGCGCCTGTTGTTGCTG
+HWUSI-EAS1795_0092:3:1:9685:2426#0/1
ggggggggfgfggeggfcffffdaffdgggffa
@HWUSI-EAS1795_0092:3:1:10237:2425#0/1
CTCTGGCTTAACTATGGCCGCCTTGGGCACAAT
+HWUSI-EAS1795_0092:3:1:10237:2425#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:10647:2431#0/1
GTACCGTTGTGGTCTTCGCCCCTGCTAACATCA
+HWUSI-EAS1795_0092:3:1:10647:2431#0/1
gggggggfagggfgcggggggggggfeeffffg
@HWUSI-EAS1795_0092:3:1:10676:2429#0/1
TTGGCATTAGGTTCAGTGGGAGCTGGTTGTTGT
+HWUSI-EAS1795_0092:3:1:10676:2429#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:11190:2429#0/1
CGCCAATTGGGTAGTTGGTAATACCCTCGCCGC
+HWUSI-EAS1795_0092:3:1:11190:2429#0/1
hhhhhhhhhhhhhhhhhhghhfhhhhRfcfffh
@HWUSI-EAS1795_0092:3:1:11224:2432#0/1
CTGCTGTCGTCGGATGGCGTGCTCACCGTCAGT
+HWUSI-EAS1795_0092:3:1:11224:2432#0/1
gegggegggggggeggggggadW_^acgffagc
@HWUSI-EAS1795_0092:3:1:11317:2428#0/1
AAAAAACCTGTTCGCAGTCACCGCAAAAATTAG
+HWUSI-EAS1795_0092:3:1:11317:2428#0/1
hghhhghhhhhghhhhhhghhhghhhhhhhggh
@HWUSI-EAS1795_0092:3:1:12113:2428#0/1
CGGCAGCGGAGATGTGGTCAGTGGTGCACTTTC
+HWUSI-EAS1795_0092:3:1:12113:2428#0/1
hhfhhhhhhhghgeeghfghhhfhdhhgghhfh
@HWUSI-EAS1795_0092:3:1:12363:2433#0/1
GGTCACTACCTGGGCGAGTTCGCCCTGACCTAC
+HWUSI-EAS1795_0092:3:1:12363:2433#0/1
hhhhhhhhhh[ffffffhhhhfhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:12438:2431#0/1
CAGCTGGACTTGAAACCCATTCCCGCCGAGGAT
+HWUSI-EAS1795_0092:3:1:12438:2431#0/1
hhhhhfhhhhhhhhhhhhdhhhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:12822:2433#0/1
CGAGCGTTCCGGCTACATCCGCGGAGTTGTCAA
+HWUSI-EAS1795_0092:3:1:12822:2433#0/1
gggggcgggggcf_fafgggaafggggafddfg
@HWUSI-EAS1795_0092:3:1:12848:2433#0/1
GCACGGTTCCGGGGGTCAGGTTGCGGCGCGTGT
+HWUSI-EAS1795_0092:3:1:12848:2433#0/1
hhhhhhhhhhhhfhhhhhhhhhchfhhghhghh
@HWUSI-EAS1795_0092:3:1:13091:2431#0/1
GAGCAGCGGTACTCCGTTTCGCAAACAGTTCAA
+HWUSI-EAS1795_0092:3:1:13091:2431#0/1
hhhhhhhggghhhhhgghhgghhhhhhhhfhhg
@HWUSI-EAS1795_0092:3:1:13183:2424#0/1
AAAACGATGATGATAATGATGATGGTGTGCAGG
+HWUSI-EAS1795_0092:3:1:13183:2424#0/1
hhhhhhhhhfhhchhhhhhhhdfhghghhgahh
@HWUSI-EAS1795_0092:3:1:13665:2433#0/1
AAAAGTACAAGTAAGTGTAACTAGCGCCAAAGA
+HWUSI-EAS1795_0092:3:1:13665:2433#0/1
gggcgggggggggggdgfffffgggggaggcgg
@HWUSI-EAS1795_0092:3:1:15393:2428#0/1
CCCGCATGAAGCTCGATTACGTGCTGGGTCTGA
+HWUSI-EAS1795_0092:3:1:15393:2428#0/1
hhhhhghhghhhhhhfhhhhhghhfghhhhhhh
@HWUSI-EAS1795_0092:3:1:15554:2430#0/1
GGTAGAGCGGCACTTGCCACGCTTGACTTGCAG
+HWUSI-EAS1795_0092:3:1:15554:2430#0/1
hhhghghhhhhhhhghhhhhghhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:15972:2434#0/1
CACGGACAATAACCTTTTGATACCTTAAGATCA
+HWUSI-EAS1795_0092:3:1:15972:2434#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:16031:2432#0/1
CGGGGATTCTCGATGAGGCGTCGCGTTTTGGGA
+HWUSI-EAS1795_0092:3:1:16031:2432#0/1
gdgggcg^ffffffacda\a`BBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:16670:2433#0/1
CGTAGGTCACCAGAGGGAAGTGAATACGTGGGT
+HWUSI-EAS1795_0092:3:1:16670:2433#0/1
hhhghhhhfhhhhhghhgfhdgfa_caYU[_BB
@HWUSI-EAS1795_0092:3:1:17037:2424#0/1
CTGGCTCTTTCTTTTTATTGCTTCTTGGTTGCG
+HWUSI-EAS1795_0092:3:1:17037:2424#0/1
ghfhhhghghhhhhhh`hhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17615:2431#0/1
CCAAGAGCATGAATTTTCTGCGGCAATCCTTTG
+HWUSI-EAS1795_0092:3:1:17615:2431#0/1
hhhhghhhghhhhhghhhhchghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:17851:2424#0/1
CAGCCACTATTCAAAATAGAACTCGAACCAGAG
+HWUSI-EAS1795_0092:3:1:17851:2424#0/1
dacfca_da^ca^Z]V`ZV^]bBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:17955:2431#0/1
CTCGGGAAGACCGTCTGGCATAGGTAGGGCTTT
+HWUSI-EAS1795_0092:3:1:17955:2431#0/1
ggggggcggggggegged[bdbcddegfff_fg
@HWUSI-EAS1795_0092:3:1:18682:2427#0/1
GTTTGCATGGTGGAGGCTGATGTCAACGAAGGA
+HWUSI-EAS1795_0092:3:1:18682:2427#0/1
hhghhhghhhhhffhhhhhfhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18983:2427#0/1
TTTTCGTTAAGACCCTCACTGGCAAGACCATCA
+HWUSI-EAS1795_0092:3:1:18983:2427#0/1
hhghhhhhghghhhhhhhhfhhghhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:19295:2428#0/1
CGTGTTCGGAGTGGCTCACATCTACGCCAGCTT
+HWUSI-EAS1795_0092:3:1:19295:2428#0/1
ddc^dddfffffffcfffffdS\W_`_ff\fff
@HWUSI-EAS1795_0092:3:1:19616:2423#0/1
CGACCTGATCAACGGTGCAAAGAACCAGAACTT
+HWUSI-EAS1795_0092:3:1:19616:2423#0/1
ggfgggfgggeggggggfgggagggf][fffdg
@HWUSI-EAS1795_0092:3:1:1475:2437#0/1
CGAGAAGTACCAGAATGAGTACATCAAGGCGGA
+HWUSI-EAS1795_0092:3:1:1475:2437#0/1
fgffffecead\Zaaa`e^cdcccdedfffffg
@HWUSI-EAS1795_0092:3:1:1543:2441#0/1
CGTGAGGATGACAACTGCGTACGAAAGATATTG
+HWUSI-EAS1795_0092:3:1:1543:2441#0/1
\\^aZa\ac^c[\aaZaW\]\Za^^aafdffdf
@HWUSI-EAS1795_0092:3:1:1659:2445#0/1
ATTTATTTGTGTCTTAAACTAAGAGGATTAAAG
+HWUSI-EAS1795_0092:3:1:1659:2445#0/1
ffeffdbccfefffdffffffdffffffffffc
@HWUSI-EAS1795_0092:3:1:1963:2438#0/1
CAAGAACATGATCACTGGTACCTCGCAGGCCGA
+HWUSI-EAS1795_0092:3:1:1963:2438#0/1
cegfgffdgggff_fcffgggagfcacf]cW[]
@HWUSI-EAS1795_0092:3:1:2841:2442#0/1
GGCCAGAAGGTCACTTGGATTGTGCCGCATTAC
+HWUSI-EAS1795_0092:3:1:2841:2442#0/1
gffffcdfffffcSccccfdfcfffdfgggcga
@HWUSI-EAS1795_0092:3:1:3341:2445#0/1
CTGCGTGTTGTTGTTGTTGTTGAGTGGAAGCAA
+HWUSI-EAS1795_0092:3:1:3341:2445#0/1
gggggggggcgggfgcgfffffdggggfggcfg
@HWUSI-EAS1795_0092:3:1:3530:2443#0/1
CTGATCAGGCCGTTATTTAAGTTTTATTATGAA
+HWUSI-EAS1795_0092:3:1:3530:2443#0/1
hhhhhhhhhhhhhhghhhfhhhhhhfhhghhhh
@HWUSI-EAS1795_0092:3:1:3673:2445#0/1
GGCGAATTAGGTGTGTATTTTCATTTGTTTATA
+HWUSI-EAS1795_0092:3:1:3673:2445#0/1
ggegfgffcffcefeadffffcgggccfffffg
@HWUSI-EAS1795_0092:3:1:3754:2437#0/1
CAGAAGACCGCCTGGCACTTCGAGAAGAAGTAC
+HWUSI-EAS1795_0092:3:1:3754:2437#0/1
gggfgggggcggeggggggggggggdggggggf
@HWUSI-EAS1795_0092:3:1:3842:2444#0/1
TCGCTTCTCCCACACGCGCCCATTATGGTCGAT
+HWUSI-EAS1795_0092:3:1:3842:2444#0/1
hhhhhhhhhhhhghhhghhhhhhhhgffhghfh
@HWUSI-EAS1795_0092:3:1:4213:2438#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:4213:2438#0/1
hhhWehghhhhhhhhhghgghhhhhhfhhhhag
@HWUSI-EAS1795_0092:3:1:4782:2438#0/1
CCGGCACTCGTGGGACACAATCCCTTGTTCGAG
+HWUSI-EAS1795_0092:3:1:4782:2438#0/1
hghfhhhhhhhhfhfhghhhhhhhhhhhhhfdh
@HWUSI-EAS1795_0092:3:1:6651:2440#0/1
GCCCGGTCTGCTGCCTGAGGCGCCTGGCAACGG
+HWUSI-EAS1795_0092:3:1:6651:2440#0/1
ggggg_gggdegggggfaffffggggggegggg
@HWUSI-EAS1795_0092:3:1:6724:2435#0/1
TAAAAGTGTGTCAGCTCTACTCGGGGGAAAGTA
+HWUSI-EAS1795_0092:3:1:6724:2435#0/1
hhhhhhhhghhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6755:2436#0/1
CCGCGAATGTGTGTGTGTAAGCTTGTGGGTGTG
+HWUSI-EAS1795_0092:3:1:6755:2436#0/1
hhhhhhhhhhhhhhghfhhhhhhhhhhhfghhf
@HWUSI-EAS1795_0092:3:1:6930:2435#0/1
CCTCACGAGTGCGTTCATCAACTCCCGCGAAAA
+HWUSI-EAS1795_0092:3:1:6930:2435#0/1
hhghhhhhghhhghhhhWffffhhhhhhghfhh
@HWUSI-EAS1795_0092:3:1:7059:2441#0/1
CGCAGGCGCAGGTGCGGGTGCGGGGAATGATCC
+HWUSI-EAS1795_0092:3:1:7059:2441#0/1
hhhghhhhhhhhhhhhhhehfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7116:2435#0/1
GCGGCAGCTGGGGCTGTCTCGCCCCCCGGGGGA
+HWUSI-EAS1795_0092:3:1:7116:2435#0/1
ccccccccacccc^_BBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:7356:2445#0/1
AGGACATCAAGATAAAGAAGAACTTAAAGAAGA
+HWUSI-EAS1795_0092:3:1:7356:2445#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:7605:2438#0/1
CAAGGACATCAAGATAAAGAAGAACTTAAAGAA
+HWUSI-EAS1795_0092:3:1:7605:2438#0/1
hhhhhhhhhhhhgghhhhghhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:7714:2434#0/1
GGGCGATGATCGTAGCAAGGAGTGACGTAGCTC
+HWUSI-EAS1795_0092:3:1:7714:2434#0/1
hhhhhhhhghhhgdhghdedddI``^`^c_c^f
@HWUSI-EAS1795_0092:3:1:8076:2441#0/1
TAAAAATTGCACGCAAAATAAGTGGCAAGCAAC
+HWUSI-EAS1795_0092:3:1:8076:2441#0/1
c^ff_fdffc\dfcfffffcfZfcffcdd_f[f
@HWUSI-EAS1795_0092:3:1:8546:2438#0/1
TAAATATCCATTTCCGTGGCCGGGTGAAGATGT
+HWUSI-EAS1795_0092:3:1:8546:2438#0/1
hhhhhhhhhhhhhhhhhhhhhhhhfhhhhchhg
@HWUSI-EAS1795_0092:3:1:8619:2442#0/1
GCCGCACCCATTTATGAACTGAGCGAACGCAAT
+HWUSI-EAS1795_0092:3:1:8619:2442#0/1
hhhhhhhhhhhhhhhhhhhhhfhghhhhghhhh
@HWUSI-EAS1795_0092:3:1:9071:2435#0/1
GATTACTAGGGTGGACTTGGTGCCTGCCTTCCA
+HWUSI-EAS1795_0092:3:1:9071:2435#0/1
fagggfggggggdffffg[ggdgggfggggfgf
@HWUSI-EAS1795_0092:3:1:9308:2445#0/1
TGCAAGTGCAGCGGATGCCCGAGGATTCCGAGT
+HWUSI-EAS1795_0092:3:1:9308:2445#0/1
ffffcfeccfffadb[a]bb]`\YT\Y`d`]be
@HWUSI-EAS1795_0092:3:1:9421:2437#0/1
CAGCCGGTGCGGTGCCCACTCAGTTCCGTTCGG
+HWUSI-EAS1795_0092:3:1:9421:2437#0/1
hhhhhhhhhhhhhdhhhhhehhhhfhhhhfhhh
@HWUSI-EAS1795_0092:3:1:9582:2435#0/1
CGTCGCCGCACGTACCGTGCCCATGGTCGCATC
+HWUSI-EAS1795_0092:3:1:9582:2435#0/1
ggggcggffdffggggagfgggggggdgggggg
@HWUSI-EAS1795_0092:3:1:10012:2438#0/1
TGAAGTTTTATATATATACAGATCCATGAGTAT
+HWUSI-EAS1795_0092:3:1:10012:2438#0/1
hhhfhhghhghhhhhhhhhhfhhghghhhgghh
@HWUSI-EAS1795_0092:3:1:10108:2438#0/1
CGCGTGCAGCCCAGGACATCTAAGGGCATCACA
+HWUSI-EAS1795_0092:3:1:10108:2438#0/1
dfaafffaffffffccfWda`dbbbdff_aacf
@HWUSI-EAS1795_0092:3:1:10248:2443#0/1
TAAACATTCTGGATTGATTTGCAAACACAAAGT
+HWUSI-EAS1795_0092:3:1:10248:2443#0/1
XZZZ___ad[a_QJS]PVZW]Z``bZ`a\a^WU
@HWUSI-EAS1795_0092:3:1:10825:2445#0/1
GCCTTTTAAACTAGAATTTCTGGCGAATGCAGT
+HWUSI-EAS1795_0092:3:1:10825:2445#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11672:2445#0/1
CGCCGTTGGTGTAATAGTAAACAAACGCGTAAG
+HWUSI-EAS1795_0092:3:1:11672:2445#0/1
hhghhhhhhfhhhhhfhhhhhhhhhhhdhhhhh
@HWUSI-EAS1795_0092:3:1:11700:2446#0/1
ATAAACCCCAGACCCCTAACCACGTTCTTTTAG
+HWUSI-EAS1795_0092:3:1:11700:2446#0/1
hhhhhhhhhhhhhhhhhhhhhfhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13155:2442#0/1
TGTGGATCTGCCCGGGGGTGTCCTCCTCCAGCT
+HWUSI-EAS1795_0092:3:1:13155:2442#0/1
hhhhhhhghghhhhhhhhghhhhhhhhhhhfhe
@HWUSI-EAS1795_0092:3:1:13323:2437#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13323:2437#0/1
hhghhhhhghgfehhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13626:2445#0/1
AATCCAACACGATGAATCGCTACAAGCTATCCT
+HWUSI-EAS1795_0092:3:1:13626:2445#0/1
c\cdd^efdfc_ceeeccacaa^a]bY]`Zaba
@HWUSI-EAS1795_0092:3:1:13979:2441#0/1
AAGCCAACGCACGTTGAAGATCGCGCGTTCTTC
+HWUSI-EAS1795_0092:3:1:13979:2441#0/1
hhhhhhhhhhhhhhhhhhhfhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:14336:2442#0/1
CGCGGCTGCTGGCACCAGACTTGCCCTCCAATT
+HWUSI-EAS1795_0092:3:1:14336:2442#0/1
hhhhhhhhc_hhfdhhfcgeghhhhhghhehgh
@HWUSI-EAS1795_0092:3:1:14856:2442#0/1
GCTGTTGCTGGCATTGTTTCCCTTAGCCGAACC
+HWUSI-EAS1795_0092:3:1:14856:2442#0/1
fc_fffffgggggggcggggggggggfgggggg
@HWUSI-EAS1795_0092:3:1:15167:2441#0/1
GTTCAATCGAGCAGTTTGTGGCAGCAACCCAAT
+HWUSI-EAS1795_0092:3:1:15167:2441#0/1
hhhhhhhhhhhhhhhhhghhhhhhgce`edWba
@HWUSI-EAS1795_0092:3:1:15304:2436#0/1
CGATGAAGTGCATATTCGTTTTCAAGCTTGACT
+HWUSI-EAS1795_0092:3:1:15304:2436#0/1
hhhhhhhhhhhhhhhhghhhhhhhghghghhhh
@HWUSI-EAS1795_0092:3:1:15620:2443#0/1
GAAAGTTGTGTTTTTCGTACATTTTGCCAATTC
+HWUSI-EAS1795_0092:3:1:15620:2443#0/1
hhhhhhhhhhhhhhhhhhhhfhhhgghhhghhh
@HWUSI-EAS1795_0092:3:1:16334:2442#0/1
CGATTGCCAAGTCTTTACACTGGGTTTCCTTGG
+HWUSI-EAS1795_0092:3:1:16334:2442#0/1
ggggggggggggggggdgfgggggggggggggg
@HWUSI-EAS1795_0092:3:1:17018:2437#0/1
CCTCGCATGAATTCCACTCTCAATGAAGATGGC
+HWUSI-EAS1795_0092:3:1:17018:2437#0/1
ecafc_cf]_fffaff[fc_fffff_cfdafcd
@HWUSI-EAS1795_0092:3:1:17079:2446#0/1
CATGAACAGGGTGAGGAAGAGGTGGTAGAACAG
+HWUSI-EAS1795_0092:3:1:17079:2446#0/1
hhhhghhfhfheffffffffffchfhchhhhch
@HWUSI-EAS1795_0092:3:1:17567:2440#0/1
TAAAAGTCTCCACCATCGGACCGGACCGGCTTC
+HWUSI-EAS1795_0092:3:1:17567:2440#0/1
gggfggggfggfgggagfa[ffdf_fcgfaggg
@HWUSI-EAS1795_0092:3:1:17691:2442#0/1
CGGCTGTGCTCCCTTGTGTTGTTGTTTATGACC
+HWUSI-EAS1795_0092:3:1:17691:2442#0/1
ggdcfffgfagggggdggggcgffffecggggg
@HWUSI-EAS1795_0092:3:1:18354:2441#0/1
ATTTTTCGAAATGGTTACACCGCTTTTGTCAAA
+HWUSI-EAS1795_0092:3:1:18354:2441#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19537:2443#0/1
TCACCATCGATATCGCCCTGTGGAAGTTCGAAA
+HWUSI-EAS1795_0092:3:1:19537:2443#0/1
hhhhhhhhhhgfhhhhhhhghghheghehhhhg
@HWUSI-EAS1795_0092:3:1:1863:2456#0/1
CCAACAGCATATTGAATCCCTTCTCAATATCCT
+HWUSI-EAS1795_0092:3:1:1863:2456#0/1
hhfhhghghhhhhghhhhhhhhhhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:2293:2457#0/1
GTTAGTGGGCACCAGGGATAATATGGCCACAAG
+HWUSI-EAS1795_0092:3:1:2293:2457#0/1
ggggg]fggffgfffffeffffgagggggggcf
@HWUSI-EAS1795_0092:3:1:2314:2448#0/1
CGTAACTCTATTTCTATTAGTGATTTTGTAATG
+HWUSI-EAS1795_0092:3:1:2314:2448#0/1
ggggcfggggdgfdfffffcdfacfffggg^gg
@HWUSI-EAS1795_0092:3:1:2531:2448#0/1
AAAAATGGGCGATACTGCTTTTGTATTAAATCA
+HWUSI-EAS1795_0092:3:1:2531:2448#0/1
cccde[cfcffaafdcbadeae_ffafffafff
@HWUSI-EAS1795_0092:3:1:2926:2449#0/1
GCGCTTTCCTCATCGAAGAGCAGAAGATCGTCA
+HWUSI-EAS1795_0092:3:1:2926:2449#0/1
c_ffdffcdddcdbca]c^Qa^^QZa^BBBBBB
@HWUSI-EAS1795_0092:3:1:3108:2456#0/1
GAACGGCACATTTCCCAAGAGCTGCCGTTCATG
+HWUSI-EAS1795_0092:3:1:3108:2456#0/1
Ycfaffcffd_fgcggcd]af]fccfadcfWaa
@HWUSI-EAS1795_0092:3:1:3131:2447#0/1
TTCCTGTAGTTTTTCGCTTTCACAATTCTCAAA
+HWUSI-EAS1795_0092:3:1:3131:2447#0/1
hhhhhhhhhhhhhhhhghhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3494:2454#0/1
TGGTGTTATACTACTATTGTGTTCGCTGCTGCT
+HWUSI-EAS1795_0092:3:1:3494:2454#0/1
fcfff^_a_aa_`]`Y]fbfdfffc_ff^[cff
@HWUSI-EAS1795_0092:3:1:4047:2450#0/1
CGGAGCGGGCTAAGAAGCGCACCGTGGGCAATC
+HWUSI-EAS1795_0092:3:1:4047:2450#0/1
gffdfdfdfafc_aedegggggggggaffffff
@HWUSI-EAS1795_0092:3:1:4502:2448#0/1
GTACTTACATGAATTGGGCGATCCCGAGGCCAG
+HWUSI-EAS1795_0092:3:1:4502:2448#0/1
cfeffhdhhhhfhehghhfhfhhhhhhghfghh
@HWUSI-EAS1795_0092:3:1:5119:2450#0/1
ATGAAGGACATCCTTGGCCGCTTCAAGGAGCTG
+HWUSI-EAS1795_0092:3:1:5119:2450#0/1
hhhhfhhhhhhhhhhhhhhhhhghhhhhghggg
@HWUSI-EAS1795_0092:3:1:5348:2454#0/1
GAAGAAATAAAAAGGTGGCCTGACGGCTGCACC
+HWUSI-EAS1795_0092:3:1:5348:2454#0/1
hhhhhgehghhhhhhhhhhhhhhhhhehgfhhg
@HWUSI-EAS1795_0092:3:1:5370:2452#0/1
CGACGGCCTTCTTGCTGCCGAACTCGATCTCGC
+HWUSI-EAS1795_0092:3:1:5370:2452#0/1
ffafff_dafffddaddRddddVZ`^Ra^a[aB
@HWUSI-EAS1795_0092:3:1:6249:2450#0/1
CTCCGATCCAATGCCATGCACGTATCGCTTTCC
+HWUSI-EAS1795_0092:3:1:6249:2450#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhgghegh
@HWUSI-EAS1795_0092:3:1:6891:2447#0/1
CCATCAATCACATGCGCTACAAGGGTGCTGGAT
+HWUSI-EAS1795_0092:3:1:6891:2447#0/1
cgfgggggfgagggcfcafffdggagfffffaa
@HWUSI-EAS1795_0092:3:1:7099:2447#0/1
CGTAATATTTCCCAATACACTGTGGGCGTGTGC
+HWUSI-EAS1795_0092:3:1:7099:2447#0/1
X\a]_a^cdaaa_a^\[dd^cc\^_]]_\_Z]d
@HWUSI-EAS1795_0092:3:1:7446:2448#0/1
GTCGGTGTCGCCGGATGTGTTGATGGGCTCCTC
+HWUSI-EAS1795_0092:3:1:7446:2448#0/1
gggggfggggggggfcef_ffccafffaggggf
@HWUSI-EAS1795_0092:3:1:7550:2454#0/1
AGGACGTCTAGGGAAAATTACGTCGAGAAATAT
+HWUSI-EAS1795_0092:3:1:7550:2454#0/1
affffffggggggfggggfgggeff_fac[ccg
@HWUSI-EAS1795_0092:3:1:7810:2448#0/1
CCCAGAAGTACAACTGCGACAAGATGATCTGCC
+HWUSI-EAS1795_0092:3:1:7810:2448#0/1
\\__]dbcfeeffcffffffefY_a^^ffffaf
@HWUSI-EAS1795_0092:3:1:8442:2451#0/1
AAAGAAATCGCTAACGAATTTAATTTGTTTAAT
+HWUSI-EAS1795_0092:3:1:8442:2451#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:9401:2451#0/1
CTGTGCAACACACTTGCGAGGCGAGAAAGCAGC
+HWUSI-EAS1795_0092:3:1:9401:2451#0/1
hhhhhhhhhhhhhghghhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:9519:2458#0/1
TTCATCTCCAGCAGGGCCAACGGACGTCCCAAC
+HWUSI-EAS1795_0092:3:1:9519:2458#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9770:2450#0/1
CACTGGATCAACTCCTGCTCCACACCCTTGAGC
+HWUSI-EAS1795_0092:3:1:9770:2450#0/1
hhhhhhhhhhhhhhhhfhhhhehhhhhhhhhgf
@HWUSI-EAS1795_0092:3:1:10274:2456#0/1
ATCGGCTACAACCCAGCCGCCGTTGCCTTCGTG
+HWUSI-EAS1795_0092:3:1:10274:2456#0/1
cccaccccWccacc[WaBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:10543:2448#0/1
CGGCATTGTCCTCAAAGTATATAAACACCCCGT
+HWUSI-EAS1795_0092:3:1:10543:2448#0/1
hhhfhhhhhhhhhhhhdgghcfhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:10636:2457#0/1
CTATCGATATGAAATTGATTTTTAAAAAGAACT
+HWUSI-EAS1795_0092:3:1:10636:2457#0/1
hhhhhhhhhhhhhfhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11544:2453#0/1
CTGAGGTACAAGCTTACCGGAGGACTGGCCGTC
+HWUSI-EAS1795_0092:3:1:11544:2453#0/1
hhhhhhhhhhhhhhghhhhhhdhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:11587:2453#0/1
CAACCACTTACAACACCTTGCCTGTTACAAAAG
+HWUSI-EAS1795_0092:3:1:11587:2453#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12002:2456#0/1
GTGGCAAGGTGGCCGTGGTCCGCTGCGAGGAGC
+HWUSI-EAS1795_0092:3:1:12002:2456#0/1
ggggfggffdfdffffffgggdc`fffaff]fe
@HWUSI-EAS1795_0092:3:1:12092:2455#0/1
CGGGTCGAGAAATCTCCAAGCTGGGCGTGTCCT
+HWUSI-EAS1795_0092:3:1:12092:2455#0/1
ggfgfggcggggggggggagggfggggggfggc
@HWUSI-EAS1795_0092:3:1:12256:2456#0/1
CAGCATCTTCTCTTCCATCGCTTCCTTGCGTTC
+HWUSI-EAS1795_0092:3:1:12256:2456#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12301:2447#0/1
CCCAATCAGAATCCACATAACCAATAATTTTAT
+HWUSI-EAS1795_0092:3:1:12301:2447#0/1
hhhhghhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12833:2454#0/1
CTCCACCAGCGCACAGACGAACTGAGCGAAAGT
+HWUSI-EAS1795_0092:3:1:12833:2454#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:13400:2453#0/1
CTTGAACTGCAAGCGCTGCAGCCATTTGAGCAG
+HWUSI-EAS1795_0092:3:1:13400:2453#0/1
hhhhhhhhhhhhehhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:13769:2455#0/1
GCTCGGTTGAATTGTCGGAACCATGGTGAACGG
+HWUSI-EAS1795_0092:3:1:13769:2455#0/1
hhhhhhhhhWhhhhhhhhhhhghhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:14425:2456#0/1
GCGACTTCTTGATGGATTTCGCATCGATGAGGG
+HWUSI-EAS1795_0092:3:1:14425:2456#0/1
hhghhghhghhhhghhhhhhghhgghhhghhhc
@HWUSI-EAS1795_0092:3:1:14628:2452#0/1
GCAAGTGCTACGCCCGTCTGCATCCTCGTGCCA
+HWUSI-EAS1795_0092:3:1:14628:2452#0/1
gggegfggcggfggggfgggggggggegggggg
@HWUSI-EAS1795_0092:3:1:15597:2448#0/1
CAAATCTTTCTTGGCTAATGAAAGCATTGTAAA
+HWUSI-EAS1795_0092:3:1:15597:2448#0/1
hghfhhhghhhhghhhhhhfhhhgfhghhhhhh
@HWUSI-EAS1795_0092:3:1:15784:2455#0/1
TGACAGACTAATTGAATTGGAAGATACAGATAA
+HWUSI-EAS1795_0092:3:1:15784:2455#0/1
__^___\cc^\cccccadcaddddf_fff[[cV
@HWUSI-EAS1795_0092:3:1:15888:2453#0/1
CTAACAACTACAAACCTCTAACAAAAAGGTTAG
+HWUSI-EAS1795_0092:3:1:15888:2453#0/1
hhhhhhhhhhhhhhhhhhhghhhghhhhghhhh
@HWUSI-EAS1795_0092:3:1:17008:2453#0/1
ATGCTTTACGAACAGATTGCGCATGGTCCGCTC
+HWUSI-EAS1795_0092:3:1:17008:2453#0/1
gggcegggdgagggggggggg_fffffggggfg
@HWUSI-EAS1795_0092:3:1:17030:2451#0/1
CCGGTCTTAAACAAAACACATAGGAGCTGCCGG
+HWUSI-EAS1795_0092:3:1:17030:2451#0/1
hhhhhhhhfhhhhhhhhhhhghchdghhghhhf
@HWUSI-EAS1795_0092:3:1:17101:2452#0/1
GGCTGGTATGTTCGATCAGAAGTCAACGGGTAG
+HWUSI-EAS1795_0092:3:1:17101:2452#0/1
ggggggggfcggggfffgeggeggggggggcgg
@HWUSI-EAS1795_0092:3:1:17722:2450#0/1
AGGATATCAATTGAAAGCGGATGGAAAATGTTA
+HWUSI-EAS1795_0092:3:1:17722:2450#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhhhfhhhgh
@HWUSI-EAS1795_0092:3:1:18491:2458#0/1
TGTAGCTCATATATATAAGACTAGAGTAAGCTT
+HWUSI-EAS1795_0092:3:1:18491:2458#0/1
hghhhhhhghghhhhhhhhhhhhhhhfhhghhh
@HWUSI-EAS1795_0092:3:1:18628:2455#0/1
GATCCTTGTTCCACGATCCTCCAGGATCCCATA
+HWUSI-EAS1795_0092:3:1:18628:2455#0/1
aYdcedeaccffcff_ccd`ecfffccfd_]d^
@HWUSI-EAS1795_0092:3:1:18808:2454#0/1
GTTTACCCAGGAGGACATAGACGAGGCGATATC
+HWUSI-EAS1795_0092:3:1:18808:2454#0/1
hffghhgghchhhh_gghhgfhgdhfgghhhhg
@HWUSI-EAS1795_0092:3:1:19008:2452#0/1
ATCGATTTGCTGCAGGAGAAGATCGAGGAGTTC
+HWUSI-EAS1795_0092:3:1:19008:2452#0/1
ghhhhehhhhhghhhhghhhhhhhhhhhehhhf
@HWUSI-EAS1795_0092:3:1:19049:2457#0/1
TGGCACTGTTAAGTGATAAGAAATTCCTTTCTT
+HWUSI-EAS1795_0092:3:1:19049:2457#0/1
^c[ac^^c]VcaSRWOXZWW]Z^]aaV]a]cac
@HWUSI-EAS1795_0092:3:1:19556:2456#0/1
GTGAGAGCGCCTGGAAGGCCAATGACGATGGCA
+HWUSI-EAS1795_0092:3:1:19556:2456#0/1
hhhhhfhhghhhghhhhgfhfhghfhfaehhgh
@HWUSI-EAS1795_0092:3:1:1607:2464#0/1
GTCAACGTGTTCAAAACATAAGCATCGTCGACC
+HWUSI-EAS1795_0092:3:1:1607:2464#0/1
ggffccfaedeadfccc__eeaWda[ed`d^^c
@HWUSI-EAS1795_0092:3:1:2114:2462#0/1
AATTCATCGCACTCGACATTGCATCTCGCCGAG
+HWUSI-EAS1795_0092:3:1:2114:2462#0/1
hhhhhhhhfhfhhhgghfhfhhhhhhhghhgWh
@HWUSI-EAS1795_0092:3:1:2545:2458#0/1
GGGTAATGCCCTGCTGCGCCGTCTGGTCCGTAT
+HWUSI-EAS1795_0092:3:1:2545:2458#0/1
^dcadccfdff]fccccfddffafccf[bdd]P
@HWUSI-EAS1795_0092:3:1:2651:2461#0/1
CGAGTTTCCGCAACTGGCCATGGGTTCCCGGGA
+HWUSI-EAS1795_0092:3:1:2651:2461#0/1
ed]ff_feffff]fffcfffaaf_ccfgggggc
@HWUSI-EAS1795_0092:3:1:2866:2469#0/1
TACTCAAGCTCAAGCAAAAACTGAATCTCTATG
+HWUSI-EAS1795_0092:3:1:2866:2469#0/1
gagggggcfggggggggadfffcggggggggcc
@HWUSI-EAS1795_0092:3:1:2952:2461#0/1
CGGCATATTACTTAACTTTTATTTTCAAAATAC
+HWUSI-EAS1795_0092:3:1:2952:2461#0/1
hghcfhehhhhhghhhhhfgehhhhhhhcdhhh
@HWUSI-EAS1795_0092:3:1:3334:2463#0/1
GATAAACAGTACTATCAATATGGAGTTCCTCGA
+HWUSI-EAS1795_0092:3:1:3334:2463#0/1
hghhhhghhhhhhhhgghhhhhhhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:3528:2465#0/1
ACGACATCGTGCTCGGCGGCGGATCCACTCGCA
+HWUSI-EAS1795_0092:3:1:3528:2465#0/1
][ff[ffcddWWSNUIZac^a^I]^^^SLSSN^
@HWUSI-EAS1795_0092:3:1:3636:2462#0/1
TGTGCGGCTGCTCCGTGGTCGTGATCAAGGATT
+HWUSI-EAS1795_0092:3:1:3636:2462#0/1
ffgggfcggggfffc]affffdcffffggdaff
@HWUSI-EAS1795_0092:3:1:3678:2462#0/1
CGTCTACCTGGAGCTGGAGGCAGTGGTGGCCAA
+HWUSI-EAS1795_0092:3:1:3678:2462#0/1
fff]ffaffffaeWaee[ae[Wcaaa_acd_[f
@HWUSI-EAS1795_0092:3:1:3706:2463#0/1
CAGAAAAATAAATTTACTCCGAACTATGGCATA
+HWUSI-EAS1795_0092:3:1:3706:2463#0/1
hhhdhhfghghhhhfhfghhhgghhhhhhdehh
@HWUSI-EAS1795_0092:3:1:3877:2463#0/1
GCGTGATTCATGATTCAATAAAGGAATATGAAG
+HWUSI-EAS1795_0092:3:1:3877:2463#0/1
hhhhhhhhhhhhgfhhhhhhhhhhhhhhhhhff
@HWUSI-EAS1795_0092:3:1:3919:2459#0/1
CTGCTCCATGATTCTGGGAAACACCGTGTGGGT
+HWUSI-EAS1795_0092:3:1:3919:2459#0/1
gggfggggggaaffffdgcgggggaegfffffb
@HWUSI-EAS1795_0092:3:1:4007:2462#0/1
CCTCGGTGTACTTGCCCTTATCCTTGCCGAGAG
+HWUSI-EAS1795_0092:3:1:4007:2462#0/1
fdffffc_fffffcffcdfffffffffffffac
@HWUSI-EAS1795_0092:3:1:4490:2468#0/1
TATCGAAGGGATCTGGACTCAGTGGAGCTCCCA
+HWUSI-EAS1795_0092:3:1:4490:2468#0/1
gfggggggggdgfdfdcgggggggggggggg_g
@HWUSI-EAS1795_0092:3:1:4534:2463#0/1
AGGCTGCTCGCCAGTTGGCCAACAGCATCAAGG
+HWUSI-EAS1795_0092:3:1:4534:2463#0/1
gcggggggggggggggcgggggggcfggggggc
@HWUSI-EAS1795_0092:3:1:4567:2467#0/1
CGAACTTATAAGTGAATTGTTGGCAGCTGGTGC
+HWUSI-EAS1795_0092:3:1:4567:2467#0/1
ghhhghhghhfhghhhhhfhhhhgcgdghhchh
@HWUSI-EAS1795_0092:3:1:4952:2460#0/1
AGCTGAACAACCAGGTGCTGTTCGACAAGGCCA
+HWUSI-EAS1795_0092:3:1:4952:2460#0/1
cdfgffgggggfffaffeecgggagdgfggfag
@HWUSI-EAS1795_0092:3:1:5473:2463#0/1
GCAAGTTGGGGTAGGATTGAGTTCAGTGATAAT
+HWUSI-EAS1795_0092:3:1:5473:2463#0/1
]^aaaa_hhhhhfhhfhhhhfhhhfhhhchgch
@HWUSI-EAS1795_0092:3:1:5498:2463#0/1
CGGGGTTAGAGATGAGGAGCAAACACCTTCTTC
+HWUSI-EAS1795_0092:3:1:5498:2463#0/1
gfffffffgg_gfdaff_ffffgdgggffffff
@HWUSI-EAS1795_0092:3:1:6020:2468#0/1
CGGCACGGTGATGACCGCGTTGGTCACAGTCTT
+HWUSI-EAS1795_0092:3:1:6020:2468#0/1
ffc_c\cff_^faecaeYceeacfWffccdaff
@HWUSI-EAS1795_0092:3:1:6660:2464#0/1
GTGAATTCATGCCATACGATGGCCATCGGCACG
+HWUSI-EAS1795_0092:3:1:6660:2464#0/1
hhhhhhhhhhfhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7313:2465#0/1
GCACCATCGGTCCACTCCTGCTTCGCCACAGTC
+HWUSI-EAS1795_0092:3:1:7313:2465#0/1
gfhhhhhhhhghdhhhghghghhhghhhghhhh
@HWUSI-EAS1795_0092:3:1:8975:2460#0/1
GCCTTCTTCTTGCTCTTGTACCAGTTCTTGTAG
+HWUSI-EAS1795_0092:3:1:8975:2460#0/1
hhhhghhhdhhhhhggh_ffffdhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9181:2459#0/1
GGAAGAAGCAGAGCGATGTGATGCGCTACTTGC
+HWUSI-EAS1795_0092:3:1:9181:2459#0/1
ccccYc\a^]Saa_a\acccacaacaccaYccS
@HWUSI-EAS1795_0092:3:1:9696:2462#0/1
GTAAAACAGTGCCAGTTAACAACAGCAAACGGC
+HWUSI-EAS1795_0092:3:1:9696:2462#0/1
hhhhhhhhhhhhhhhh[hhfhhhhhhhhghhgh
@HWUSI-EAS1795_0092:3:1:10024:2463#0/1
TTGCCGTCGTCGAAGACATGATAGACACCGAAC
+HWUSI-EAS1795_0092:3:1:10024:2463#0/1
hhghhhhhhhhhhhfhhhhhhfgfhhhhgghhh
@HWUSI-EAS1795_0092:3:1:10401:2461#0/1
ATTTTGACCAGCGTGCTTGTTCTCGTCCCGAGC
+HWUSI-EAS1795_0092:3:1:10401:2461#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:11430:2467#0/1
GAGGCGTTGTACACAACATCGGCGATACGGGTC
+HWUSI-EAS1795_0092:3:1:11430:2467#0/1
ggggggggggggggggggfggffgfgggggffg
@HWUSI-EAS1795_0092:3:1:11657:2467#0/1
CTTGATTGGGATTATTTTCGACTTCTCGAATGC
+HWUSI-EAS1795_0092:3:1:11657:2467#0/1
hhhhhhhhghhhhhhhhhghhgghghhdhfhhh
@HWUSI-EAS1795_0092:3:1:11730:2469#0/1
GCGACATGGGAGCCCGCCACCGTGCCCGTGCCC
+HWUSI-EAS1795_0092:3:1:11730:2469#0/1
hhghhhfhhhhhhhhhhhhhhhefhhgdghhhh
@HWUSI-EAS1795_0092:3:1:11877:2463#0/1
AAGGATGGTAGTACTCTGGCGGTGCGAAGAGCA
+HWUSI-EAS1795_0092:3:1:11877:2463#0/1
ghhhhhhhhhhhhhhhhhhhhhhhhhhghghgh
@HWUSI-EAS1795_0092:3:1:12664:2462#0/1
CGCTGGTTCTTCTTGTATCTTTGAAATTGATTT
+HWUSI-EAS1795_0092:3:1:12664:2462#0/1
ZZ^\^^Ubacdaddaaaabbeaaa__adaadea
@HWUSI-EAS1795_0092:3:1:13074:2467#0/1
TTCGAGGCATTAAAGTCTTTAAGCCACACACCA
+HWUSI-EAS1795_0092:3:1:13074:2467#0/1
\a^aa^a\Y[a\]a^RaaZcac\_^_aacY^ac
@HWUSI-EAS1795_0092:3:1:13366:2461#0/1
CACGGAGAATATAGTCCTTGCCCTCGAGCTCGA
+HWUSI-EAS1795_0092:3:1:13366:2461#0/1
d^cddecff_dfcabeecedeeffacfacbd]d
@HWUSI-EAS1795_0092:3:1:13463:2459#0/1
GCGCAGCACTCAGCACGAACAAACGTTTGACGC
+HWUSI-EAS1795_0092:3:1:13463:2459#0/1
gghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13498:2467#0/1
CAGGGCTTTCCGACCTATCGAACCAGGGCTGGG
+HWUSI-EAS1795_0092:3:1:13498:2467#0/1
ff]fcfdffffcgggggggacgggfgacfffdg
@HWUSI-EAS1795_0092:3:1:14047:2458#0/1
TCCAGGAGTTCCCCCCTCTGGGTCGCTTCGCTG
+HWUSI-EAS1795_0092:3:1:14047:2458#0/1
eggggcgcffffdfac]ZZ^^^cfcfdgggcgd
@HWUSI-EAS1795_0092:3:1:14452:2459#0/1
GTTCGCTTATCGCTTAGGCTAATGTAATGCGGG
+HWUSI-EAS1795_0092:3:1:14452:2459#0/1
hhhhhhhhhhhhhhhhhghhheghhhhehhhhh
@HWUSI-EAS1795_0092:3:1:14976:2459#0/1
ATTTAAAGCGTCCCTGTGAGTGTCAGCGGCAAA
+HWUSI-EAS1795_0092:3:1:14976:2459#0/1
gggegdggdgggggggggagcgffcfaffgggg
@HWUSI-EAS1795_0092:3:1:15078:2464#0/1
GTCGACGTTTAGGAGCGTTCCACTGAGGGAAGT
+HWUSI-EAS1795_0092:3:1:15078:2464#0/1
gggggggggcggg_gggggegggggggggeegc
@HWUSI-EAS1795_0092:3:1:15229:2466#0/1
AAGCAAACTGCGAATCGCCAGAGGGCCAAATAG
+HWUSI-EAS1795_0092:3:1:15229:2466#0/1
hhhghhhhhhhhhhhhghhgfhehfhdfhgghh
@HWUSI-EAS1795_0092:3:1:15299:2459#0/1
CCGCGCTGCCAAACTTCTCAAACAGCTCGTACT
+HWUSI-EAS1795_0092:3:1:15299:2459#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:15743:2465#0/1
CTTCCTGCATCTCTATCCTAATTCCAATAAAAT
+HWUSI-EAS1795_0092:3:1:15743:2465#0/1
fcffdffdcffddcfffgdggegggeggggggg
@HWUSI-EAS1795_0092:3:1:16659:2469#0/1
CTTCAGAAGGTTCTTGGCGCGCTCGACCTCAGC
+HWUSI-EAS1795_0092:3:1:16659:2469#0/1
hhhhhhhhhghhhghhhhcgggehhhghfhhgh
@HWUSI-EAS1795_0092:3:1:17115:2469#0/1
CCCAGTCCCAAGCAGATACAACCCAAACCTGTG
+HWUSI-EAS1795_0092:3:1:17115:2469#0/1
hhhghhhhhhhagfghghghhchhhghg_hggh
@HWUSI-EAS1795_0092:3:1:17243:2464#0/1
CTGCACTATGCACGTGTAAGAGTTTGTGTCGTG
+HWUSI-EAS1795_0092:3:1:17243:2464#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17497:2461#0/1
CCAGCATACCAATACCAATCCGATACGAATCCC
+HWUSI-EAS1795_0092:3:1:17497:2461#0/1
ggffggcgggagfgggggffggfaaeagg_ggc
@HWUSI-EAS1795_0092:3:1:17819:2464#0/1
GCCTGCGTGGTGGTGCCAAGAAGCGCAAGAAGA
+HWUSI-EAS1795_0092:3:1:17819:2464#0/1
hghghhhhhhgffdfffhhchhhhfeggfhghc
@HWUSI-EAS1795_0092:3:1:17856:2468#0/1
CGTTACGAAGAAAAGGTGGAATGCTAAGAAACT
+HWUSI-EAS1795_0092:3:1:17856:2468#0/1
ffdffff_ffffggggbfffcfggggaggg`eg
@HWUSI-EAS1795_0092:3:1:18874:2468#0/1
GCTACACCCAAAATTATATCTTAATCCAACATC
+HWUSI-EAS1795_0092:3:1:18874:2468#0/1
cacefaeaeeeedfa_ffcdddfdffadadeaf
@HWUSI-EAS1795_0092:3:1:18985:2468#0/1
GCGATGACGATCCCCCACATGCCTTCTCGCAGG
+HWUSI-EAS1795_0092:3:1:18985:2468#0/1
gggggcggggegggggegggagggggfgggggg
@HWUSI-EAS1795_0092:3:1:19223:2460#0/1
GGACATTCTGGTGCAGTACGACAGAACCCTGCT
+HWUSI-EAS1795_0092:3:1:19223:2460#0/1
fdde^`bcceeecf_fffdffdgcgfgdfggge
@HWUSI-EAS1795_0092:3:1:19519:2461#0/1
AAAGCAGATACTGATCAAAACGCAGAGGCATCC
+HWUSI-EAS1795_0092:3:1:19519:2461#0/1
hhhhhghhhhhhgghhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:1936:2474#0/1
CTCGACTTCTGGGAGGCCCGATCGAAGGGACAA
+HWUSI-EAS1795_0092:3:1:1936:2474#0/1
c[cccccaccccc_c__cccYcccc[ccaccac
@HWUSI-EAS1795_0092:3:1:1998:2475#0/1
CAAGAAGGAAGTGTCCTCTTACATCAAGAAGAT
+HWUSI-EAS1795_0092:3:1:1998:2475#0/1
aggggggfcfffcdeffdf_dfgefcgdfacY`
@HWUSI-EAS1795_0092:3:1:2448:2475#0/1
AAAATCAACAACAACACGACAACAACTTCAAGA
+HWUSI-EAS1795_0092:3:1:2448:2475#0/1
_affdffSaaaXd[dddadaaYca^aSUW\^^f
@HWUSI-EAS1795_0092:3:1:2669:2479#0/1
GCTAAGTGGTGTGATGTGAAATTCTGGCCGTGC
+HWUSI-EAS1795_0092:3:1:2669:2479#0/1
ggfdfffbb[bccfdccgggggcgggggggfgf
@HWUSI-EAS1795_0092:3:1:4656:2470#0/1
CGACAACTACTACAACCACGCCAAAGCCCACTA
+HWUSI-EAS1795_0092:3:1:4656:2470#0/1
hhhhhhhhhghhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4734:2480#0/1
GTCCACCGGGATCGATTTACTTCGACTCGCAGT
+HWUSI-EAS1795_0092:3:1:4734:2480#0/1
hhhhhhhghhhfghhhhhhhhfhhhfhhhhcgg
@HWUSI-EAS1795_0092:3:1:4775:2479#0/1
CTTTAGTGAGTAGGAAGGTACAATGGTATGCGT
+HWUSI-EAS1795_0092:3:1:4775:2479#0/1
ggffffafcfffgffgdggggggggggggfggg
@HWUSI-EAS1795_0092:3:1:4849:2481#0/1
ACAACATCCGCAAGACTTCCATGTTCCCGCGCG
+HWUSI-EAS1795_0092:3:1:4849:2481#0/1
ghhhhhhhhhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4990:2471#0/1
GCGGAAGAATATCACCGAACGGAAGAGTCGCCG
+HWUSI-EAS1795_0092:3:1:4990:2471#0/1
cggggcfggfaffffffcffcffadafc]cf]a
@HWUSI-EAS1795_0092:3:1:5364:2470#0/1
ATTCATTCGAAATGGTGGTTAAAGCTGTCTGCG
+HWUSI-EAS1795_0092:3:1:5364:2470#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhg
@HWUSI-EAS1795_0092:3:1:5763:2471#0/1
GCGCAGTCGTTCCGAGGGCATTTGGCCATCCTC
+HWUSI-EAS1795_0092:3:1:5763:2471#0/1
ggg_gggfcffc_f]ffffacfaffffgggecf
@HWUSI-EAS1795_0092:3:1:6703:2480#0/1
TCATCATCGACAAACTGGGCAGGAATGTGACCT
+HWUSI-EAS1795_0092:3:1:6703:2480#0/1
faffacff__cdccaccf^fad^caaabacaa[
@HWUSI-EAS1795_0092:3:1:6725:2472#0/1
CGGGAAAGAAAAGTGTCCTTCTTGAATGGACTC
+HWUSI-EAS1795_0092:3:1:6725:2472#0/1
hhhhhhhhhhhhhgghhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:7288:2477#0/1
AGCTTTGACATCGTACCAGTCCTTGCGAGAAAA
+HWUSI-EAS1795_0092:3:1:7288:2477#0/1
hhhhhhhdffffcffffhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7352:2479#0/1
CGTAAGCACTGGAGGATCCATCGCAAAAGGTGT
+HWUSI-EAS1795_0092:3:1:7352:2479#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhchhggf
@HWUSI-EAS1795_0092:3:1:7823:2480#0/1
CGCAGGTTTAGGTCCTTGACAATCTTGCCGGGC
+HWUSI-EAS1795_0092:3:1:7823:2480#0/1
hhghhhhhhhhhhhhhhhhghhgghh_gfhhhh
@HWUSI-EAS1795_0092:3:1:9499:2473#0/1
CAAGAAGGCCCATCGTAATGGCATCAAGCGCCC
+HWUSI-EAS1795_0092:3:1:9499:2473#0/1
hhhhhhghhhghhhhhhghhhhfhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:9770:2479#0/1
CGGGCCTCGGTGTTTTTGCGCACACGGTAACGG
+HWUSI-EAS1795_0092:3:1:9770:2479#0/1
hdhhghhhhfehhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:10037:2481#0/1
GCTGTTTCGCTTTCCCTACTCTCATTCGGGTTG
+HWUSI-EAS1795_0092:3:1:10037:2481#0/1
hhhhhhhhhhhhhhhhhhhhhggghhhhhhghh
@HWUSI-EAS1795_0092:3:1:10157:2473#0/1
AACTGTTCAATATCCTTAAGGATTCGTCGATCA
+HWUSI-EAS1795_0092:3:1:10157:2473#0/1
ghfhghhhhhhhfhhhhhhhhhhhhhfhchhhh
@HWUSI-EAS1795_0092:3:1:10192:2471#0/1
TTGGGGAACGGATCTGTTCTGCTTCAGCTTCTT
+HWUSI-EAS1795_0092:3:1:10192:2471#0/1
hhfhhhhhhhhehhhdhhhhefhhhhffhhhfh
@HWUSI-EAS1795_0092:3:1:10219:2470#0/1
ACAAAACATAACTAACCAGAAAGAGAACCAGCA
+HWUSI-EAS1795_0092:3:1:10219:2470#0/1
fffggggfcfefdfffdfddffacffdfafa^f
@HWUSI-EAS1795_0092:3:1:10265:2479#0/1
GCTGGTTTGAGGATCGCAGTCGAACGGATAATT
+HWUSI-EAS1795_0092:3:1:10265:2479#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhffhhhh
@HWUSI-EAS1795_0092:3:1:11160:2474#0/1
GCTTGCGATGCCTTGGCTGATAATCCCTCCTGG
+HWUSI-EAS1795_0092:3:1:11160:2474#0/1
hhhhhhhghhhhgghhhhhgghhhhhhhhhehf
@HWUSI-EAS1795_0092:3:1:11290:2480#0/1
AGCGCAAGGAGTCGCTCAACAAGATGCGTCAGG
+HWUSI-EAS1795_0092:3:1:11290:2480#0/1
hhchhhhghhhhhhhghhhhhhghhghhhhhhg
@HWUSI-EAS1795_0092:3:1:11400:2471#0/1
CTCCAGCCGAATCCAGCTAAAAAGAAAGCAGGA
+HWUSI-EAS1795_0092:3:1:11400:2471#0/1
hhhhhhhhhhhhghfhhhfhhhhhhhghghhgh
@HWUSI-EAS1795_0092:3:1:12146:2471#0/1
TTCCCTTGCCATAATGGTGCCAGATGGATGTCG
+HWUSI-EAS1795_0092:3:1:12146:2471#0/1
hhhhhhhfhhghhhchhhfhhfhgfhchghhgc
@HWUSI-EAS1795_0092:3:1:12479:2481#0/1
GCAAAGTCGATCTTCCAGTTGAGAGCACTGTGC
+HWUSI-EAS1795_0092:3:1:12479:2481#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhfhhhhhhd
@HWUSI-EAS1795_0092:3:1:12611:2476#0/1
CGCGCAGCTTGCGATCGTTTTTGGATATTCGCT
+HWUSI-EAS1795_0092:3:1:12611:2476#0/1
gagdgeffgfggggdggggggffffcfgfgcgf
@HWUSI-EAS1795_0092:3:1:13128:2476#0/1
AAACCGACGACTACTGCTGAGGGGACAACAATG
+HWUSI-EAS1795_0092:3:1:13128:2476#0/1
hhhhhhhhhhhhhhghhhhhhgh`hhhhhhgch
@HWUSI-EAS1795_0092:3:1:13156:2470#0/1
AATGCTCCCAATGCGGATACGGAGAAGTTGTTC
+HWUSI-EAS1795_0092:3:1:13156:2470#0/1
fgfgggggggggdcgg_dffff]afffggcggg
@HWUSI-EAS1795_0092:3:1:13221:2478#0/1
AGCGCACCCTAGACGATGACTTGCGCGACATGA
+HWUSI-EAS1795_0092:3:1:13221:2478#0/1
afffffdd^ffacf^ffSaa[ZS\Y]]ead[e\
@HWUSI-EAS1795_0092:3:1:13425:2480#0/1
GGGACGTGTCGGCACCGTTGTCAACCGTGAGCG
+HWUSI-EAS1795_0092:3:1:13425:2480#0/1
hhhghhhghhhghghhhghhhhghhhghgghgg
@HWUSI-EAS1795_0092:3:1:13888:2473#0/1
CGGAGCTTACTGTTTGCAAACAAAAAATACATT
+HWUSI-EAS1795_0092:3:1:13888:2473#0/1
hhhhhhhhhhfhhhhhhhhhfhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14235:2473#0/1
ATAACACCGTTAAAATGCTAATTTTGTTTAACA
+HWUSI-EAS1795_0092:3:1:14235:2473#0/1
gggggggeggggggfgffafafgggcggggggc
@HWUSI-EAS1795_0092:3:1:15250:2478#0/1
AAGAGCGTCCCAACATCTACCAGCCATCGCAGG
+HWUSI-EAS1795_0092:3:1:15250:2478#0/1
hhhhfghhhhhhhhhhhhhhhhghhghhghcfg
@HWUSI-EAS1795_0092:3:1:15622:2480#0/1
TCTTCACGTTCATGTCCACGATTTCGCCGGACT
+HWUSI-EAS1795_0092:3:1:15622:2480#0/1
hghhhhhhhhhhhhhhhghhhhhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:15814:2479#0/1
TTCGATCGTCCGGACATGAAAGCCAACTTCTCG
+HWUSI-EAS1795_0092:3:1:15814:2479#0/1
hhhhhhhhhhhhhhhhhhhhghhhhgghfhhgh
@HWUSI-EAS1795_0092:3:1:15906:2477#0/1
CAGGGGCAGACGCAGGGCCTTGTCGGTGGGACG
+HWUSI-EAS1795_0092:3:1:15906:2477#0/1
hfhghhhhhhhhhfhhhghhhhfghhchhhceh
@HWUSI-EAS1795_0092:3:1:16427:2478#0/1
GAACTTTGCAGGTCACGCCAGCCACTTCATCAA
+HWUSI-EAS1795_0092:3:1:16427:2478#0/1
hhghhhhhhhhhhhhhghhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17022:2476#0/1
GTCTTTTTTAACAATTTGAGCGCTAAGAATAGC
+HWUSI-EAS1795_0092:3:1:17022:2476#0/1
hhghhhhhhfghhhhhhfghhhhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:17390:2474#0/1
ATTCATTGGGCGCCTCCAAGTACATGACCTATG
+HWUSI-EAS1795_0092:3:1:17390:2474#0/1
hhhhhhhhhghhhhhhhghghhhfhghhhdggh
@HWUSI-EAS1795_0092:3:1:18550:2470#0/1
GCTAGGTATGCTAGGTATCGGTTTCGGTTTCGG
+HWUSI-EAS1795_0092:3:1:18550:2470#0/1
ggfggggggggfggggggggggggggegggggg
@HWUSI-EAS1795_0092:3:1:18958:2474#0/1
CGGGGATTGCATGATATTTTTTGGTGATATAAA
+HWUSI-EAS1795_0092:3:1:18958:2474#0/1
HLGMMTZTPW_UQYWYYTPPPQIZbKaccac\W
@HWUSI-EAS1795_0092:3:1:19413:2475#0/1
GCGACAGGTCGCAGTGGCTGCCCGCCGACAAGC
+HWUSI-EAS1795_0092:3:1:19413:2475#0/1
ggggfgggdgggffeffggg_eaW^BBBBBBBB
@HWUSI-EAS1795_0092:3:1:2115:2486#0/1
GTTGGTCATGAACTTGCGGGTGCGGATGGTAGC
+HWUSI-EAS1795_0092:3:1:2115:2486#0/1
egfgeggggaggggggfeafffcffffeffaff
@HWUSI-EAS1795_0092:3:1:2226:2493#0/1
TCGTGGGGTCTTGAAACCGAGTCCCACATCGCG
+HWUSI-EAS1795_0092:3:1:2226:2493#0/1
hhhhhgfhghhhhhhhhhhhhghhhghfghhhg
@HWUSI-EAS1795_0092:3:1:2255:2485#0/1
CAGCGACGCCCGTTATGAGGAAATCAAGAAGGA
+HWUSI-EAS1795_0092:3:1:2255:2485#0/1
]c```R_OWRNRWIWYR^SK^acaaaac[_caa
@HWUSI-EAS1795_0092:3:1:2350:2486#0/1
GTCGTAGGTGCCCAAACGTTCTCCGTTCAGCGA
+HWUSI-EAS1795_0092:3:1:2350:2486#0/1
ggffaffggggggcacgggfggggggggadegc
@HWUSI-EAS1795_0092:3:1:3240:2488#0/1
CGCGATGGAAGAAATACTCGACCATGTCGAAGA
+HWUSI-EAS1795_0092:3:1:3240:2488#0/1
fgdggggggggf[fcafgeggegcgggffcacf
@HWUSI-EAS1795_0092:3:1:4078:2482#0/1
GGGGAAGCCACCCATGGGCGTGATGCTCTTGTC
+HWUSI-EAS1795_0092:3:1:4078:2482#0/1
hhhhhhhhhhhhhhhhhhfhhhhghhehhhfhh
@HWUSI-EAS1795_0092:3:1:4298:2492#0/1
TGTGGACTGGCGCACCAAGGGAGCTGTGACCGC
+HWUSI-EAS1795_0092:3:1:4298:2492#0/1
gdgggfggggggggeggggggagggggggggef
@HWUSI-EAS1795_0092:3:1:4330:2482#0/1
AGCAACAACAACAACAACAACACGCAGTAGTAG
+HWUSI-EAS1795_0092:3:1:4330:2482#0/1
hhghhhhhhhhhhhhhhfhhhfhhhhhggfhhg
@HWUSI-EAS1795_0092:3:1:4488:2487#0/1
CGGAAATGGCGATGGTAGTGCCAAAGTCGAGGA
+HWUSI-EAS1795_0092:3:1:4488:2487#0/1
hhhhhhhhhhhhhhhhghhdhhhhghhhgghfh
@HWUSI-EAS1795_0092:3:1:5255:2490#0/1
CGAGGACAAGAGTGAGGCCGAAGGTAACGATGA
+HWUSI-EAS1795_0092:3:1:5255:2490#0/1
ggggggggfgggffafffffafffdff_fffff
@HWUSI-EAS1795_0092:3:1:5810:2489#0/1
GCAATTCCTGCCGGGACAGAGTGCCGAGACATT
+HWUSI-EAS1795_0092:3:1:5810:2489#0/1
hhhhhhhhhhhhhhghehffghhhhhghhhhhg
@HWUSI-EAS1795_0092:3:1:5907:2487#0/1
CGAGCTCACGCCCGAGCAACTGGAGCGGCAGCG
+HWUSI-EAS1795_0092:3:1:5907:2487#0/1
hhhhhhhhhhhhhhhhhhhhghhfhhhfhhhff
@HWUSI-EAS1795_0092:3:1:6057:2483#0/1
GGCAAGTTCTCGCATCCCACCGATGTCATCTGT
+HWUSI-EAS1795_0092:3:1:6057:2483#0/1
gfggggfdccfceggagggfggggfggfggfgf
@HWUSI-EAS1795_0092:3:1:6128:2487#0/1
GAAAAAGCCCAGATTCGACTCCTTGAGGACGAA
+HWUSI-EAS1795_0092:3:1:6128:2487#0/1
hhhhhhhhhhhfhhhhhghhhhhhhhhhdfhhh
@HWUSI-EAS1795_0092:3:1:7086:2489#0/1
CGGGAGGTCATTGTGGGATTGCGCTTTTGTTCC
+HWUSI-EAS1795_0092:3:1:7086:2489#0/1
ggggggggggggfdffcgggggdgggggagggg
@HWUSI-EAS1795_0092:3:1:7202:2492#0/1
TTCCACTCCTCCTCCAACTGTTCCGCCTCCGCC
+HWUSI-EAS1795_0092:3:1:7202:2492#0/1
cccfdfdcffffgcgfcff_fadddecbcd`bf
@HWUSI-EAS1795_0092:3:1:8668:2487#0/1
GTAATGCGGTCGGTATTGCATGGCATCCAGTAT
+HWUSI-EAS1795_0092:3:1:8668:2487#0/1
hhhhhfhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9019:2482#0/1
TAGGATAGCATCGAAGGTGCTCAGGCTGGCCGG
+HWUSI-EAS1795_0092:3:1:9019:2482#0/1
ggggggaffffffffcfcffffff_ffgfgggc
@HWUSI-EAS1795_0092:3:1:9262:2491#0/1
TTGGTATCAAGGTCAAGGTCATGTTGCCCTACG
+HWUSI-EAS1795_0092:3:1:9262:2491#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9296:2490#0/1
TTAGCTTTAGCCCGTTCCAGTTGTTAACCAAGA
+HWUSI-EAS1795_0092:3:1:9296:2490#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhgg
@HWUSI-EAS1795_0092:3:1:9369:2486#0/1
CAAGCCGCCAAGTCTACGACCAACACGTTCCTC
+HWUSI-EAS1795_0092:3:1:9369:2486#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:10313:2488#0/1
CCTGGCTACTAAGTATCAGGTCAGCGTTGAGGA
+HWUSI-EAS1795_0092:3:1:10313:2488#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhchhe
@HWUSI-EAS1795_0092:3:1:10377:2490#0/1
CGACACACACACACACTTTACTCACACCCTACT
+HWUSI-EAS1795_0092:3:1:10377:2490#0/1
hhhhhhhhhhhhghchhhhhhchhhhhhhdhgh
@HWUSI-EAS1795_0092:3:1:10429:2482#0/1
AGGAGCGCTTCGTGCCCAACGAGCAGCGCAAGA
+HWUSI-EAS1795_0092:3:1:10429:2482#0/1
hhhhhhhhhhhhhhhhhhhhhgdhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:10801:2491#0/1
CGGGCACTCGTCGTCGTTTGATATTTATTGAAT
+HWUSI-EAS1795_0092:3:1:10801:2491#0/1
[PW_Z_`ccaZ_YU_WN^\QTNcac_^aVV^aB
@HWUSI-EAS1795_0092:3:1:10927:2490#0/1
CGCCAACAAACATGTTTAATTTTCTAGTATTTA
+HWUSI-EAS1795_0092:3:1:10927:2490#0/1
Ycacca_^___ccccac_WZ]_cc]Zca[aaac
@HWUSI-EAS1795_0092:3:1:11480:2481#0/1
CGAGCAGCTGCCTCCGCCGTCGGAGGCATCGAC
+HWUSI-EAS1795_0092:3:1:11480:2481#0/1
YYZ`Z]VPJ^VVQYS_UacacBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:11558:2487#0/1
CTCCGGTGGCAAGGTCACCAAGGCCGCCGAGAA
+HWUSI-EAS1795_0092:3:1:11558:2487#0/1
hhhhdhhhhhhhhhhhhhfhhhhhfhhfggchf
@HWUSI-EAS1795_0092:3:1:11964:2484#0/1
TGGGCATGGTAGCGAAAATGCACGGGCAGAGCC
+HWUSI-EAS1795_0092:3:1:11964:2484#0/1
hhghfhhhhhfhhhfhhhhefhhhhhgfhghhf
@HWUSI-EAS1795_0092:3:1:12704:2487#0/1
CCCAAGTCGGTGACCGCTTCGGTCCTCCGCCCG
+HWUSI-EAS1795_0092:3:1:12704:2487#0/1
hhhhhhhhggghhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12780:2487#0/1
CCCACTTCCCTGACTACACTTCCAACATCGCTG
+HWUSI-EAS1795_0092:3:1:12780:2487#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:12994:2490#0/1
TGGTGCTCGAGCAGAAGCGTGCCGATCGCGTCC
+HWUSI-EAS1795_0092:3:1:12994:2490#0/1
fdcffffggggaefggYafffcaecba^cdaaf
@HWUSI-EAS1795_0092:3:1:13498:2489#0/1
TTTTTATTTAGTTTCTAGAACAATGTGAAGTAA
+HWUSI-EAS1795_0092:3:1:13498:2489#0/1
Yfdc```ccccff]ff]ddcddff_adfcf`]f
@HWUSI-EAS1795_0092:3:1:13571:2492#0/1
GCCAGCTACGTGAACATCCCCGTGATTGCCTTC
+HWUSI-EAS1795_0092:3:1:13571:2492#0/1
hhhhhhhhhghhhhdhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13714:2488#0/1
TTTAAGTCCTTGACGCGAATATCACGAGACAGA
+HWUSI-EAS1795_0092:3:1:13714:2488#0/1
hhhhhhhhhhhhghhhhghhghhhhghchhhhh
@HWUSI-EAS1795_0092:3:1:15215:2489#0/1
CGCATCTTGATGACAGCTCCGTTAGTCCCTCGT
+HWUSI-EAS1795_0092:3:1:15215:2489#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:16981:2491#0/1
CTTGTATTGCTTCTGGGCCAAGCAGCTGGCGAG
+HWUSI-EAS1795_0092:3:1:16981:2491#0/1
hhhhhhghghghhhhhhhhhhgfhhgfgcghhh
@HWUSI-EAS1795_0092:3:1:17127:2493#0/1
GTGAAGACTTGAAGGTTCCAGAGGGCGAATTGG
+HWUSI-EAS1795_0092:3:1:17127:2493#0/1
gggggfggggggggfggggdgggggggf`ffff
@HWUSI-EAS1795_0092:3:1:17464:2487#0/1
GGCTGACATATTTACAAAACCGTTGCCTGCTGC
+HWUSI-EAS1795_0092:3:1:17464:2487#0/1
hhhhhhhhhhghhhghhhhghhhhhhhgfhhhh
@HWUSI-EAS1795_0092:3:1:17533:2482#0/1
CACGATAGTCTCGTGGTGTGCCAATTGGTTAAC
+HWUSI-EAS1795_0092:3:1:17533:2482#0/1
gfgggggggggggdgggfffffgfgggggcggg
@HWUSI-EAS1795_0092:3:1:17690:2490#0/1
CGAGATCAAGGAACCAAAGACGCGCACCGAGAA
+HWUSI-EAS1795_0092:3:1:17690:2490#0/1
f_fffffcfffffgaggfgggcggdfg\cScaf
@HWUSI-EAS1795_0092:3:1:18483:2491#0/1
GGCCGGTACTATTACTTTGAACAAATTAGAGTG
+HWUSI-EAS1795_0092:3:1:18483:2491#0/1
hhhhhhhghhhhhhhhhhhghhhgfhhhhhehh
@HWUSI-EAS1795_0092:3:1:19078:2483#0/1
CTGGGAAGTGTTAACTGATCCAGCATTTGCTGC
+HWUSI-EAS1795_0092:3:1:19078:2483#0/1
hhhhhghhhhhhhghhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:19294:2492#0/1
TCCAGATACCATCATCCTTTGAACATCATTGCT
+HWUSI-EAS1795_0092:3:1:19294:2492#0/1
gcgfgggfgeggegggcggggcfggggfggg_f
@HWUSI-EAS1795_0092:3:1:19498:2491#0/1
GGCAGCAAGTCTGGGTGAGCTGCAACGGTCACT
+HWUSI-EAS1795_0092:3:1:19498:2491#0/1
cc^cYScccWacBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:19688:2484#0/1
CCTACCGCGATGCCAATGGTATTCAGTACAACG
+HWUSI-EAS1795_0092:3:1:19688:2484#0/1
hhhhhhhghghhhgghhhhchcfffffgfhhhh
@HWUSI-EAS1795_0092:3:1:1437:2502#0/1
AGAATATCAGGTCTTCAAAGGAGGCAGTCAATT
+HWUSI-EAS1795_0092:3:1:1437:2502#0/1
fhghhhhhhhhhhhhffghaghghfhhgdhhhe
@HWUSI-EAS1795_0092:3:1:2048:2499#0/1
CGATACTCCCGATGTGTCCAAGTACCAGTACGA
+HWUSI-EAS1795_0092:3:1:2048:2499#0/1
^d^ffcfcdddYaaXaadcdda_fffffffcff
@HWUSI-EAS1795_0092:3:1:2392:2505#0/1
TCTTCACATACTGGTAAACCAGACGACCACCGG
+HWUSI-EAS1795_0092:3:1:2392:2505#0/1
feebdbc\\\W\`aba`add\aacd^dfd_fff
@HWUSI-EAS1795_0092:3:1:2533:2497#0/1
ATGCGTGTGCGTGTGTTTCACTATTAAAGCACG
+HWUSI-EAS1795_0092:3:1:2533:2497#0/1
ffccffWaaaa^daddc\_Z_Zdfdddffdf[d
@HWUSI-EAS1795_0092:3:1:3576:2501#0/1
CTGGAGGATGTACTCTTTTGTAAGGAAGCTGCT
+HWUSI-EAS1795_0092:3:1:3576:2501#0/1
hhhhhhghhhhhhhhhhhhhhfhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:4515:2496#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:4515:2496#0/1
hhhfhhhhhfgghhahhhhhhhhghhffhhhfh
@HWUSI-EAS1795_0092:3:1:4804:2499#0/1
CGACTTACCGGAATCGACGTGTCCGATCACGAC
+HWUSI-EAS1795_0092:3:1:4804:2499#0/1
hhhhhhfhhhhhfhhghhhhghhhghfhhhghf
@HWUSI-EAS1795_0092:3:1:4922:2501#0/1
TGAAGCAGTACGACTCGAGGCCGTTCTTGGCGG
+HWUSI-EAS1795_0092:3:1:4922:2501#0/1
fggggggggggggfeggggggggggeggggggg
@HWUSI-EAS1795_0092:3:1:4968:2497#0/1
CGAAATATTAACTGTTTCATTTAAAATTTTTAT
+HWUSI-EAS1795_0092:3:1:4968:2497#0/1
hhhhhhhhhghhhhhhhghhhhfhhdhhhhhhh
@HWUSI-EAS1795_0092:3:1:5612:2497#0/1
GCGCCACTAGCAGCGGAGGAAGAAGCAGCAGCA
+HWUSI-EAS1795_0092:3:1:5612:2497#0/1
hhhhhhhghghfhhhhghhghdafffffhhhgh
@HWUSI-EAS1795_0092:3:1:5693:2498#0/1
AGATCACCTGCGATCCAATCAGCAACAACTAAT
+HWUSI-EAS1795_0092:3:1:5693:2498#0/1
ffcadaffdaffdffcfff[dafffffffccff
@HWUSI-EAS1795_0092:3:1:5763:2495#0/1
GTTCAATGCGCCATTTGCCACCACTGGCGAGAA
+HWUSI-EAS1795_0092:3:1:5763:2495#0/1
hhhhghhhghhhhhhhhghhhghhhhghhghhh
@HWUSI-EAS1795_0092:3:1:5977:2501#0/1
CCGGGGGAAAATGCAAATAGTTGTTTGTTTTGT
+HWUSI-EAS1795_0092:3:1:5977:2501#0/1
hhhhfhhhhhghghhghghhhghhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:7051:2500#0/1
CCGCCGACGAGTTGCTCAGCCATCCGTTCCTCA
+HWUSI-EAS1795_0092:3:1:7051:2500#0/1
hhhhhghghhhhhghhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7421:2504#0/1
TTGCGCAGGACAGGTGTTGGTGTTATACTACTA
+HWUSI-EAS1795_0092:3:1:7421:2504#0/1
hhhhhgchhchghhcghhhhhhhgfhhghgghh
@HWUSI-EAS1795_0092:3:1:7532:2494#0/1
CGTGGGAAGTCCCGAAGTGGTGGCTGCCGTGGC
+HWUSI-EAS1795_0092:3:1:7532:2494#0/1
gggfgg_gggggfgfffcfacfffac`BBBBBB
@HWUSI-EAS1795_0092:3:1:7959:2498#0/1
CAAGTATGCCCAGCGCCCCGCCAAGAACACCGT
+HWUSI-EAS1795_0092:3:1:7959:2498#0/1
hhhhhhhhhhhhehhghhhcheegfhfhhghhh
@HWUSI-EAS1795_0092:3:1:8084:2502#0/1
TGTGGATCCGTTTTTTTTTCTTTTTGGTTAGAT
+HWUSI-EAS1795_0092:3:1:8084:2502#0/1
hhhhhhhhhhhhhhhhhhhchhhhhcaffafah
@HWUSI-EAS1795_0092:3:1:8493:2494#0/1
CAGGAAACTTAGCACATTGTTCGTCTCGATGTC
+HWUSI-EAS1795_0092:3:1:8493:2494#0/1
gdgagggegggga]gggg_ggefeffagagggf
@HWUSI-EAS1795_0092:3:1:8627:2501#0/1
CGACTTCATATTCCCAGAAAATGGGCTGGTGCA
+HWUSI-EAS1795_0092:3:1:8627:2501#0/1
hhhhhhhhhhhhhhhhhhhhgehhhhhhhhghf
@HWUSI-EAS1795_0092:3:1:9446:2497#0/1
CTCTGGCGTACATAGCCTTGCTGGAGGCCGAGT
+HWUSI-EAS1795_0092:3:1:9446:2497#0/1
hhhhhhhhhhhhhhhghhhfhhhhhhfhhhhhh
@HWUSI-EAS1795_0092:3:1:9956:2496#0/1
CTGCCTTGCTTGGCCACTGCAATCTTAAGTGGA
+HWUSI-EAS1795_0092:3:1:9956:2496#0/1
hhghhhhhhhhhhhhhhhghhghhhhhhahghh
@HWUSI-EAS1795_0092:3:1:10894:2495#0/1
CCGGCGGAACCCTCTACTCCACCACTCCTGGAG
+HWUSI-EAS1795_0092:3:1:10894:2495#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhhhhhggh
@HWUSI-EAS1795_0092:3:1:11000:2495#0/1
ACTTTCGTTTCGGGGGTCACACGAAATTGGCAG
+HWUSI-EAS1795_0092:3:1:11000:2495#0/1
hhhhfhhhhhhhhhhgghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11161:2502#0/1
CTCGAATAAGCTGAATGAGAAATCACGAAGTCT
+HWUSI-EAS1795_0092:3:1:11161:2502#0/1
hhhhhhghhhhhhghhhghghhhhhhhfahggg
@HWUSI-EAS1795_0092:3:1:11225:2502#0/1
GGTCAGAAAATCGAAAGGCACGAAAGTAGGACA
+HWUSI-EAS1795_0092:3:1:11225:2502#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhehhhhhh
@HWUSI-EAS1795_0092:3:1:11261:2498#0/1
TGGAAACCTATAGGCTGCTCAAGCTGGCGGCGG
+HWUSI-EAS1795_0092:3:1:11261:2498#0/1
gggggggggggggggeec_dfffdgggaff]fd
@HWUSI-EAS1795_0092:3:1:11665:2502#0/1
CCCAATTCAACTAAATTCATCAATTGAATGATA
+HWUSI-EAS1795_0092:3:1:11665:2502#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:11831:2503#0/1
AAAAGCTTTACGCAAAAGCTCGCATCAGCTGTA
+HWUSI-EAS1795_0092:3:1:11831:2503#0/1
fcfaffcggfgdfcfffff]ffff_affffcfc
@HWUSI-EAS1795_0092:3:1:12191:2497#0/1
ACGAAGGTGACATTACCTTTACGGATTCATGTG
+HWUSI-EAS1795_0092:3:1:12191:2497#0/1
ggggg_gfdfcc[ff_fgggcgga]agggcegf
@HWUSI-EAS1795_0092:3:1:12306:2496#0/1
CTGCACTTGGATGTTGTGGGGGATCGGGTGGTG
+HWUSI-EAS1795_0092:3:1:12306:2496#0/1
hhhhhhhhghfhhhhhhhhhhhchhhhhehhef
@HWUSI-EAS1795_0092:3:1:12329:2504#0/1
GAAGGAGGAGAAGAAGGAGGAGTCCGAGTCCGA
+HWUSI-EAS1795_0092:3:1:12329:2504#0/1
hhhhhhhhhghhhhhhhfgcchhchhhhghchh
@HWUSI-EAS1795_0092:3:1:12538:2503#0/1
AGAGATTTGACGAATTGGATGCCCAGCAGGAAG
+HWUSI-EAS1795_0092:3:1:12538:2503#0/1
hhghhhhhhhhhhhhhhhhhhhhhghhfhhhhh
@HWUSI-EAS1795_0092:3:1:12816:2498#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:12816:2498#0/1
hgfhhhhhhhhhghhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:13973:2501#0/1
CTGGGAAGTGTTAACTGATCCAGCATTTGCTGC
+HWUSI-EAS1795_0092:3:1:13973:2501#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:14225:2504#0/1
GGCATAGTAATCGGTCTTTCCTTCGCGACGCCT
+HWUSI-EAS1795_0092:3:1:14225:2504#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:14559:2494#0/1
AAAATGCTGGACACCGATGTCATTACCGATTAT
+HWUSI-EAS1795_0092:3:1:14559:2494#0/1
hhhhhhghhhhhhhhhghghhfhfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14663:2495#0/1
GGGCAAGAAGTAGCTGGTTTGCTTCCACTCAAC
+HWUSI-EAS1795_0092:3:1:14663:2495#0/1
fcgagggcfacdfdcdafffffadfffgfgdcf
@HWUSI-EAS1795_0092:3:1:14743:2495#0/1
AGGTTGAAGCGTAAGCGCAGAAAGATGCGTGCA
+HWUSI-EAS1795_0092:3:1:14743:2495#0/1
hhghhhhhhghhhhhfhhhhhhhhhfhfhhfhh
@HWUSI-EAS1795_0092:3:1:14773:2504#0/1
CCCTATGGTAACTTTTCTGACACCTCTTGTTAA
+HWUSI-EAS1795_0092:3:1:14773:2504#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhghhhh
@HWUSI-EAS1795_0092:3:1:15378:2503#0/1
GTACAAGATATCCAAGCAGGTGGTGCCCAAGAC
+HWUSI-EAS1795_0092:3:1:15378:2503#0/1
hhfhhhfegghhhhhhhhhhghhhhhhhhhfaf
@HWUSI-EAS1795_0092:3:1:15572:2500#0/1
CGTAGGGCTCGAGGATCATTTCGGTGGCCACAG
+HWUSI-EAS1795_0092:3:1:15572:2500#0/1
fffffffgcfg_fffff_cfffcffffgggcag
@HWUSI-EAS1795_0092:3:1:15820:2498#0/1
CGCTTTGTGCCCACTGCATCGATTTCGTCGATG
+HWUSI-EAS1795_0092:3:1:15820:2498#0/1
ggggggggfggggggfgggggggggggggggcg
@HWUSI-EAS1795_0092:3:1:15924:2499#0/1
GGAAAAGCTGAAGAAGTTGCAGGCGCAGGTGCG
+HWUSI-EAS1795_0092:3:1:15924:2499#0/1
hhhhhhhhhhhhghhhhghhhhghfdhhfdgef
@HWUSI-EAS1795_0092:3:1:16032:2503#0/1
AAAACGGATTTGCTATATTAGGTCGTCCTGCCA
+HWUSI-EAS1795_0092:3:1:16032:2503#0/1
hhhfhggfhhhheahhghhhhahhhghddffff
@HWUSI-EAS1795_0092:3:1:16056:2496#0/1
GTGTATGGTGATAGCAACAGCGTCTTTAAGGTC
+HWUSI-EAS1795_0092:3:1:16056:2496#0/1
ffacfffdffffcfaafff[ffdfcfceb``[Z
@HWUSI-EAS1795_0092:3:1:16199:2496#0/1
TACGCTTCCGGCAGCACCAATATGTTTTATGTG
+HWUSI-EAS1795_0092:3:1:16199:2496#0/1
gggggggfdgffgggfdgggfdggfcgfeeefg
@HWUSI-EAS1795_0092:3:1:16484:2504#0/1
CGTCCACCTCTCGAGGATTACAGCACAAACACA
+HWUSI-EAS1795_0092:3:1:16484:2504#0/1
fagfggfdcgggf_ffdfffacdffffcaW[W_
@HWUSI-EAS1795_0092:3:1:16729:2503#0/1
GCTGGATACTGCTGCTTGTTGTTGTGATCCGTT
+HWUSI-EAS1795_0092:3:1:16729:2503#0/1
c^adeeecfa_fff[dcfffcfffcfafaafff
@HWUSI-EAS1795_0092:3:1:16899:2497#0/1
GGATCGCATCCTCTAGGGGTCGCTTAAGCTGAT
+HWUSI-EAS1795_0092:3:1:16899:2497#0/1
hhghgfhhhhhehhhghhhahhghhhhhhhffh
@HWUSI-EAS1795_0092:3:1:17081:2500#0/1
GCTGATCAAGCAGGGCGATATCGTCAAGCGTAC
+HWUSI-EAS1795_0092:3:1:17081:2500#0/1
gggg_ggcfdfcggggagfffgccadfaafffg
@HWUSI-EAS1795_0092:3:1:17358:2498#0/1
CGCTCGTCGCTCCTCTGGCAGATCCTCTGGTGT
+HWUSI-EAS1795_0092:3:1:17358:2498#0/1
gfgegggggfgdfdfeffacfaefffffff_fb
@HWUSI-EAS1795_0092:3:1:17664:2503#0/1
GTTAGCATCAATCAAGAGTTCCATTTAGTGGGC
+HWUSI-EAS1795_0092:3:1:17664:2503#0/1
hhghhhghhhhhhhhhhhhhhhhhhhhghhhgg
@HWUSI-EAS1795_0092:3:1:18112:2500#0/1
GTGGATATCGATAAGTCCGGTGATGAGCGCGCG
+HWUSI-EAS1795_0092:3:1:18112:2500#0/1
hhhhhhhhhhhdhhhhhhhhggdghfhhhhhhh
@HWUSI-EAS1795_0092:3:1:18650:2504#0/1
CGTGGATGAAGGTCAGCGAAATAGGTAGCAACA
+HWUSI-EAS1795_0092:3:1:18650:2504#0/1
ae`ae``edaea^^^^a`]d``MOQKU[ddaa]
@HWUSI-EAS1795_0092:3:1:19202:2501#0/1
CCGACTTCTTTTGGTCCAGCGTGATCTTGTGTT
+HWUSI-EAS1795_0092:3:1:19202:2501#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:19318:2495#0/1
GCCAGCTGCCACTTTGGAACAGTATCTCAGCAG
+HWUSI-EAS1795_0092:3:1:19318:2495#0/1
gggggegfggggagggddffe[ddafffgcfgg
@HWUSI-EAS1795_0092:3:1:19348:2503#0/1
CTGCGTTGAAGGTGGCAGCGTCCAGCTTACGTA
+HWUSI-EAS1795_0092:3:1:19348:2503#0/1
hhhhhhhhhhhhgghhhgghghhhghhhhhhhf
@HWUSI-EAS1795_0092:3:1:19379:2497#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19379:2497#0/1
fafgfgggfgdgfgaggggfggggggefaefec
@HWUSI-EAS1795_0092:3:1:19726:2503#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19726:2503#0/1
ggggeeggggafcffffggggecffffggfggg
@HWUSI-EAS1795_0092:3:1:1649:2514#0/1
AGTAAACATTTATTTTTAACTTTTTCGGTTTCG
+HWUSI-EAS1795_0092:3:1:1649:2514#0/1
UU\\J\\^ddd^fcccccd_ccccf\cffff^d
@HWUSI-EAS1795_0092:3:1:2145:2514#0/1
CGAATACGGAAAATATTCAAACGAGCTCTATGA
+HWUSI-EAS1795_0092:3:1:2145:2514#0/1
fg_ggggg_ggggfe`ggggcfggegggggagg
@HWUSI-EAS1795_0092:3:1:2355:2509#0/1
TGGACATCAAGGATCAGACATTCGCTGAGGCGC
+HWUSI-EAS1795_0092:3:1:2355:2509#0/1
gggaggef_fffa_fcf]ffcfgeaf_fdfffc
@HWUSI-EAS1795_0092:3:1:2723:2510#0/1
CGCCGATCCAAACAGAGTACTTGCGTTCTGGCG
+HWUSI-EAS1795_0092:3:1:2723:2510#0/1
fffffffgfggef_dffdcfffgggggfggegg
@HWUSI-EAS1795_0092:3:1:2776:2505#0/1
CGGAAGTGGTTTCTGGCGGTTTGCGTTTGTAGA
+HWUSI-EAS1795_0092:3:1:2776:2505#0/1
fffafffddfffdJddSccacc^Y\V^ac^acf
@HWUSI-EAS1795_0092:3:1:3433:2516#0/1
CCAAGGCCCAGATGTACAAGCGTCGTGCTCTGT
+HWUSI-EAS1795_0092:3:1:3433:2516#0/1
fcffff_aede^ffffac_add^c[Ydddade^
@HWUSI-EAS1795_0092:3:1:3451:2506#0/1
CTGAACGATAATTCCAGCAACGATAAACTTGTA
+HWUSI-EAS1795_0092:3:1:3451:2506#0/1
cccc^c\NSRTTaa\aSQ\X\\cacYY___W\a
@HWUSI-EAS1795_0092:3:1:4257:2507#0/1
GTATTGGGCAATTTTAATTTTACGCAATGGGTC
+HWUSI-EAS1795_0092:3:1:4257:2507#0/1
hhhhhhhhhhfhhhhhhhhhhhhgehghhgdhh
@HWUSI-EAS1795_0092:3:1:4450:2509#0/1
AATTAACACCTGAAAACGAAAATCCAACTGGAA
+HWUSI-EAS1795_0092:3:1:4450:2509#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhghhhhh
@HWUSI-EAS1795_0092:3:1:5134:2511#0/1
GAGTAGAGTTCTCCAGCTCGTTGGCCAATATTT
+HWUSI-EAS1795_0092:3:1:5134:2511#0/1
hhhhhghhhhhhhhhhhhhhghhfhhhghhhhh
@HWUSI-EAS1795_0092:3:1:5533:2516#0/1
GCGCATCTAGTAAAGACGCTGGGGGGGTCCCAT
+HWUSI-EAS1795_0092:3:1:5533:2516#0/1
ffcffffdccffcd[ddd]d]d_BBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5896:2507#0/1
GTCGCTATCACTGCCATCATCCTCAACGCGGAC
+HWUSI-EAS1795_0092:3:1:5896:2507#0/1
hhhhhhhhhhhhhhhhhhhhhffhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5938:2512#0/1
AGTTGATCAACGTGTACACACCATCTAAAATCC
+HWUSI-EAS1795_0092:3:1:5938:2512#0/1
ghhhhhhhghhhhfhhhhhhhhhhhhhhhffha
@HWUSI-EAS1795_0092:3:1:8110:2512#0/1
GTGCCGCGGACAGCAATCACATCGAATAATCTG
+HWUSI-EAS1795_0092:3:1:8110:2512#0/1
hhhhhhhhhhhhfghhgghhhghhhgggghhhf
@HWUSI-EAS1795_0092:3:1:8320:2514#0/1
CAGCAGCGGATCTTTTACATAAATACCCTTATC
+HWUSI-EAS1795_0092:3:1:8320:2514#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8656:2509#0/1
CCAGTGCTTGCAAAACGTTGTTATTTGTCAATT
+HWUSI-EAS1795_0092:3:1:8656:2509#0/1
hhhhhhhghhhghhhhhhhfhghhhfhhghdhh
@HWUSI-EAS1795_0092:3:1:8745:2507#0/1
CCGGGACTCAAAGAGATGTTCGAGCTTCTGTGT
+HWUSI-EAS1795_0092:3:1:8745:2507#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8766:2514#0/1
CATCAAGCGGGTGACGGAGATTAAGGAGAAACG
+HWUSI-EAS1795_0092:3:1:8766:2514#0/1
hhhhhhhghhhgfffffghhehhhhffahhfhh
@HWUSI-EAS1795_0092:3:1:9141:2509#0/1
CGCATATAGTCTGCAACGTGCTGGCCAAATATA
+HWUSI-EAS1795_0092:3:1:9141:2509#0/1
aa_aa_`\Y_\YXYZZZacc\Waaaa^f[ff_d
@HWUSI-EAS1795_0092:3:1:9463:2506#0/1
GCTTGCGGTCAGTTTGCGATAGTGTGCGCAAAT
+HWUSI-EAS1795_0092:3:1:9463:2506#0/1
ffcc]_faa^acd]b]d\[\ZZdbbadf_ff]Z
@HWUSI-EAS1795_0092:3:1:9560:2507#0/1
CCTGGGGTTAGTCAATAATCCGATAGGAAAGCA
+HWUSI-EAS1795_0092:3:1:9560:2507#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9836:2509#0/1
GTTATCATATGGGTGTTGTAGCTTAAAAGATCC
+HWUSI-EAS1795_0092:3:1:9836:2509#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:10298:2510#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:10298:2510#0/1
cgfgeagggdggefgggggggggeggggggggg
@HWUSI-EAS1795_0092:3:1:10856:2506#0/1
GCGGGAGAGTGAACGATGGTTTTCGTGATGAAC
+HWUSI-EAS1795_0092:3:1:10856:2506#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhfhfhhf
@HWUSI-EAS1795_0092:3:1:11522:2510#0/1
TGCCTGTACATCCGAGTTCATCAGAGCGAACTG
+HWUSI-EAS1795_0092:3:1:11522:2510#0/1
hhhhhghhhhhhhhhghhfhhhhhghhhhhagh
@HWUSI-EAS1795_0092:3:1:11564:2514#0/1
GCACGCTCCTGGCAAGGGTATTTCCCAATCAGC
+HWUSI-EAS1795_0092:3:1:11564:2514#0/1
hhhhhhhhhhhfhhhghhbhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12136:2511#0/1
CTAAACTACATCAGTTCTGCTCTAGACCAGGGG
+HWUSI-EAS1795_0092:3:1:12136:2511#0/1
hhhhhhhhhghhhghhhhgfhhghhhhgfhhhh
@HWUSI-EAS1795_0092:3:1:12345:2511#0/1
GTCAAGTTAAATATTTATTATTCAAATATTAAT
+HWUSI-EAS1795_0092:3:1:12345:2511#0/1
ggggfgffffffgfgggggeggfggggdgggcg
@HWUSI-EAS1795_0092:3:1:12637:2515#0/1
ATTCCGGTGACTTCCGCAATCCTATGGACTTCT
+HWUSI-EAS1795_0092:3:1:12637:2515#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12953:2510#0/1
CAGAAAGATGCGTGCAAGGTCCAAGTAAGCGCA
+HWUSI-EAS1795_0092:3:1:12953:2510#0/1
hhhhhhhhhghhhhhhhhhhhhhhhhhfhhhgh
@HWUSI-EAS1795_0092:3:1:13005:2508#0/1
CCTTTTCAATGTTGTACTTCTCGAGGGCCTGTG
+HWUSI-EAS1795_0092:3:1:13005:2508#0/1
ggfggggggfgggggfgggggggggggggcfgg
@HWUSI-EAS1795_0092:3:1:13563:2515#0/1
GGCAAGTTGAAGGTGCCCGACCAGATGGACATC
+HWUSI-EAS1795_0092:3:1:13563:2515#0/1
hhhhghhhghhhhhhhghhghhhggfhhhccch
@HWUSI-EAS1795_0092:3:1:13767:2513#0/1
ATCTGCTACTGCGCCTTGCGCTCCACGGACGCT
+HWUSI-EAS1795_0092:3:1:13767:2513#0/1
fffffffadWa\aaaZ^cdcdafaffafc_aca
@HWUSI-EAS1795_0092:3:1:14316:2506#0/1
TGCCTTTTTGCCCACTCGCGGTATAACCACATC
+HWUSI-EAS1795_0092:3:1:14316:2506#0/1
hhhhghhhhhhhhhhhhfgggeghhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:14575:2508#0/1
CATCGGGTCCCATGCCAAGCAGCAGCAGATCGA
+HWUSI-EAS1795_0092:3:1:14575:2508#0/1
hhhhhhhhhhhhhhhhgfgcghgeghhhhhfhh
@HWUSI-EAS1795_0092:3:1:15038:2514#0/1
CCACAACAAAAGTCGTGCAAGCAGAACCCAAAA
+HWUSI-EAS1795_0092:3:1:15038:2514#0/1
ggggggggggggggggaffdcfcgggdgfgfgg
@HWUSI-EAS1795_0092:3:1:15239:2512#0/1
CACCAACATTGCTGAGGATAGCATCATGGATGT
+HWUSI-EAS1795_0092:3:1:15239:2512#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghfhhhhg
@HWUSI-EAS1795_0092:3:1:15644:2510#0/1
GGGATAATGAAATAAGACCTCTGTTCTGCTTTC
+HWUSI-EAS1795_0092:3:1:15644:2510#0/1
hghhhhhhhhhhhhhghhhhhhhghhhghhhhh
@HWUSI-EAS1795_0092:3:1:16537:2508#0/1
GCCGGATGCGCAGGCGCACGTCTTCAACAAGGA
+HWUSI-EAS1795_0092:3:1:16537:2508#0/1
hhhhhhhhhhghhhhhhehhfhhhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:17464:2512#0/1
CAGATTCCTCGTTTGCTTGGCCCTGGCTTGAAC
+HWUSI-EAS1795_0092:3:1:17464:2512#0/1
hhghhhhhhhhhhhhghhghhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:17728:2514#0/1
CCGAACTTTTCGGTATTTGGAATAATCTGACCA
+HWUSI-EAS1795_0092:3:1:17728:2514#0/1
hhhhhhhhhhhhhhghhhfhehhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:18024:2507#0/1
CGCGTGCTGGGCTTTGTATTGCTGCGCGGCGAG
+HWUSI-EAS1795_0092:3:1:18024:2507#0/1
hhhhhhhhhhhhhhhhhhhhfhhhhghhghhgh
@HWUSI-EAS1795_0092:3:1:19502:2509#0/1
GCTGTCGCAGTGCTCGATGTCTGGCAGCCTCAA
+HWUSI-EAS1795_0092:3:1:19502:2509#0/1
ff]ggggggfaacfffcggffg[ffffggcfgg
@HWUSI-EAS1795_0092:3:1:1569:2524#0/1
TGTCGCGGAAGTACTCTCCCATGGCGCATCCGG
+HWUSI-EAS1795_0092:3:1:1569:2524#0/1
ggffaac^^aa^cfffffff]ff\ffff_cfac
@HWUSI-EAS1795_0092:3:1:2168:2522#0/1
ACTACATCTACGACCACTCCGTCTCCGAACTCG
+HWUSI-EAS1795_0092:3:1:2168:2522#0/1
daac^a^c\cYY_aa\^_a`ab^accaZZOZ_a
@HWUSI-EAS1795_0092:3:1:2563:2526#0/1
GTGGCCAGTGGTATCTATTGGTTATTGGTGGAT
+HWUSI-EAS1795_0092:3:1:2563:2526#0/1
gggefedfcffcfffffggggefafffebeca^
@HWUSI-EAS1795_0092:3:1:3993:2525#0/1
GAGATCGGAAGAGCGGTTCAGCAGGAATGCCGA
+HWUSI-EAS1795_0092:3:1:3993:2525#0/1
dcddcdddfcfKYPYOVZW_``d[d\\cad\cd
@HWUSI-EAS1795_0092:3:1:4065:2524#0/1
CGCTGGTGGGCAGCATTGCCACGCAATATTTGC
+HWUSI-EAS1795_0092:3:1:4065:2524#0/1
ghhhhhhhhhhggchhgfhhghcghhhhhhhhf
@HWUSI-EAS1795_0092:3:1:5466:2519#0/1
GTGGCCTTGTTCAGCTTGATGAACACACCGTTG
+HWUSI-EAS1795_0092:3:1:5466:2519#0/1
hhghghhhhhhhhhhhhgghhhhhhhhhhhhfd
@HWUSI-EAS1795_0092:3:1:5629:2527#0/1
GTCGCCGCGTCATTATTTGACATTGTTTTTCGA
+HWUSI-EAS1795_0092:3:1:5629:2527#0/1
hhhhhhhhhhhghhehhhhghghhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5776:2517#0/1
CAAAGAAGCGCGCCAAGATCGAGAACGCCGCCG
+HWUSI-EAS1795_0092:3:1:5776:2517#0/1
hhhhhhghghhhhhhhhghhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5823:2517#0/1
AGATGACCGCCCCCGGGCCACGCCCCCTTGTCC
+HWUSI-EAS1795_0092:3:1:5823:2517#0/1
hhhhhhhhhhhhhhghhhchccfhhhhhgghhh
@HWUSI-EAS1795_0092:3:1:5982:2528#0/1
TGGGCAACTGCGGAGCTCCCACCTTGGAGGCCT
+HWUSI-EAS1795_0092:3:1:5982:2528#0/1
hhhhhhehhghhhhhhghhhhhhhhhehdffhh
@HWUSI-EAS1795_0092:3:1:6137:2524#0/1
CGAGGTCCTGGTTGCCGGTTTCGGTCGTAAGGG
+HWUSI-EAS1795_0092:3:1:6137:2524#0/1
hhhhhhhhhhhhhghhhhhhhghhfgfhhhhhg
@HWUSI-EAS1795_0092:3:1:6280:2522#0/1
ATCGGAATTAACCAGACAAATCACTCCACGAAC
+HWUSI-EAS1795_0092:3:1:6280:2522#0/1
ggfgggggggdgge]ggggg_effffcgggfff
@HWUSI-EAS1795_0092:3:1:6722:2517#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6722:2517#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhahhhhhh
@HWUSI-EAS1795_0092:3:1:7088:2524#0/1
CACCAATGAAACCATAAACAAAGCGCTTACCCA
+HWUSI-EAS1795_0092:3:1:7088:2524#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7247:2527#0/1
GCTATTCCCAAAAGCTGCTGGTTATGCGTTAGT
+HWUSI-EAS1795_0092:3:1:7247:2527#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7593:2519#0/1
CTCGTCGATGAGTACCAGAGGATTTTCAATCTT
+HWUSI-EAS1795_0092:3:1:7593:2519#0/1
hhhhhhgdhhffhhhhhhgghhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:7621:2517#0/1
TCGGCTGCCACTTCGAAACAGCGCACTTCAGCA
+HWUSI-EAS1795_0092:3:1:7621:2517#0/1
hhhhfhhhhhhhhhhhhhhhghhfhhhhhghhh
@HWUSI-EAS1795_0092:3:1:7799:2521#0/1
GAAAAGAAAGCGAGATGATCACCTGAATGAAAG
+HWUSI-EAS1795_0092:3:1:7799:2521#0/1
hhhhhhhhhhhhhhghhghhhhghhhhghhhgh
@HWUSI-EAS1795_0092:3:1:8170:2523#0/1
TGCCAGAGCTCTCAGGAGTTGACCTGTGGCGAG
+HWUSI-EAS1795_0092:3:1:8170:2523#0/1
hhhhhhhhhhhhhhhhghhhhhhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:8262:2521#0/1
TGCGTGTTGTTGTTGTTGTTGAGTGGAAGCAAA
+HWUSI-EAS1795_0092:3:1:8262:2521#0/1
ggggggggggggggggggggg_fgggggggggg
@HWUSI-EAS1795_0092:3:1:8461:2518#0/1
ATTTATCGCCAGCCTGGAACTCGGCCACCAACA
+HWUSI-EAS1795_0092:3:1:8461:2518#0/1
hhhhhhhhfhhghghhhhgdfhhgghdhggghh
@HWUSI-EAS1795_0092:3:1:8976:2523#0/1
GCTAAAGTCGGTGTGTGGTTCGATTACAACAAT
+HWUSI-EAS1795_0092:3:1:8976:2523#0/1
hhghhhfhhhhgfffddfhheeghhhghhhhhg
@HWUSI-EAS1795_0092:3:1:9018:2517#0/1
CCTACACCCTGACCTCCAACATTCCCGAAATCT
+HWUSI-EAS1795_0092:3:1:9018:2517#0/1
hhhhhhhhhhhhhhhhghhhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:9218:2523#0/1
TGTAAAGGGTGTGAGGGAGCTTAGATTCTTCAA
+HWUSI-EAS1795_0092:3:1:9218:2523#0/1
hhhhhhhhhhhhhhhhhhhghhfhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9697:2521#0/1
CGCTGGCATCGTTTATGGTTAGAACTAGGGCGG
+HWUSI-EAS1795_0092:3:1:9697:2521#0/1
hhhhhhhhhhhhhhghhhhhgfghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10609:2523#0/1
CGCGGATTAGGTCCGATAGAGTCGCAGTTCGGA
+HWUSI-EAS1795_0092:3:1:10609:2523#0/1
hhhgghhhhhhhhhhhhhhhhdhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:10729:2527#0/1
CTTTTCAAGTGTTTTAAAAGCTCCGTCAAAATG
+HWUSI-EAS1795_0092:3:1:10729:2527#0/1
ddcb``fadd`effcfadfgecdfcf^ffcfcg
@HWUSI-EAS1795_0092:3:1:10797:2526#0/1
CGGCCCATTGTGTCCAAGCACTCGGTGCTATCC
+HWUSI-EAS1795_0092:3:1:10797:2526#0/1
hhhhhhhhhhhhhhgghghghhhhhfgghghhh
@HWUSI-EAS1795_0092:3:1:11043:2522#0/1
CTCCGGGAACAATTTCGCAATGGTGGTGGATCG
+HWUSI-EAS1795_0092:3:1:11043:2522#0/1
hhhhhhhghhhhhhhhhghhhhhdhffhfhhhh
@HWUSI-EAS1795_0092:3:1:11336:2517#0/1
TGGGATTCAGTCTAATTTAACCATCGACAGCGG
+HWUSI-EAS1795_0092:3:1:11336:2517#0/1
hghhhghhhhhghhghhhhhhhhhhfhhhhhhg
@HWUSI-EAS1795_0092:3:1:11489:2518#0/1
TTTGGCTTGGACAGCAAGCTGGTCTATTCAAAG
+HWUSI-EAS1795_0092:3:1:11489:2518#0/1
ggggggggcgccfff_f]ccee^a^\cfccfff
@HWUSI-EAS1795_0092:3:1:11880:2528#0/1
CCTCGGGATCGGCATCGGGATTCTGTTCCAGCC
+HWUSI-EAS1795_0092:3:1:11880:2528#0/1
hhhhhhhghhhhhhhhhghdhhhhfhhhhhehh
@HWUSI-EAS1795_0092:3:1:12502:2525#0/1
GGGGTTTCGAACAATCCGAGCGTTATCTGAACC
+HWUSI-EAS1795_0092:3:1:12502:2525#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:13064:2523#0/1
CATCGATGCCACGCCCTTCCGCCAGTGGTACGA
+HWUSI-EAS1795_0092:3:1:13064:2523#0/1
hhhhhhhhhhhhhhhhghhhfhhhhghhghheh
@HWUSI-EAS1795_0092:3:1:13302:2525#0/1
GGCATTGAAAAATATAGGCTGCACATTCGCATA
+HWUSI-EAS1795_0092:3:1:13302:2525#0/1
ggggggfgeggggcfgeggfgggggggggcggg
@HWUSI-EAS1795_0092:3:1:13521:2522#0/1
TATGCGTTCAACATGATGGTAAACGTGGCTACG
+HWUSI-EAS1795_0092:3:1:13521:2522#0/1
hhhhhhhhhhhhhhhghhhhhhhghhhhhfhhh
@HWUSI-EAS1795_0092:3:1:13623:2523#0/1
AAAGTCTAACCTGCCCACTGAAAATTTTAAATG
+HWUSI-EAS1795_0092:3:1:13623:2523#0/1
hhfhhhhhhhhhhhhhghhffhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14423:2524#0/1
CTCGAAGTTAGGTACGGTCTGTCCCAAACGCAT
+HWUSI-EAS1795_0092:3:1:14423:2524#0/1
hhhhhhhhhhhhhhhhghhfghhhhhhhhfhgh
@HWUSI-EAS1795_0092:3:1:15127:2520#0/1
CACATCCTTGCCCTTGGCCTTAGCCTCGGCGAT
+HWUSI-EAS1795_0092:3:1:15127:2520#0/1
hhghhhhhghhhhhhefhhhhhghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:15211:2519#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:15211:2519#0/1
hhhhhhhhhhhgfhghhhhhhgghhgghehhhh
@HWUSI-EAS1795_0092:3:1:15727:2520#0/1
CTTTGATTGGATTTAATTGATTTTAATTTTTTA
+HWUSI-EAS1795_0092:3:1:15727:2520#0/1
hhhhhhhhhhfhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16787:2520#0/1
GGGCAGGTTAGACTTTATATATAATTCAAAAAG
+HWUSI-EAS1795_0092:3:1:16787:2520#0/1
cgf\fdfdfffaffff^ggfdggggegggcgga
@HWUSI-EAS1795_0092:3:1:16951:2517#0/1
CTCGTCTTTTAAATAAATTTTAGCTTTTTGACT
+HWUSI-EAS1795_0092:3:1:16951:2517#0/1
hhhhhhhhhhhhhhhhhhhhhhhghhhhhhhgh
@HWUSI-EAS1795_0092:3:1:17148:2519#0/1
GTGGAAAGCGGCTGGCGACGGCTTTGTTTCTGT
+HWUSI-EAS1795_0092:3:1:17148:2519#0/1
ffffffdfffffdffaa]^`a]^ffcdcd`dd]
@HWUSI-EAS1795_0092:3:1:17568:2526#0/1
TGCAGGAGTGCGCACAATCTTTGTTTTTCTTCG
+HWUSI-EAS1795_0092:3:1:17568:2526#0/1
hhhhhhhhhghhhhhhhhhhhhghhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:17705:2522#0/1
AGATGATCTGCCGCAAGTGCTACGCCCGTCTGC
+HWUSI-EAS1795_0092:3:1:17705:2522#0/1
ghghhghhahhggghhhhhhhhfhhhhgffhhg
@HWUSI-EAS1795_0092:3:1:18090:2521#0/1
AAGACCACAACGGTACCGGGCTTCAGCACACCA
+HWUSI-EAS1795_0092:3:1:18090:2521#0/1
fgggggfgggggggdggffdffggcgfggggdf
@HWUSI-EAS1795_0092:3:1:19102:2518#0/1
CGGCAAAGTCACGGGCCACCTCCACGTCGTCCG
+HWUSI-EAS1795_0092:3:1:19102:2518#0/1
gggfgWgadfaffacff]fc_ffca]cdfdfdb
@HWUSI-EAS1795_0092:3:1:1334:2535#0/1
GGCCATCGGAGTTGCTCCGTCGAAGGGCAGGAC
+HWUSI-EAS1795_0092:3:1:1334:2535#0/1
b`fffff_a_cfhhffhhhdff_cdc_f_ffaf
@HWUSI-EAS1795_0092:3:1:2716:2531#0/1
GACGGCAGCAGCGCCCGCCACCACCTGTCGACC
+HWUSI-EAS1795_0092:3:1:2716:2531#0/1
fcfdffac\_ccadfffQUU]]aa^ZbfffWd\
@HWUSI-EAS1795_0092:3:1:3086:2534#0/1
CAGCTACCTCCACCTGCCGCCCGAGATCGTGCC
+HWUSI-EAS1795_0092:3:1:3086:2534#0/1
hhhhhhhhhhhhghhhhhhhhhcdfcdghdghh
@HWUSI-EAS1795_0092:3:1:3794:2530#0/1
CCGGCAAGAAGCCCCAGTCCGTGCTGGCCAAGC
+HWUSI-EAS1795_0092:3:1:3794:2530#0/1
gggfggfgggaefffffgggeeggfgdgfeegg
@HWUSI-EAS1795_0092:3:1:4707:2534#0/1
CAAGGGATCTCAAAAAAAGGTTCAAAACCCTAT
+HWUSI-EAS1795_0092:3:1:4707:2534#0/1
hhhhhhchfhhhhhhhghhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4865:2537#0/1
CGGCGTGCGAACAATGCGCCGCTTGTTGGAGCG
+HWUSI-EAS1795_0092:3:1:4865:2537#0/1
ggggggggggggggdcggggedggfggggaggg
@HWUSI-EAS1795_0092:3:1:5173:2529#0/1
GGCTGGGGGAAGGATGGCATCGAGGGCATCGAT
+HWUSI-EAS1795_0092:3:1:5173:2529#0/1
gggggggdf_cfc`bdddfd_ffffddadffcd
@HWUSI-EAS1795_0092:3:1:5367:2532#0/1
CGACGACTGCGTGCGGAAGCCAGAATCCTAAAA
+HWUSI-EAS1795_0092:3:1:5367:2532#0/1
ggfafffafcfff_ffYff_affdffffdfff_
@HWUSI-EAS1795_0092:3:1:5472:2540#0/1
GTGAGTTGTTACACACTCCTTAGCGGATTTCGA
+HWUSI-EAS1795_0092:3:1:5472:2540#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6346:2534#0/1
CGCCCTCCAAGTTGGTAATCAGTACGGATTCAG
+HWUSI-EAS1795_0092:3:1:6346:2534#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:6473:2539#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6473:2539#0/1
ecfeafefaf^fad^cff^fffadfdae[da^e
@HWUSI-EAS1795_0092:3:1:6572:2531#0/1
GTTTGGTGCAACTGTTTATGTGCATATTAAAAA
+HWUSI-EAS1795_0092:3:1:6572:2531#0/1
hhhhhhhhhhhhhghhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6636:2530#0/1
TGATCATGTTCCTCAGGTGGGTCTTGACAATCT
+HWUSI-EAS1795_0092:3:1:6636:2530#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7718:2528#0/1
ATGCGAGAAGGTCCTGCCAAGAACTCCGTGAAA
+HWUSI-EAS1795_0092:3:1:7718:2528#0/1
hhghhhdhghgghhhhhfhhehhhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:7785:2540#0/1
GGCCTCCATGATGGGCTGGTGATCGGTGTTGGG
+HWUSI-EAS1795_0092:3:1:7785:2540#0/1
hghhhhhhhgghhghhhhhhhhhhhhehhhhhh
@HWUSI-EAS1795_0092:3:1:8105:2534#0/1
CTCATCGTCGCTCAGCTTGGCGCCCAGCTTGTC
+HWUSI-EAS1795_0092:3:1:8105:2534#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:8552:2536#0/1
CAAACACTCCCAGAAACAACAGGCTCGAATATA
+HWUSI-EAS1795_0092:3:1:8552:2536#0/1
hhhhhhhhhhgfhgfhhhgcfhfhghhhhafcf
@HWUSI-EAS1795_0092:3:1:8772:2531#0/1
GGAAGACAAAGATGTGTCGCCCCTCAGGCACAG
+HWUSI-EAS1795_0092:3:1:8772:2531#0/1
gedgcgffggggcagggggggfgcg`ggggfcg
@HWUSI-EAS1795_0092:3:1:8831:2529#0/1
AGGTAGTCCACCAGGTGGTAGTGGTTGTAGGGC
+HWUSI-EAS1795_0092:3:1:8831:2529#0/1
ghhhhhhhhhhhhhhghfdfffhhhhhehhhhh
@HWUSI-EAS1795_0092:3:1:9335:2529#0/1
GCGGGTTTGTCCTTGATTCTGGTGCTAGTGACC
+HWUSI-EAS1795_0092:3:1:9335:2529#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9926:2530#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9926:2530#0/1
gggcgfggggggdffffggggg^dfdffffffg
@HWUSI-EAS1795_0092:3:1:10056:2533#0/1
CGCTGCTTATTCCCATGAGCTTCCCAAATACGG
+HWUSI-EAS1795_0092:3:1:10056:2533#0/1
hhhhhhhhhhhhghhhfhghhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:10544:2530#0/1
ATTGTCCCACATCTTATATTTCAACATCATTCT
+HWUSI-EAS1795_0092:3:1:10544:2530#0/1
hhhhhhhhhhhhhhhhhhhhhdhhhhfhgghhh
@HWUSI-EAS1795_0092:3:1:11207:2537#0/1
CATGCCTGCGTTTCCCCGGCCAGCTGAACGCCG
+HWUSI-EAS1795_0092:3:1:11207:2537#0/1
hhhhghhhhhhhhhhhhghhhgheaehgghhhh
@HWUSI-EAS1795_0092:3:1:11396:2536#0/1
GATTCGATACGGCGGTCAGTCCGCATCCGCATC
+HWUSI-EAS1795_0092:3:1:11396:2536#0/1
fffffffffffffdf]aPVS^ZGRJJS_OZ\Zf
@HWUSI-EAS1795_0092:3:1:11617:2532#0/1
GTTAAGTGATAAGAAATTCCTTTCTTAACACAA
+HWUSI-EAS1795_0092:3:1:11617:2532#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12252:2529#0/1
CGTACCTGTTGGTTTGTCCCATTATAAGGACAC
+HWUSI-EAS1795_0092:3:1:12252:2529#0/1
hhhhhhhhhhhhhhhfhhhhghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:12816:2529#0/1
CGAAAGTGGAAAACCATTTTAAATTTACACGAT
+HWUSI-EAS1795_0092:3:1:12816:2529#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:13103:2529#0/1
TAACTAATCCATTAACTAGGCCGATTTAGGACC
+HWUSI-EAS1795_0092:3:1:13103:2529#0/1
hgghhfhhfhhhghhghhghghhghhhahghhh
@HWUSI-EAS1795_0092:3:1:13984:2533#0/1
CCGGGCAGGTAGTAGAAGTCAACCATTTTAATT
+HWUSI-EAS1795_0092:3:1:13984:2533#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14126:2533#0/1
CTTGGAGCGTCGTCTGCAGACGCAGGTGTTCAA
+HWUSI-EAS1795_0092:3:1:14126:2533#0/1
hhhhhhhhhhhhghhhhhfghhhahhbfffffh
@HWUSI-EAS1795_0092:3:1:14523:2535#0/1
GGTTTCTTATCGGGGAACCCCAGCGATTGAGCT
+HWUSI-EAS1795_0092:3:1:14523:2535#0/1
hhhhhhhhhghhhhhghhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:14917:2539#0/1
CCGGCATCCAAAATAAAGCAATCACCCGTGTTC
+HWUSI-EAS1795_0092:3:1:14917:2539#0/1
cggeggggggggfggggfggfgggggggddfaf
@HWUSI-EAS1795_0092:3:1:15021:2529#0/1
CCCAGACCTTCCTTGACGAACTGGCGGAATCGT
+HWUSI-EAS1795_0092:3:1:15021:2529#0/1
hhhhhhhhfhhhhhghhhhghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15557:2532#0/1
CGCGCGTGCAGCCCAGGACATCTAAGGGCATCA
+HWUSI-EAS1795_0092:3:1:15557:2532#0/1
gggggggggggggggggggfgggggggdgfgff
@HWUSI-EAS1795_0092:3:1:16121:2535#0/1
GCGGGGTATTGTGGCGCCGTAGTATACTAAAAT
+HWUSI-EAS1795_0092:3:1:16121:2535#0/1
hhhhhhghhhfhhhhaghhhhhhhghghhhhhh
@HWUSI-EAS1795_0092:3:1:16765:2533#0/1
CTTGCTAATCGACCCATCGTTTTACTTTCGTAT
+HWUSI-EAS1795_0092:3:1:16765:2533#0/1
hhhhhhhhhhhhhhhhhhghhhhhghhhhfhhh
@HWUSI-EAS1795_0092:3:1:16881:2532#0/1
GGGGTGAGAATGAACGAGACCAATTCGACAGTT
+HWUSI-EAS1795_0092:3:1:16881:2532#0/1
hghhhhhhhhhhhgghaghhhhhhggfghdghg
@HWUSI-EAS1795_0092:3:1:17041:2532#0/1
GCGCTCACTCATCCAGCGAGCCAACCATGCACC
+HWUSI-EAS1795_0092:3:1:17041:2532#0/1
hfhhhhhhhhhhhhhhfhhfhhhhhgdhhghhh
@HWUSI-EAS1795_0092:3:1:17587:2534#0/1
CAAAGGTCTAAAATACTTCGAAAATGTATCTGA
+HWUSI-EAS1795_0092:3:1:17587:2534#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:18284:2532#0/1
CTCGTCTTTTAAATAAATTTTAGCTTTTTGACT
+HWUSI-EAS1795_0092:3:1:18284:2532#0/1
hhhhhhhhhhhhhhhhghhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18574:2536#0/1
CAAGGAAGTTCTGGGAACCGCCCAGAGCGTCGG
+HWUSI-EAS1795_0092:3:1:18574:2536#0/1
gggggggfgggfdgfggggcggfggcgggeggf
@HWUSI-EAS1795_0092:3:1:18616:2539#0/1
TGCTGCTGTTGTTGTTGTTGGTCTAAATGAGGG
+HWUSI-EAS1795_0092:3:1:18616:2539#0/1
ggggggggggfgggggfgggggggggggggggg
@HWUSI-EAS1795_0092:3:1:18656:2536#0/1
TCAAGAATTACGTTCTTTGATTCCTGCTGTCCG
+HWUSI-EAS1795_0092:3:1:18656:2536#0/1
hhhhhhhhhhhhhghhhhghhhhhhhhgdhghh
@HWUSI-EAS1795_0092:3:1:18791:2536#0/1
GCCCGGTGTGGGATATACATCTTGGGACACACA
+HWUSI-EAS1795_0092:3:1:18791:2536#0/1
hhhhhhhhhhhhhhfhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:1885:2548#0/1
GGTGAGGTGGCCTTTGAGGGACGCCCACTATCT
+HWUSI-EAS1795_0092:3:1:1885:2548#0/1
cfdffacdacedffafafffa_[daaafafaac
@HWUSI-EAS1795_0092:3:1:2413:2545#0/1
CCACGACGATGGAACCCCGGAGAAGCCCTTCGG
+HWUSI-EAS1795_0092:3:1:2413:2545#0/1
gagggdggggcgafdffggfggf[accdac]fd
@HWUSI-EAS1795_0092:3:1:2451:2549#0/1
GACCAGTTTCTTCCAGGCCCTGTCCATCCCGAC
+HWUSI-EAS1795_0092:3:1:2451:2549#0/1
ggggggggggggggffgggggcgggfffdfffd
@HWUSI-EAS1795_0092:3:1:3392:2550#0/1
GGCAGACGCAGGGCCTTGTCGGTGGGACGGGCT
+HWUSI-EAS1795_0092:3:1:3392:2550#0/1
gfggggggfggggggggfffff`bd`]cfffcd
@HWUSI-EAS1795_0092:3:1:3690:2543#0/1
CGAAACTGAAGCCAACTGAACGCAAAGAGTTGG
+HWUSI-EAS1795_0092:3:1:3690:2543#0/1
ff[_afdZX_a\VVZVV^_Y\\ddcRd]]NZb^
@HWUSI-EAS1795_0092:3:1:4288:2548#0/1
AAAAGATCTTCAAGCAAATCGACTTCAATGAGT
+HWUSI-EAS1795_0092:3:1:4288:2548#0/1
hghchfhhhhehhhfhchghhghcfhh_hhfhh
@HWUSI-EAS1795_0092:3:1:4822:2546#0/1
GCAGCAGCCATTATTTAGCAATTTCCCTGGTCG
+HWUSI-EAS1795_0092:3:1:4822:2546#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5198:2547#0/1
GCGTACTCCGGAAGTTCCTCTGTGGATGCGTAA
+HWUSI-EAS1795_0092:3:1:5198:2547#0/1
`]a^aO^a\aa\Z\a_ZSZVV]U_\TWZS\U_U
@HWUSI-EAS1795_0092:3:1:5619:2545#0/1
TTCAGTTTCAGCCAGGATGGGACAGTGCGTCTG
+HWUSI-EAS1795_0092:3:1:5619:2545#0/1
hhhhhhhhghhhgdhh_hhhhhffhhhhghhhh
@HWUSI-EAS1795_0092:3:1:5696:2545#0/1
AAAATATCACAATTTTTTAAAGATAGAAACCAA
+HWUSI-EAS1795_0092:3:1:5696:2545#0/1
hfhhghhghhhfghhhhhchhhghhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:6142:2544#0/1
TTCGCTTTCCCTACTCTCATTCGGGTTGCCTGA
+HWUSI-EAS1795_0092:3:1:6142:2544#0/1
cdfcadcfffafd`eaeaddddfffdffaccfa
@HWUSI-EAS1795_0092:3:1:6432:2547#0/1
TTCACCGAGGCCGAGAGCAACATGAACGATCTG
+HWUSI-EAS1795_0092:3:1:6432:2547#0/1
hhhhhhhghhhhhahghhhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:6553:2542#0/1
AGGATGTCGATGACACCGGCGTGGATGAGAAGG
+HWUSI-EAS1795_0092:3:1:6553:2542#0/1
hhhhhhhhhghfhhhhgchghhhhgagfhhggh
@HWUSI-EAS1795_0092:3:1:6870:2549#0/1
ATTAGATTCACTGGCACACAAACGAACTAGTGC
+HWUSI-EAS1795_0092:3:1:6870:2549#0/1
hhhhhhhhhhhhcfhhhhhhhhghhghhhgggh
@HWUSI-EAS1795_0092:3:1:7127:2541#0/1
CAGAGACACACGAGACACGCCCACGCCCCCTCA
+HWUSI-EAS1795_0092:3:1:7127:2541#0/1
hhhfhghhhhhhhhhhhhhhhhhhhhhhhhehh
@HWUSI-EAS1795_0092:3:1:7314:2550#0/1
CACAGAAGCTGTGGTTTGGGGGACCGCCCAGGA
+HWUSI-EAS1795_0092:3:1:7314:2550#0/1
hgghhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7866:2545#0/1
TAACACAGCAAAGCAACAACAAACGAAGCGACA
+HWUSI-EAS1795_0092:3:1:7866:2545#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhggffhh
@HWUSI-EAS1795_0092:3:1:8177:2541#0/1
CGGGTATTAAAATTCGAGATGCATGGTGTAATA
+HWUSI-EAS1795_0092:3:1:8177:2541#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhgghhhhhh
@HWUSI-EAS1795_0092:3:1:8284:2548#0/1
CAAATGATCGTTCGTGTCCTTGTGGCTCAGTAT
+HWUSI-EAS1795_0092:3:1:8284:2548#0/1
hhhhhhhghhhhhhhhhhhhhghhfhhhfghhh
@HWUSI-EAS1795_0092:3:1:8665:2541#0/1
CTATCCCAACAAGCGGTCCAGGGAGAATCTGGC
+HWUSI-EAS1795_0092:3:1:8665:2541#0/1
hhhhhhhhhhhhhhhhhhggfhhhfhhhhhhgf
@HWUSI-EAS1795_0092:3:1:8794:2546#0/1
GGAGGAATGCCAAATCGATGTTGATGCTCTCGT
+HWUSI-EAS1795_0092:3:1:8794:2546#0/1
hhhhhhhhhhhhhhhhghgehgghfhghhhhhh
@HWUSI-EAS1795_0092:3:1:8892:2544#0/1
CGTGATTCTACTGTGTGCTGCTCAGAGTTTTCT
+HWUSI-EAS1795_0092:3:1:8892:2544#0/1
hhhghhhhhhhhhhghhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9072:2545#0/1
TCGGCGTGTGCATGTCGGTCGTTAACTTCACCC
+HWUSI-EAS1795_0092:3:1:9072:2545#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9167:2541#0/1
CGCGGCTGCTTTTCGGCCTTCTTCGCCAGTTCC
+HWUSI-EAS1795_0092:3:1:9167:2541#0/1
gggg_gggfggggggg__dfcfgccggfgbcgg
@HWUSI-EAS1795_0092:3:1:10114:2544#0/1
TGAAGGTGTTGTTCCTGGCCACGTCCGGTGCCA
+HWUSI-EAS1795_0092:3:1:10114:2544#0/1
e^ccdc^Yeeeefffadfdf_caadca`Y`a^a
@HWUSI-EAS1795_0092:3:1:11702:2540#0/1
TTGGGCGACAGCTTCTCAAAGCTGATGTCGTGC
+HWUSI-EAS1795_0092:3:1:11702:2540#0/1
hhhhhhhhhhhhhhhhhhhhhghghghhhhhgg
@HWUSI-EAS1795_0092:3:1:11932:2544#0/1
CCGAGTTCCTCGATCCAGCCCTCTATCTGGGCG
+HWUSI-EAS1795_0092:3:1:11932:2544#0/1
hhhhhhhhhhhhhhhhhdfhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12450:2552#0/1
CTTAGCCAGGGCGTACTTGACGCGCCACACTTC
+HWUSI-EAS1795_0092:3:1:12450:2552#0/1
hhhhhhhghhhhhfhhhhhhhfghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12786:2547#0/1
GTCCGCCCTGGTCATGTTCTATGCACCCTGGTG
+HWUSI-EAS1795_0092:3:1:12786:2547#0/1
hhhhhhhhhhghhhghhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:12863:2548#0/1
CGGAGACACAGAGGACCGCTTCTCAATTGCATT
+HWUSI-EAS1795_0092:3:1:12863:2548#0/1
aKaZZacdacaacaacccccccaa^bacc\ccc
@HWUSI-EAS1795_0092:3:1:13263:2549#0/1
TGCACGACTCGGACAACAACAACAAGTTGGACG
+HWUSI-EAS1795_0092:3:1:13263:2549#0/1
hhhhhghhhhfhhhhhhhhfhhghhghhghhhh
@HWUSI-EAS1795_0092:3:1:13466:2546#0/1
CATGAACAGGATTCTCCGAAATACCACCCACAA
+HWUSI-EAS1795_0092:3:1:13466:2546#0/1
ggfd_dcdffffaaffceade`ed]dbfcccfa
@HWUSI-EAS1795_0092:3:1:13762:2551#0/1
TGCACAAACGCCACGAGTCCACTCTGGGTATGG
+HWUSI-EAS1795_0092:3:1:13762:2551#0/1
hhhhhhhhhhhhhhgfghhhhhhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:14071:2541#0/1
ATCTCATATGGGGTCTTTGAACTATCAACAAGT
+HWUSI-EAS1795_0092:3:1:14071:2541#0/1
dffffdffffffeaefdffffdgfgggafcfff
@HWUSI-EAS1795_0092:3:1:14345:2547#0/1
GAGGGCCCTGAAGTTCCTCAAGCGCCGCCTGGG
+HWUSI-EAS1795_0092:3:1:14345:2547#0/1
hhhhhhhhhhhhhhhhhhhhhghghhhhhfhhe
@HWUSI-EAS1795_0092:3:1:14763:2550#0/1
GCTCTCCAAGAAGAAGCTGCAGCGCCAAAAGGA
+HWUSI-EAS1795_0092:3:1:14763:2550#0/1
ggggggggggggagfeggggfgfggdggggggg
@HWUSI-EAS1795_0092:3:1:15099:2540#0/1
CAGAATCTGGATGCGTTCACTAAGAAGTATGGT
+HWUSI-EAS1795_0092:3:1:15099:2540#0/1
hhhhhhhhhhfhhhhhhhhhhhghhghhhhhdc
@HWUSI-EAS1795_0092:3:1:15776:2541#0/1
TGGGACTTGCTGTTGTTGTTGTTGCTGCTGCCG
+HWUSI-EAS1795_0092:3:1:15776:2541#0/1
hhhhhhhhhhhhhhhhhfhhghhghfhhghghh
@HWUSI-EAS1795_0092:3:1:15844:2541#0/1
GTTGAACGATGAGAACCCCGTAGAACGGAACGG
+HWUSI-EAS1795_0092:3:1:15844:2541#0/1
hhhhhhhhhghfehhhhhghhghhhghchhhhg
@HWUSI-EAS1795_0092:3:1:15991:2549#0/1
GTTTGAAATAAACTATGTGATTACAGTACATAT
+HWUSI-EAS1795_0092:3:1:15991:2549#0/1
hchhhhghchhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16015:2548#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:16015:2548#0/1
hhhhhhhhhhhhhghhhchhhgfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16384:2541#0/1
CGCCAGTTGCGACGCCAAACTTTTTCGTTCATA
+HWUSI-EAS1795_0092:3:1:16384:2541#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:16715:2551#0/1
GGCCAATCCATTGGCGAAAGCCAGTTCGTCCAG
+HWUSI-EAS1795_0092:3:1:16715:2551#0/1
fffdfccgggdeggaggaffffgggggfggggg
@HWUSI-EAS1795_0092:3:1:16845:2545#0/1
CCTCAGTTTCAGACTGCAGCTTGGCAACATATG
+HWUSI-EAS1795_0092:3:1:16845:2545#0/1
aaa\baa^aaaaf_cfYZW^WYUYYY^WSSYWf
@HWUSI-EAS1795_0092:3:1:17380:2547#0/1
TCAAGCACGGTCGTCCTGGTATCGGTGCCACCC
+HWUSI-EAS1795_0092:3:1:17380:2547#0/1
hhhhhhhhhhhhdhhhfhhhghhhdhhhhfhhh
@HWUSI-EAS1795_0092:3:1:17801:2551#0/1
GGTCTTGATTCTGCTGGAGGAGGAGGAGGAGAA
+HWUSI-EAS1795_0092:3:1:17801:2551#0/1
ggggggggggggggggg_ffafcfffcffefd`
@HWUSI-EAS1795_0092:3:1:18495:2543#0/1
GTCTGGAAGCGACCGTGACCCATCTTGGACGAG
+HWUSI-EAS1795_0092:3:1:18495:2543#0/1
gghhhhhhhhhhhfedhhhghhfhhfghgchdh
@HWUSI-EAS1795_0092:3:1:18832:2540#0/1
AGGGCTTCGGCTCGCTGGAGGGCATGAACGGGA
+HWUSI-EAS1795_0092:3:1:18832:2540#0/1
hhhhhhhhdhghhehfhheffhghchhhghhha
@HWUSI-EAS1795_0092:3:1:18894:2545#0/1
CTGGAATGATGGCGATGTGAAAAAGCTAGGCGT
+HWUSI-EAS1795_0092:3:1:18894:2545#0/1
hhhhhhhhhhgghhhhghfghhhhhhehhghhg
@HWUSI-EAS1795_0092:3:1:19437:2551#0/1
CGCCAAGATTCAGGACAAAGAAGGAATTCCTCC
+HWUSI-EAS1795_0092:3:1:19437:2551#0/1
ffafafcdfffcg]ggfggaegggdfgggagfg
@HWUSI-EAS1795_0092:3:1:19586:2545#0/1
AACGGCTTCATCAAGACCGGCGATTCCGTCGTG
+HWUSI-EAS1795_0092:3:1:19586:2545#0/1
hhhhhhhchhhhhfghhgfghhdegghaadcbc
@HWUSI-EAS1795_0092:3:1:19694:2550#0/1
TGGTCAACAAGGAGCGCGGCGAAGCGATTGCCC
+HWUSI-EAS1795_0092:3:1:19694:2550#0/1
Yfcbedcfffaf]fcffa_fffdffcc]ffaff
@HWUSI-EAS1795_0092:3:1:1275:2557#0/1
ATTGGAGGCGAGACAGCCAAAACAACGGCAGTA
+HWUSI-EAS1795_0092:3:1:1275:2557#0/1
ffacaffffacY^I`Z^dadda___\ddffdff
@HWUSI-EAS1795_0092:3:1:1591:2557#0/1
GCGAAATGAGCAAATCTTCCCCGCTCTGATTTA
+HWUSI-EAS1795_0092:3:1:1591:2557#0/1
Z^ceeedf\afaffdffggggaccf]_ffcffg
@HWUSI-EAS1795_0092:3:1:1711:2560#0/1
CCGGGAGCATTTAAATAATTTTTTCTGTGGATT
+HWUSI-EAS1795_0092:3:1:1711:2560#0/1
ggggffgggcgggcggfggggggggggcgggga
@HWUSI-EAS1795_0092:3:1:2250:2560#0/1
GCATTCCAAAAGGGTCTAGAAACATAAATCACG
+HWUSI-EAS1795_0092:3:1:2250:2560#0/1
hhghhhhhghghhhhhhhhhhfghhhhfhhghh
@HWUSI-EAS1795_0092:3:1:2539:2563#0/1
TCTCTGGGTCCCAAGGGTCTGGACAAGATCATG
+HWUSI-EAS1795_0092:3:1:2539:2563#0/1
ggfgggcfafffffffecfffffggfgggggdg
@HWUSI-EAS1795_0092:3:1:2902:2554#0/1
CCAAGCGCAAATTAAAACGAATTTCTGCGATAG
+HWUSI-EAS1795_0092:3:1:2902:2554#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhch
@HWUSI-EAS1795_0092:3:1:2989:2559#0/1
CTCCGGCTCCTGCCAACATGTGTCGCTAATAGT
+HWUSI-EAS1795_0092:3:1:2989:2559#0/1
gggggggggggggggggggfgaggggggggfgg
@HWUSI-EAS1795_0092:3:1:3245:2555#0/1
TTGGTGCTTAGTGAAGAAATGATACCTCCAGCC
+HWUSI-EAS1795_0092:3:1:3245:2555#0/1
hhhhhhhhhhhhhhhhhhhhfghhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:3481:2561#0/1
AAACTCGATTGCAGGGTATCGCATAGTCGGGGC
+HWUSI-EAS1795_0092:3:1:3481:2561#0/1
ghhhchhhhghhgghhhcghfehgfhhhfhhhc
@HWUSI-EAS1795_0092:3:1:4036:2561#0/1
TAGAGATTCCTTGGAAGGTACCCAAATGGTTGG
+HWUSI-EAS1795_0092:3:1:4036:2561#0/1
^da]b`afafcfa[ddaafcfffffaffffcW\
@HWUSI-EAS1795_0092:3:1:4543:2558#0/1
CTCCTCATAGCGGCCGGAGATCTGCTTGTCCGG
+HWUSI-EAS1795_0092:3:1:4543:2558#0/1
hhhhhghhhhhfhhhfhcffffhhfhghhhhhc
@HWUSI-EAS1795_0092:3:1:4678:2558#0/1
TTTAGTATGAGGGCCTGAAGCCATTGCGTTGCG
+HWUSI-EAS1795_0092:3:1:4678:2558#0/1
fffaffcaca^aSYPZVWXWUabddd[ddddda
@HWUSI-EAS1795_0092:3:1:4762:2563#0/1
TGATGCGCTACTTGCTACGTATTCGCGTTTGGC
+HWUSI-EAS1795_0092:3:1:4762:2563#0/1
hhhghhhhhhhhhhhhhhhgghhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:5323:2555#0/1
GCGGTGCGCTGCTTACTAATTAAATCAAAGTCC
+HWUSI-EAS1795_0092:3:1:5323:2555#0/1
gfgggfggeggdddfffggggfgggfggggggg
@HWUSI-EAS1795_0092:3:1:5368:2560#0/1
GCTCATCCTGCTGGCCGGACGCCACCAGGGCAA
+HWUSI-EAS1795_0092:3:1:5368:2560#0/1
hhfhhhhhhhhhhhhgghhhhghhfghefhhhe
@HWUSI-EAS1795_0092:3:1:5455:2556#0/1
ATTAACTGCTACTTATTTAATCAACAGAATTCC
+HWUSI-EAS1795_0092:3:1:5455:2556#0/1
hhhhhhhhhhhhhhhhhhgghhhhghhhghhhh
@HWUSI-EAS1795_0092:3:1:5688:2562#0/1
TTTGGAAATAAGAAGCAAGAAAAGCAGATACTG
+HWUSI-EAS1795_0092:3:1:5688:2562#0/1
aaffff_\bbZZYVSZZ]`]][WW\Z^U\\^ZZ
@HWUSI-EAS1795_0092:3:1:7246:2556#0/1
GAGAAACCGCTTGAAGTACGCCCTCAATGGCGC
+HWUSI-EAS1795_0092:3:1:7246:2556#0/1
hhhhhhhhhhhhhhhghhhhghghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7510:2561#0/1
CTATTGCTCTACTTTTACAACAGTCTAAACTGT
+HWUSI-EAS1795_0092:3:1:7510:2561#0/1
[\YVVVX\[[\\\\\W\acaa\YY\\\VT[[TV
@HWUSI-EAS1795_0092:3:1:7887:2559#0/1
GCACACCACCCACATTTGATAGTTACTAATGAA
+HWUSI-EAS1795_0092:3:1:7887:2559#0/1
hhhhhhhhhhhhhhhhhhhhhhhghfhhfhhhh
@HWUSI-EAS1795_0092:3:1:8093:2557#0/1
CTTCTGCTGACCCAGTGGTGGCTACTTCATCGT
+HWUSI-EAS1795_0092:3:1:8093:2557#0/1
hhhhhghhhhhhhhhhhhhhhhhhhhhhhfhhh
@HWUSI-EAS1795_0092:3:1:8126:2559#0/1
TGGAGGCGGAGGCTGAAGTTATCAACGATTTCC
+HWUSI-EAS1795_0092:3:1:8126:2559#0/1
hhhhhhhhhghhhghhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8645:2553#0/1
GGAGGGTATTTTAGCCGACGAAAACTTGCGCGG
+HWUSI-EAS1795_0092:3:1:8645:2553#0/1
hhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9017:2555#0/1
CTGGGAGTATGCTGCGGCTTCCGCTCCTCTGCA
+HWUSI-EAS1795_0092:3:1:9017:2555#0/1
hhhhghhhhhhhhghhhghhgh]dbbd_f``ac
@HWUSI-EAS1795_0092:3:1:9089:2552#0/1
CGGTGAAGAAGGCCGCTAAGGTCATCATCGAGA
+HWUSI-EAS1795_0092:3:1:9089:2552#0/1
hhhhhhhghhhhhhhhhhhhhhhhghfhghhhh
@HWUSI-EAS1795_0092:3:1:9365:2563#0/1
CGCACTTTTTGTTTATGTTTGGCCAAGCCAACT
+HWUSI-EAS1795_0092:3:1:9365:2563#0/1
hhhhhhhhhhghhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:9642:2555#0/1
GCACAATCTAGCTCGTAGTCCAGGTAATTAACC
+HWUSI-EAS1795_0092:3:1:9642:2555#0/1
ggggggegggggfffeffdfffgggggggggdg
@HWUSI-EAS1795_0092:3:1:9708:2552#0/1
AATGGCCTTAAACTGGCCAAGCAGATCCTGTCC
+HWUSI-EAS1795_0092:3:1:9708:2552#0/1
hhhgghhhhhhhhghghhhhhghhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:10029:2561#0/1
CTCCGCCAGAGCGGCTGTACGGGGCCACAGCCG
+HWUSI-EAS1795_0092:3:1:10029:2561#0/1
hhhhhhhhhhghhhhhheghghhghhhfhahhg
@HWUSI-EAS1795_0092:3:1:10775:2561#0/1
TGGCAACGAAGGCCTTGAAACGGGTACGCTGAC
+HWUSI-EAS1795_0092:3:1:10775:2561#0/1
fgggcggggegcgfgcgffgggffcfaffcfag
@HWUSI-EAS1795_0092:3:1:11436:2556#0/1
CGCCGACTGGGTAGCCCTAAAATGGTGGCCCTA
+HWUSI-EAS1795_0092:3:1:11436:2556#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11834:2559#0/1
GCGAAGACCACAACGGTACCGGGCTTCAGCACA
+HWUSI-EAS1795_0092:3:1:11834:2559#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12324:2561#0/1
CGAATACGCAACCAACTCGGATTACTACGATGA
+HWUSI-EAS1795_0092:3:1:12324:2561#0/1
hhhhhghhhhhhhhhhfhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:12385:2560#0/1
TTGTGGAGCTATTCACGGTGACAAGTCGCAATC
+HWUSI-EAS1795_0092:3:1:12385:2560#0/1
hhhhhhhfhhhhhhhhhhhghghhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:12939:2559#0/1
GGTCAACGTGTCCTTCGGCTGGGGCGTCCATTG
+HWUSI-EAS1795_0092:3:1:12939:2559#0/1
\\]`bb`dd[a]caac^ffWf]a^a\\ff]faZ
@HWUSI-EAS1795_0092:3:1:13085:2553#0/1
CCGCCACCCGTCATGTGCTCCTGCGCCAGGGAG
+HWUSI-EAS1795_0092:3:1:13085:2553#0/1
hhhhhhhhhhghegghhhghhhhhhhhhhhhfg
@HWUSI-EAS1795_0092:3:1:13315:2559#0/1
GCGATCCTGGGGCATCTATAGTGTGCCGTCGAA
+HWUSI-EAS1795_0092:3:1:13315:2559#0/1
ggggefgfagggggcgdgggggcfffdfffffg
@HWUSI-EAS1795_0092:3:1:14608:2552#0/1
TTCGTACTAAAATATCACAATTTTTTAAAGATA
+HWUSI-EAS1795_0092:3:1:14608:2552#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:15428:2558#0/1
GCCATAAGTATCTAGCTAAGCAGGGCACTCCTT
+HWUSI-EAS1795_0092:3:1:15428:2558#0/1
hhhhhhhghhhhhhhhhhfghhghhghhghhhh
@HWUSI-EAS1795_0092:3:1:15548:2557#0/1
CAGCGAGCGCCCCCGCATGTCCAAGCGCCTGAA
+HWUSI-EAS1795_0092:3:1:15548:2557#0/1
ggdef[gff_ffgece_fffffagg[fggg_d_
@HWUSI-EAS1795_0092:3:1:15771:2560#0/1
CGGGTTCTTCGCGGGATCGCGCTTAATCTTCTT
+HWUSI-EAS1795_0092:3:1:15771:2560#0/1
hhhhhhhhhhhhhhhdhhhghchhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16083:2558#0/1
CCGCATCCGGCCGAATGCTGACATTCCGGCCGA
+HWUSI-EAS1795_0092:3:1:16083:2558#0/1
gggggggggeggggggggggfgggggggcgggg
@HWUSI-EAS1795_0092:3:1:16829:2560#0/1
TGGGCGCCGACTTCTTGGCGGGAGCGGGGGCAG
+HWUSI-EAS1795_0092:3:1:16829:2560#0/1
ggegaggfffffggggg\ffffZ\]eecff_Ke
@HWUSI-EAS1795_0092:3:1:17055:2557#0/1
CGCTCACAGCTTGTTGCTGCGTCGAATGGCGAA
+HWUSI-EAS1795_0092:3:1:17055:2557#0/1
hhhhhhhhghhhfhhhhhhhhhfhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:18150:2553#0/1
GATTGGACCAGAAGTAGTAGGGGGCGCCCTGGC
+HWUSI-EAS1795_0092:3:1:18150:2553#0/1
hehhghchhhhhhhhfghghhhhhfhhhghhgh
@HWUSI-EAS1795_0092:3:1:18589:2562#0/1
ATTATATCGGTATGATATGTAAAGACATTTGCT
+HWUSI-EAS1795_0092:3:1:18589:2562#0/1
hhhghhhhhhhhhhfhhgggghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18729:2558#0/1
GAAGGGCGATGTTGGACCCGGTGCCGGAGAGGT
+HWUSI-EAS1795_0092:3:1:18729:2558#0/1
faf_f_afff]ffRfadZ\Z\VS^ZYORKOOXc
@HWUSI-EAS1795_0092:3:1:19554:2560#0/1
TGGACACCAACGCCGAACTGGGCGAGTTCCTGT
+HWUSI-EAS1795_0092:3:1:19554:2560#0/1
fffcaffffffdHRS[Uc_ffccafdccfaffc
@HWUSI-EAS1795_0092:3:1:1503:2573#0/1
TGTTGGCTGCATTATGATGTTGGTTATATGCTT
+HWUSI-EAS1795_0092:3:1:1503:2573#0/1
e_hhcfhhchhhfcfaffYffY[hhhffffffg
@HWUSI-EAS1795_0092:3:1:2848:2572#0/1
GTGCATTCTGGGAAGTGTTAACTGATCCAGCAT
+HWUSI-EAS1795_0092:3:1:2848:2572#0/1
ffccdffgcegffcfaaceeccfcfffgfgcgg
@HWUSI-EAS1795_0092:3:1:3587:2575#0/1
GAATATTTATATCGAACAAAGTAAAACTAAAAA
+HWUSI-EAS1795_0092:3:1:3587:2575#0/1
hfhhhhhhghhghhhhhahhhaghhhghhhehd
@HWUSI-EAS1795_0092:3:1:3667:2574#0/1
TTTGGATTTGCAGTTTCCTTAGCAACGGGTATA
+HWUSI-EAS1795_0092:3:1:3667:2574#0/1
ggg_ggcda[ceff_ddfffaff_affcebfWd
@HWUSI-EAS1795_0092:3:1:3902:2572#0/1
GGAATACGGTTCCAATTCCGTAACCTGTTGAGT
+HWUSI-EAS1795_0092:3:1:3902:2572#0/1
gggggfgggggaaffdffgfggge_ggffaffc
@HWUSI-EAS1795_0092:3:1:3948:2566#0/1
GAGCTGGCCAACGAACGGCAGCTGGCTTCCTTT
+HWUSI-EAS1795_0092:3:1:3948:2566#0/1
gggggggggggfgfggggggga]cfffgfgggg
@HWUSI-EAS1795_0092:3:1:4052:2571#0/1
GTTGGTATGAGTTTCATTTGCAACATTCGTCTA
+HWUSI-EAS1795_0092:3:1:4052:2571#0/1
becffdffffffgggdgfgggggg]gffffafd
@HWUSI-EAS1795_0092:3:1:4089:2570#0/1
ATCCTGGTTCACCCTTCTGTCCAGGCAGACCTG
+HWUSI-EAS1795_0092:3:1:4089:2570#0/1
gfgeggggggggggfgeccfffggggggggffg
@HWUSI-EAS1795_0092:3:1:4471:2568#0/1
ATTTAAACAAAACTAGTGCTTTAACAAAGATCC
+HWUSI-EAS1795_0092:3:1:4471:2568#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:4932:2566#0/1
GCGGTATTCATCCTGCTCCGACTTTAGGGTAAG
+HWUSI-EAS1795_0092:3:1:4932:2566#0/1
gagfgfggegfggggfgfgggggggggfcadff
@HWUSI-EAS1795_0092:3:1:5166:2564#0/1
AAACTAGAAAACCCCATTAAAATTTACGAAGAC
+HWUSI-EAS1795_0092:3:1:5166:2564#0/1
g^gggdg_fdfcfffafffdfdfffffgggegg
@HWUSI-EAS1795_0092:3:1:5278:2565#0/1
CTGCGTTTCCAGCGCCTTTTGCATCTTTTGCAT
+HWUSI-EAS1795_0092:3:1:5278:2565#0/1
hhhhhhhhhhhhdhhhhhhhhhhhghhhhhggh
@HWUSI-EAS1795_0092:3:1:5523:2570#0/1
TCTAAATTTCCAAATCGCGTACTTCTCGCCATC
+HWUSI-EAS1795_0092:3:1:5523:2570#0/1
hhhghhhhhhhhhgghhfhhhhhhehhfhhhhg
@HWUSI-EAS1795_0092:3:1:6001:2571#0/1
CTCGTCTCGTTTTCTTGTGAGCTGCTCCAGATG
+HWUSI-EAS1795_0092:3:1:6001:2571#0/1
UWYYZUTdd^WQa\[[ZYQT\W_ZW\^BBBBBB
@HWUSI-EAS1795_0092:3:1:6336:2572#0/1
GGTGGGACTTCAATTGCCGTAGTTATATTCGCT
+HWUSI-EAS1795_0092:3:1:6336:2572#0/1
fdfffffggggggggcgggggggggfggcgccc
@HWUSI-EAS1795_0092:3:1:6524:2568#0/1
TGAGGAGACGCTGAGCAAACGGCCTTCAAATCG
+HWUSI-EAS1795_0092:3:1:6524:2568#0/1
hhhhhhghhhhhgfhfhhhhhhhhhhhhhfhhf
@HWUSI-EAS1795_0092:3:1:7022:2572#0/1
CGCCGAAGGCCTGTGGGGGTGGTGCTACTCCTC
+HWUSI-EAS1795_0092:3:1:7022:2572#0/1
hhhhhfhhhhhhhhhhhfhchhccffdehhhhh
@HWUSI-EAS1795_0092:3:1:7535:2569#0/1
CAAGAAACCAGCAGCAGTAATAAGGCCAACTCC
+HWUSI-EAS1795_0092:3:1:7535:2569#0/1
hhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:7677:2575#0/1
GAAGGCTACCGCAATGACGGACCGCGTGGAGAG
+HWUSI-EAS1795_0092:3:1:7677:2575#0/1
hhhhhhhhhhhhhhhghhhhhhhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:8407:2572#0/1
TTGCGCTTGCCGTCGATGTTCGTATTCATGATA
+HWUSI-EAS1795_0092:3:1:8407:2572#0/1
hhhhhhhhhhhhhhhhhghhhehhhhhghgggh
@HWUSI-EAS1795_0092:3:1:8654:2570#0/1
CGGGATTCCTGATGAAGGATTTAAGGTCCGACA
+HWUSI-EAS1795_0092:3:1:8654:2570#0/1
hghhgfhhghhgehhhhheghghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8759:2575#0/1
GCCGTGGTGGCCCAGGCCTATGGAGATTTCAAG
+HWUSI-EAS1795_0092:3:1:8759:2575#0/1
hhhhhghhhhhhhfhhhhhggghhghhhhhhhf
@HWUSI-EAS1795_0092:3:1:8905:2572#0/1
GAAGACCCAGCCGCCAATACAGCTTCAGGCTTC
+HWUSI-EAS1795_0092:3:1:8905:2572#0/1
OUZZYYRTTTUWVXXPZUXUYVNTMVV]Q_WRa
@HWUSI-EAS1795_0092:3:1:8930:2568#0/1
TCTGGGGTACTTGGGACTCCTGGGCAGCTTCAG
+HWUSI-EAS1795_0092:3:1:8930:2568#0/1
K__ccc^\WZQQZ__Z_YaYSa`__S_XXWX\^
@HWUSI-EAS1795_0092:3:1:8976:2573#0/1
TCGACATCTGCACATAAAACATATTGGTGCTGC
+HWUSI-EAS1795_0092:3:1:8976:2573#0/1
hhhhhhhhdhghhhhhghhhhhhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:9126:2566#0/1
CGCCAATTGGTGCGTTCTGAAGCCACAGATCGT
+HWUSI-EAS1795_0092:3:1:9126:2566#0/1
hhhhhhhhhhghh[hhfhhhhhhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:9158:2571#0/1
CCTTGACAACCTTGAAGCGCACACCGGGAATAT
+HWUSI-EAS1795_0092:3:1:9158:2571#0/1
hhhhdhhhhhhhhhhhggfghhhhhhhhchchh
@HWUSI-EAS1795_0092:3:1:9680:2575#0/1
CAGGGACACCACGGCAAAACCGAGATTTAGGGT
+HWUSI-EAS1795_0092:3:1:9680:2575#0/1
ffcggfggggfgg_eggfffffefcfffcfcag
@HWUSI-EAS1795_0092:3:1:9962:2567#0/1
CCCAACGGTCGCCTGCGTTCTCAAGAGAACGAG
+HWUSI-EAS1795_0092:3:1:9962:2567#0/1
hhhhhhhhhhhhhhghghhghgghhhghhghhh
@HWUSI-EAS1795_0092:3:1:10191:2570#0/1
GGAACTGCAAGCTCGATCGTGTTCCGTTAAGCA
+HWUSI-EAS1795_0092:3:1:10191:2570#0/1
ghghhhhghhghghhchhhhhhhfhhhfhhfah
@HWUSI-EAS1795_0092:3:1:10258:2570#0/1
GCCGAGGCTAAGGCCAAGGGCAAGGATGTGGAG
+HWUSI-EAS1795_0092:3:1:10258:2570#0/1
hhhhhhhhhhhgfhhhghhhfhhgfghhghchh
@HWUSI-EAS1795_0092:3:1:10397:2572#0/1
ATTTAATAGTTAGTTTGGATTCTTCTCTCTTAG
+HWUSI-EAS1795_0092:3:1:10397:2572#0/1
hhhhhhhhehhhhghghhhhhghghhhghhhhh
@HWUSI-EAS1795_0092:3:1:10562:2565#0/1
CGAAAAATCTCTGGTTGAGTTCCAGGACTGATA
+HWUSI-EAS1795_0092:3:1:10562:2565#0/1
ggggggggggggggcggfggggfgggfggfeg_
@HWUSI-EAS1795_0092:3:1:11121:2565#0/1
TAAGAACTTAGCATCTAGTTAATGGGTACACTA
+HWUSI-EAS1795_0092:3:1:11121:2565#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:11146:2569#0/1
GGGGCAGCATCTTGAAGACATCCTGGATCTGAT
+HWUSI-EAS1795_0092:3:1:11146:2569#0/1
hhhhhhhfhhghhhhhhhhhhhhhhhhhgghhg
@HWUSI-EAS1795_0092:3:1:11172:2572#0/1
TTCTCCTTCTGCCAGCGCACCGGGCAGTAGATG
+HWUSI-EAS1795_0092:3:1:11172:2572#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhfhgghfh
@HWUSI-EAS1795_0092:3:1:11259:2569#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11259:2569#0/1
hhhghhhhhhhhghhhhhhhhhfhhhghhhghh
@HWUSI-EAS1795_0092:3:1:12199:2571#0/1
CTCAAGCGAAAGTACCGCCAGTACATGAATCGC
+HWUSI-EAS1795_0092:3:1:12199:2571#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12370:2569#0/1
CGCTATCTCCGTGGGTTAACAGCACGGACTGTG
+HWUSI-EAS1795_0092:3:1:12370:2569#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhgfhghgh
@HWUSI-EAS1795_0092:3:1:12465:2566#0/1
GTTTTCTGAATGAACGTAGCAGCGTTTTCGCCC
+HWUSI-EAS1795_0092:3:1:12465:2566#0/1
aVVUUU[\cc\_QSSQLaTZaXXU_WS[\Y\\c
@HWUSI-EAS1795_0092:3:1:12828:2574#0/1
CGGGCATCGTTGATGGCCTCAGTGATATTGCTG
+HWUSI-EAS1795_0092:3:1:12828:2574#0/1
hhhhhhhhhghdhhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:13668:2572#0/1
CTGAAAGATAGTAAGGAAAGTAATAAATATTTT
+HWUSI-EAS1795_0092:3:1:13668:2572#0/1
hhhhhhhghhhhhhhhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14170:2571#0/1
AAGCTGTATTTGCTATTATAGCAGGTTTTATTC
+HWUSI-EAS1795_0092:3:1:14170:2571#0/1
Wfhhhhhhhhhhhhfhhhhfhhhhhhhhhghhg
@HWUSI-EAS1795_0092:3:1:15212:2565#0/1
AAAGTTTCGCTTAGGACATGTCCTCGATGAGGG
+HWUSI-EAS1795_0092:3:1:15212:2565#0/1
gggggggggggfggfcggggggfgggfgggggg
@HWUSI-EAS1795_0092:3:1:15514:2572#0/1
GTAATGTGTTTCAAAAAAAACTTATCTCCTTAT
+HWUSI-EAS1795_0092:3:1:15514:2572#0/1
hhhhhhghhhhhhhhhhhghghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15564:2575#0/1
TAAATGCAGGTGTGATGCAGCCTTTGCAGTTAC
+HWUSI-EAS1795_0092:3:1:15564:2575#0/1
hhhhhhhhhhhhhghghghhhhhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:15728:2569#0/1
CTTGGGTGCAGCAGCCATTATTTAGCAATTTCC
+HWUSI-EAS1795_0092:3:1:15728:2569#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15948:2575#0/1
CGCCGCAGCTCCTCCAGCGACATCTGAAGCGTT
+HWUSI-EAS1795_0092:3:1:15948:2575#0/1
ggggggfggggggfgdggggggggggg[dfffg
@HWUSI-EAS1795_0092:3:1:17576:2573#0/1
AAGAGGGGAGAAATAAACTCTGACCATAACAAA
+HWUSI-EAS1795_0092:3:1:17576:2573#0/1
hhhhhhhhhhhhfhhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:17968:2565#0/1
CGGAAATGCGTCACATGTTTTAAGGTAGCTCCA
+HWUSI-EAS1795_0092:3:1:17968:2565#0/1
gagfggfgfgggcgdggdffccfffefcffffe
@HWUSI-EAS1795_0092:3:1:18181:2564#0/1
CATTATTTGGCGTGGCATTGTTGTCTGTTTTAG
+HWUSI-EAS1795_0092:3:1:18181:2564#0/1
f\dffffg`gggggggffggggggggcgggggg
@HWUSI-EAS1795_0092:3:1:18363:2575#0/1
TAATAACAGCAAAATGCTACGCAGGATACTGCC
+HWUSI-EAS1795_0092:3:1:18363:2575#0/1
dfdcfffaggfgffc_fafdfcafaf[ffdffg
@HWUSI-EAS1795_0092:3:1:18454:2568#0/1
CGCCGATCCTATCCTCATGTTCCAGAAGAAATA
+HWUSI-EAS1795_0092:3:1:18454:2568#0/1
ggggg[gggffgggcgcgadcgggfgggggggg
@HWUSI-EAS1795_0092:3:1:18483:2573#0/1
CTTTGAGCAACAACAACAGCAAAATGGTCCAAC
+HWUSI-EAS1795_0092:3:1:18483:2573#0/1
hhhhhhhhhhhhhhhhhghhhhhhhghghfhhh
@HWUSI-EAS1795_0092:3:1:18908:2565#0/1
GACAGAACGATCAGGTTAAGATGTGGTTTACTT
+HWUSI-EAS1795_0092:3:1:18908:2565#0/1
hhhhhhhhhhehhhhghhhhhhfhhghhhhfhh
@HWUSI-EAS1795_0092:3:1:19347:2566#0/1
CAAAAAACGTACAAGAAGGAAAGAAGGAATAAA
+HWUSI-EAS1795_0092:3:1:19347:2566#0/1
hhhhhhhhhhhhhhghhhhhhhhhhhghhghhh
@HWUSI-EAS1795_0092:3:1:19648:2568#0/1
TCCACAACGGTGTCCGACACCTTGGGCGACGGC
+HWUSI-EAS1795_0092:3:1:19648:2568#0/1
de^dede``ZU]\]`^`ffffeffe[WWS\\Yf
@HWUSI-EAS1795_0092:3:1:1439:2581#0/1
CGGGGATCCTCGGTGATGCTGAAGCTGTTGGCA
+HWUSI-EAS1795_0092:3:1:1439:2581#0/1
\OTTX__dfffc`ffc\\^_[\aacccddd^ad
@HWUSI-EAS1795_0092:3:1:1789:2587#0/1
GCTCAATCAACATCGTGACCAGTTCGGAGATGG
+HWUSI-EAS1795_0092:3:1:1789:2587#0/1
`\cSff]fffffffafcfa\fcda^``KaY^aW
@HWUSI-EAS1795_0092:3:1:2059:2586#0/1
CCACACTACATGTCCGAGCGCACGTTTGTGACC
+HWUSI-EAS1795_0092:3:1:2059:2586#0/1
hfhhghhghdhchhhhegfhghghhhhehfdhf
@HWUSI-EAS1795_0092:3:1:2212:2577#0/1
CAGAATCGTCCATTGTCCGCTAGGTAAACATTA
+HWUSI-EAS1795_0092:3:1:2212:2577#0/1
fgf_faffggggfc[dffffefacaf_ffffaf
@HWUSI-EAS1795_0092:3:1:2524:2580#0/1
CTTTGAGCAACAACAACAGCAAAATGGTCCAAC
+HWUSI-EAS1795_0092:3:1:2524:2580#0/1
hhhahghhghhhhhhhhgffhghhhhgghhh_f
@HWUSI-EAS1795_0092:3:1:2986:2578#0/1
GCCAACTCCTTCTTGGTTCCGAACCACTTCTCC
+HWUSI-EAS1795_0092:3:1:2986:2578#0/1
gggggggggggggggggggggggggcggcgfgd
@HWUSI-EAS1795_0092:3:1:3416:2577#0/1
CCGCGGAGGACGACGACGATCGCCGCGAGCCGC
+HWUSI-EAS1795_0092:3:1:3416:2577#0/1
hghhhhhghhhhhhhhhhhggfhhdhddehfeg
@HWUSI-EAS1795_0092:3:1:3501:2581#0/1
GTCGGTGATGTGCATCTCCATGCCATTGAGCAG
+HWUSI-EAS1795_0092:3:1:3501:2581#0/1
gggggegggfgfgggfggggggggggggagffg
@HWUSI-EAS1795_0092:3:1:5057:2581#0/1
CGCCTTTCGACTCTTAATTTCGTTCTGCAGGTT
+HWUSI-EAS1795_0092:3:1:5057:2581#0/1
hhhhhhhhhhhghhhghhhhgghhhhghhhfhh
@HWUSI-EAS1795_0092:3:1:5585:2586#0/1
CCGGCGAACAGAGTCTGGCCGTCGGTGGACCAG
+HWUSI-EAS1795_0092:3:1:5585:2586#0/1
hhhhhhhhghhhfhhhhhhhggfhfafhghehh
@HWUSI-EAS1795_0092:3:1:5611:2581#0/1
AGCGAGTGAAACGGATGCAGAGGGCACAGCCGA
+HWUSI-EAS1795_0092:3:1:5611:2581#0/1
ghhhhhhhchhghhahhgfdfhhechcdffffh
@HWUSI-EAS1795_0092:3:1:5916:2575#0/1
TCAAACTTCGCAACTATCATCAGTTACTTTTGT
+HWUSI-EAS1795_0092:3:1:5916:2575#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:6071:2584#0/1
TGAATACTTCAACAATCGGTTTGGTTTCTGGTT
+HWUSI-EAS1795_0092:3:1:6071:2584#0/1
fgggggceffffggafgggecgffcffaffadf
@HWUSI-EAS1795_0092:3:1:6628:2586#0/1
ATTCTGACCAGGTTGAGGGAGCTAATGCTCCGC
+HWUSI-EAS1795_0092:3:1:6628:2586#0/1
gfgggfgggggggcgggggggcgggagfggggg
@HWUSI-EAS1795_0092:3:1:6763:2579#0/1
GGGGTATCGGAAATGCACAACACTATATTCTTG
+HWUSI-EAS1795_0092:3:1:6763:2579#0/1
hhhhhhhhhghgfJfcfffffdghhfhghhhgg
@HWUSI-EAS1795_0092:3:1:7137:2576#0/1
TGTTGAATTGGTGCTATTAGTTAAGTTAGAAGC
+HWUSI-EAS1795_0092:3:1:7137:2576#0/1
hhhhhhhhhhhhhhhfhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8305:2583#0/1
TGCAGAGCTTAAGAATGAAAGAGTGGTATGAAG
+HWUSI-EAS1795_0092:3:1:8305:2583#0/1
hhhhhhhhhhhhhhhhghhhhgehfhhhhhhch
@HWUSI-EAS1795_0092:3:1:9182:2581#0/1
GCGGGTTGTTCTCCAGATGACCGCGGATGGCCT
+HWUSI-EAS1795_0092:3:1:9182:2581#0/1
hhhhhhhchhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:9466:2577#0/1
CAGGGACGGACACTTTATGATTCGCGACACATG
+HWUSI-EAS1795_0092:3:1:9466:2577#0/1
hhhhhhggcghhhhhhhgfhghhhfhghgehgh
@HWUSI-EAS1795_0092:3:1:9587:2577#0/1
ACTTGGTCTAGGCGATACCTGCGTTGAAGTGCT
+HWUSI-EAS1795_0092:3:1:9587:2577#0/1
hhhghhhhhhhhhhhfhhhhhgfhhghhgeghh
@HWUSI-EAS1795_0092:3:1:9713:2581#0/1
TGGGACATGTGCTTTTATTAGGCTAAAACCAAG
+HWUSI-EAS1795_0092:3:1:9713:2581#0/1
hhhhhhhhhhehhhhhghhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:10066:2583#0/1
TTGTTGCTGAGGCATTGCCTGCGCATACTGCTG
+HWUSI-EAS1795_0092:3:1:10066:2583#0/1
fgggegggeggdgfggggggggfggggfffffg
@HWUSI-EAS1795_0092:3:1:10095:2576#0/1
GGACATCATCGATGGCAAGTACTGGCAGCTGAC
+HWUSI-EAS1795_0092:3:1:10095:2576#0/1
hghhhhhhhhhhhhfdhhcghhhgchgfaa[cc
@HWUSI-EAS1795_0092:3:1:10613:2585#0/1
CCGCATCTCCGCCGAGGAGGCCAAGTACAAGTT
+HWUSI-EAS1795_0092:3:1:10613:2585#0/1
hhgghghhhhhhhhghhehdhhhhhfhghghhh
@HWUSI-EAS1795_0092:3:1:11070:2586#0/1
CCTCCACCAGCTTAGGCAAGTCCGCGGGGTTCT
+HWUSI-EAS1795_0092:3:1:11070:2586#0/1
hhhhhhhhhhhhgghhhhfdhhhehhhhgehhh
@HWUSI-EAS1795_0092:3:1:11395:2578#0/1
ATTGGTGAGTGCCGTCCTCTGTCCAAGACTGTG
+HWUSI-EAS1795_0092:3:1:11395:2578#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:11451:2584#0/1
CTCCAGACCGTGCTTGAAGAACATGAGCACGGG
+HWUSI-EAS1795_0092:3:1:11451:2584#0/1
hhhhhhfhhhhhghhfhhgghhhhfhhghhghg
@HWUSI-EAS1795_0092:3:1:11819:2580#0/1
CTTGAGCAAGGAAGATGATGTGCGTCGCTTCGT
+HWUSI-EAS1795_0092:3:1:11819:2580#0/1
hhhhhhhhhhhhhhhhffgghfgghhhhhhhhg
@HWUSI-EAS1795_0092:3:1:11889:2578#0/1
TTCAGATGAAGACTGCAATACCCCATGCCGTAG
+HWUSI-EAS1795_0092:3:1:11889:2578#0/1
hhfhhhhhhhhhhhhhhhghhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:11942:2580#0/1
GGGATAGGTGGGGTCGGTGCGGACCTTTCCATC
+HWUSI-EAS1795_0092:3:1:11942:2580#0/1
gggegggggfgggggggggcgggggggggdfgf
@HWUSI-EAS1795_0092:3:1:12499:2581#0/1
GTTTACTTGCTTTATAAGTTGTTTCGAATACAC
+HWUSI-EAS1795_0092:3:1:12499:2581#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12615:2579#0/1
GCACAATCCACCAGCCAAGTGCCTTGACCTTCG
+HWUSI-EAS1795_0092:3:1:12615:2579#0/1
ggfgcggggggggegggfdecfffeffffeefb
@HWUSI-EAS1795_0092:3:1:12776:2576#0/1
GCTGCCGAAGTCAAGAACACCCAGGCGGGCGAG
+HWUSI-EAS1795_0092:3:1:12776:2576#0/1
hhhhhhhghhhhhhghhfhhhhhhhhhhhhgeg
@HWUSI-EAS1795_0092:3:1:13196:2586#0/1
TAACTGTTTCATTTAAAATTTTTATAGAATTTT
+HWUSI-EAS1795_0092:3:1:13196:2586#0/1
hhhhhhhhhhhhhhhhhfhhhhghhgghhhhhh
@HWUSI-EAS1795_0092:3:1:13339:2587#0/1
CAACAACGTCTTAGGTGGATGCGGCTGGTGCCT
+HWUSI-EAS1795_0092:3:1:13339:2587#0/1
hhhhhhhhhhhhhhhghhfhfhhhhhhf[dcfB
@HWUSI-EAS1795_0092:3:1:13814:2580#0/1
AAAAGCTTATTTCGCGCAGGCACTCGCATATTC
+HWUSI-EAS1795_0092:3:1:13814:2580#0/1
ZZ\]VXTa\Z^[[Vb`R^aVZaff]a[ZZ_WZa
@HWUSI-EAS1795_0092:3:1:13884:2586#0/1
GCCGTGGACGCTGGGCCCGTGGACGTGGAAAGG
+HWUSI-EAS1795_0092:3:1:13884:2586#0/1
ggcgcdefffa_gggecffdffW^`\bf_f_fa
@HWUSI-EAS1795_0092:3:1:14272:2576#0/1
ACGACCCTGAAAATCACAGCCACCTCTGCCTTG
+HWUSI-EAS1795_0092:3:1:14272:2576#0/1
eggggggfggggggegggccgggggfggggggg
@HWUSI-EAS1795_0092:3:1:14397:2585#0/1
TCTTGTCTCCCTGACCATGTCCGGCGTAACCAC
+HWUSI-EAS1795_0092:3:1:14397:2585#0/1
hhhhghhhhhhhhhhhhhhhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14429:2580#0/1
TTCACAATCGGTTTTAATACATATCTTAAATTT
+HWUSI-EAS1795_0092:3:1:14429:2580#0/1
hhhhhhhfhghhhhheghhhhgehhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:14742:2580#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:14742:2580#0/1
ffcffafggfgggggfgffefef[ffc_cfffg
@HWUSI-EAS1795_0092:3:1:14836:2579#0/1
GGAGCACGAGTTCTACAAATAGATTATATTAAT
+HWUSI-EAS1795_0092:3:1:14836:2579#0/1
hhhhhhhhhghghhhhhghhhhghhhhhhcheh
@HWUSI-EAS1795_0092:3:1:14992:2582#0/1
GAATTTTGCTGCACTGCCGAATTTTCGCGAAAT
+HWUSI-EAS1795_0092:3:1:14992:2582#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:15199:2585#0/1
GCTGAAGCAGAAGCAGAAAGCTGGAGCGGAATT
+HWUSI-EAS1795_0092:3:1:15199:2585#0/1
gggggggggdggggggggg_fgffcfffggggf
@HWUSI-EAS1795_0092:3:1:15412:2584#0/1
CTTCAGCGTGTGATTCACCTCCAGGTCCGTCCC
+HWUSI-EAS1795_0092:3:1:15412:2584#0/1
ggdgaggffccfggg[ggggggffadfdfdfff
@HWUSI-EAS1795_0092:3:1:15540:2581#0/1
GAACGAATGGAGCGAAAGGAGCGCTTGATACGT
+HWUSI-EAS1795_0092:3:1:15540:2581#0/1
gdfgfgeggdagggcfgggggf_fffdadd[f[
@HWUSI-EAS1795_0092:3:1:15604:2582#0/1
TCAACCGTCTGCTGCGCAAGATGGTCTAAGGAC
+HWUSI-EAS1795_0092:3:1:15604:2582#0/1
hhhhhhhhhhhhhhhhhhhgghhhhhghhhhgh
@HWUSI-EAS1795_0092:3:1:16135:2580#0/1
CGGGCTTCTGGGAGCGCAGGACAGCGGAAGCGC
+HWUSI-EAS1795_0092:3:1:16135:2580#0/1
gggggggegggggggg_ggfgcggegggdggge
@HWUSI-EAS1795_0092:3:1:16593:2583#0/1
AAAATAAAGAAAATGAAAAACAAGTTCAAACTG
+HWUSI-EAS1795_0092:3:1:16593:2583#0/1
gfhhhhhhhhhhhhhhhhhhhhhhhhcghhgch
@HWUSI-EAS1795_0092:3:1:17018:2585#0/1
GTTGAGACGGCGATATAGCTTCCGGAAGCTGGG
+HWUSI-EAS1795_0092:3:1:17018:2585#0/1
hhhhhhhghhhhhfhghhhfhfhhghhfhfhhd
@HWUSI-EAS1795_0092:3:1:17375:2582#0/1
GAGCTTTAATGCCGATGTGCATCGCGCTCATAT
+HWUSI-EAS1795_0092:3:1:17375:2582#0/1
hhhghhhhhhfhhhhhhhhhhhfhhhhfhhhhg
@HWUSI-EAS1795_0092:3:1:17429:2579#0/1
GGCGACATCGTTATTCCGGGCATCTTCATCGCT
+HWUSI-EAS1795_0092:3:1:17429:2579#0/1
hhhhhhhhhhhhghhhhghhhchhhghhghhgg
@HWUSI-EAS1795_0092:3:1:17498:2584#0/1
CCCTGGTTGCCTAAGTTCTTGATTCGCTAGTTG
+HWUSI-EAS1795_0092:3:1:17498:2584#0/1
hhhhhhhhfhghchhhhehhhfghhfhhhhhgh
@HWUSI-EAS1795_0092:3:1:17850:2582#0/1
AAATTGTATAAGAGTATAAACCCGTTGAGTTCA
+HWUSI-EAS1795_0092:3:1:17850:2582#0/1
hhhhhhhhhhhhhhhghhhhhhhhhfhfhhhfd
@HWUSI-EAS1795_0092:3:1:19056:2575#0/1
GTTCGGCTCTTGGATTTCGACATCCGATTCATT
+HWUSI-EAS1795_0092:3:1:19056:2575#0/1
fgdggggggfgfgcggafffffggggacdfffg
@HWUSI-EAS1795_0092:3:1:19549:2586#0/1
GGGCAAGCCCCAGCTCACCCCCATTTACCCCCC
+HWUSI-EAS1795_0092:3:1:19549:2586#0/1
ggggggggggg[gfggg[dfccUcffcgggggg
@HWUSI-EAS1795_0092:3:1:19642:2586#0/1
CCGGTGCGGCCCAGAACCTTCATGACGCGTGCC
+HWUSI-EAS1795_0092:3:1:19642:2586#0/1
hfhfhhhghhhfgffhfehhhgghhghhhdggh
@HWUSI-EAS1795_0092:3:1:2244:2593#0/1
CTTCATTTGCGGCTTGGCTGCTTCTCTTGCTTG
+HWUSI-EAS1795_0092:3:1:2244:2593#0/1
gggggggggggggggaga]a__fccaffa[cfa
@HWUSI-EAS1795_0092:3:1:3078:2593#0/1
GGGCGATCTCCTTTTGGTAGTTCTGAATGCGCT
+HWUSI-EAS1795_0092:3:1:3078:2593#0/1
ggggg_fggf^gffffffc\ffafffdggggef
@HWUSI-EAS1795_0092:3:1:3142:2588#0/1
TTGGCGTCGAGCTTCTTCCAGTCGTAGACCTCG
+HWUSI-EAS1795_0092:3:1:3142:2588#0/1
ffcgggggggcgcfgg]ffffeggggggfgggd
@HWUSI-EAS1795_0092:3:1:4618:2589#0/1
CAGCAGTTACAAAAAACCAACACAAAAATGGCC
+HWUSI-EAS1795_0092:3:1:4618:2589#0/1
hhhhhhhhhhhhhhhhhghhfhhhhhhghhhhg
@HWUSI-EAS1795_0092:3:1:4788:2591#0/1
CAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAA
+HWUSI-EAS1795_0092:3:1:4788:2591#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhgh
@HWUSI-EAS1795_0092:3:1:5965:2596#0/1
GGTATGGACACCTCGGGCAGCGGCGCCGTGCAG
+HWUSI-EAS1795_0092:3:1:5965:2596#0/1
^c`dddcc^cWadcdcdW^BBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:6456:2596#0/1
AAAACCGTTGCCTGCTGCGAGATTTGTGGAGTT
+HWUSI-EAS1795_0092:3:1:6456:2596#0/1
hhhhhhhhghhhhhhhghhghhhghhhhaedhh
@HWUSI-EAS1795_0092:3:1:6537:2593#0/1
CTTGAAACCGGTATCACCATCATCGCCGCGCTC
+HWUSI-EAS1795_0092:3:1:6537:2593#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhghgh
@HWUSI-EAS1795_0092:3:1:6803:2597#0/1
GGCCGGTCTCAGTCTCCTGGCCACGGTCATCAT
+HWUSI-EAS1795_0092:3:1:6803:2597#0/1
hhdhhghhhhehgehghhchfhffghghfhghh
@HWUSI-EAS1795_0092:3:1:7220:2595#0/1
CCGTGATCCAAATGCAGGGGGAAGGTCTCGTTG
+HWUSI-EAS1795_0092:3:1:7220:2595#0/1
gggggdggggggcefWdffffd[ad^dfadf_c
@HWUSI-EAS1795_0092:3:1:7570:2588#0/1
GTAGAAAGGCCTTAGCTCCACTGAAAAATCAGA
+HWUSI-EAS1795_0092:3:1:7570:2588#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:7630:2589#0/1
ATCGAACACCGGCTTGAGCACTCCGAAGATCTT
+HWUSI-EAS1795_0092:3:1:7630:2589#0/1
gggggggggggggggcgc_dcaffdffcddffg
@HWUSI-EAS1795_0092:3:1:8367:2591#0/1
CTCCCCTCACTGTGATCTGTAGCTTTTTCTCGT
+HWUSI-EAS1795_0092:3:1:8367:2591#0/1
hhhhhhhhghhhhhfhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8634:2589#0/1
GACAGTTTGAGATCGAGCAACTGCAAACGTGGC
+HWUSI-EAS1795_0092:3:1:8634:2589#0/1
hhhhhhhhhhhhhhhfhhhhhhchhhhhfhghh
@HWUSI-EAS1795_0092:3:1:9542:2596#0/1
CGATTGGGTTCGAATAGCCCGTTGCTTCTTTTG
+HWUSI-EAS1795_0092:3:1:9542:2596#0/1
hhhhhhhhhhhhhhhfhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:10032:2589#0/1
CGGCAGCACCTGGCAGGAGAACTACGATTTGCT
+HWUSI-EAS1795_0092:3:1:10032:2589#0/1
hhhgghhghhfghhffgaffffahhgeghhhhh
@HWUSI-EAS1795_0092:3:1:10450:2596#0/1
CTGATCCATCTGCTCCTCCAGCTGCACCTCCAG
+HWUSI-EAS1795_0092:3:1:10450:2596#0/1
aaaaaccfdcafc`dd`fff_f_ffdcbbbb`f
@HWUSI-EAS1795_0092:3:1:10703:2597#0/1
GGAAGTCATAGGGTGCTCCATGAATATTTTGTT
+HWUSI-EAS1795_0092:3:1:10703:2597#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10732:2592#0/1
GTGGGTCAAATCAACTTTGCGATCGCCTCCAAG
+HWUSI-EAS1795_0092:3:1:10732:2592#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10991:2587#0/1
ATCGACAACAAGGCAATCTACGACACTTTCTCC
+HWUSI-EAS1795_0092:3:1:10991:2587#0/1
cgggcdffcafcffffacffffgccgggggggf
@HWUSI-EAS1795_0092:3:1:12391:2598#0/1
CGAAGGAAAGACCGATTACTATGCCAGGAAACG
+HWUSI-EAS1795_0092:3:1:12391:2598#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12421:2594#0/1
TGGGTGGCCACCAGAAGGTAGTCGCAGCTCAGT
+HWUSI-EAS1795_0092:3:1:12421:2594#0/1
gggggggggggggffggfaefeggggggggggg
@HWUSI-EAS1795_0092:3:1:12955:2596#0/1
CTCGTGTTCCGTGTCGCTGTGATAAGCAACTCC
+HWUSI-EAS1795_0092:3:1:12955:2596#0/1
fgggggggggfgcff_agggg_ffffagggfgf
@HWUSI-EAS1795_0092:3:1:13035:2598#0/1
CCGTTTTGTAGGTCTTGAGGCACATCAGGGACT
+HWUSI-EAS1795_0092:3:1:13035:2598#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13235:2588#0/1
CCTTCCAGGAGTTCCCCCCTCTGGGTCGCTTCG
+HWUSI-EAS1795_0092:3:1:13235:2588#0/1
hhhhhhhhghhhhhhhhhhhhhhghffhhhchh
@HWUSI-EAS1795_0092:3:1:13450:2596#0/1
TTGGATGATTACACTATGGTCTCGAATAAGCTG
+HWUSI-EAS1795_0092:3:1:13450:2596#0/1
d^__S^\\Z\\\YVYYY__Z_^XY[^[_Waaaf
@HWUSI-EAS1795_0092:3:1:13493:2589#0/1
GCAGCAGAGCGAGTGTGAAGAGCGAAATAGCGA
+HWUSI-EAS1795_0092:3:1:13493:2589#0/1
hhhhhhgghhhhhhhghhhehghgghhghhhhh
@HWUSI-EAS1795_0092:3:1:13945:2591#0/1
GGATAGCCTTGCATTTGCTGCAGGCGTGGGGAG
+HWUSI-EAS1795_0092:3:1:13945:2591#0/1
ggf_ffafffffggggegggggggggggggg`g
@HWUSI-EAS1795_0092:3:1:14059:2597#0/1
CTTGTGATTTCCGTACACCTCGGGAGGGGGCTC
+HWUSI-EAS1795_0092:3:1:14059:2597#0/1
hhhhhhgghhhhhhghhdhhhhghchhhhhhhh
@HWUSI-EAS1795_0092:3:1:14205:2598#0/1
CATATATGTCCTCCGTGTGCTGCCAATGTCCTG
+HWUSI-EAS1795_0092:3:1:14205:2598#0/1
fddc[fa\accccaaRaaaccccdddda^dd[d
@HWUSI-EAS1795_0092:3:1:14225:2590#0/1
GTCCTCGCCGGCAAGAAGCCCCAGTCCGTGCTG
+HWUSI-EAS1795_0092:3:1:14225:2590#0/1
afggfcggfgggffcff]fffaaa\d`^[^c]^
@HWUSI-EAS1795_0092:3:1:15064:2593#0/1
GGCAAATGCTGACTTGATCTCGGTGTTCAGTAC
+HWUSI-EAS1795_0092:3:1:15064:2593#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhdhhhh
@HWUSI-EAS1795_0092:3:1:15514:2592#0/1
GGGCACGGCTGTGCATCAGCTCCACCAGCTGGT
+HWUSI-EAS1795_0092:3:1:15514:2592#0/1
cfdaddaf]d_``ZbbaWad[dffcfd]P`bb]
@HWUSI-EAS1795_0092:3:1:15691:2590#0/1
GTCTCAACAGCTTGCCCACGCTTATGAATGGAT
+HWUSI-EAS1795_0092:3:1:15691:2590#0/1
ggfgggggfggggggcgggfcffcfffafdffg
@HWUSI-EAS1795_0092:3:1:16160:2596#0/1
CAGGAAGCCCAGGACCTACTTCCAGTAGGATTC
+HWUSI-EAS1795_0092:3:1:16160:2596#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16274:2587#0/1
CACGTAGTACTTGGCAGTTTCGAACTTCCACAG
+HWUSI-EAS1795_0092:3:1:16274:2587#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhd
@HWUSI-EAS1795_0092:3:1:16390:2590#0/1
GCTTAATGTAAGCGGTGGCATGTGGTGCCCTCG
+HWUSI-EAS1795_0092:3:1:16390:2590#0/1
hhhhhhhhhhhhhhhhhhhhhhfffffhhhhgh
@HWUSI-EAS1795_0092:3:1:16439:2588#0/1
CCACATATTTGTGCAATTCCATAATGGAGACAC
+HWUSI-EAS1795_0092:3:1:16439:2588#0/1
hhhhhhghhhehhhhhhhhhhhhhhhghhhhhf
@HWUSI-EAS1795_0092:3:1:16471:2599#0/1
CAAGAAGACCCAGCTGGGAGCCAAGGGAGTTCC
+HWUSI-EAS1795_0092:3:1:16471:2599#0/1
hgghhhhhhhhfhffhhhdghghhghgahgghh
@HWUSI-EAS1795_0092:3:1:16877:2596#0/1
CCTGGCTCCGTAGGGATCGTGTGAGGCTGCTAC
+HWUSI-EAS1795_0092:3:1:16877:2596#0/1
gffgegegggggggg_gffffef_fcfgggg_g
@HWUSI-EAS1795_0092:3:1:17241:2589#0/1
GTTCTTTAGTAAATCCGATAGGTTCGGCGAGGA
+HWUSI-EAS1795_0092:3:1:17241:2589#0/1
hhhhhhhhhhhhhfhhhfhhhhhhhhhhhgfhf
@HWUSI-EAS1795_0092:3:1:18098:2589#0/1
TGCGCATCAAGATGGATTGCGAAGTGCAGGAGC
+HWUSI-EAS1795_0092:3:1:18098:2589#0/1
hfhhhhhhhhhhgghhhghdhghgehgaffcfg
@HWUSI-EAS1795_0092:3:1:18243:2597#0/1
CACGGAGCTTGTGTGGACCGGTCGAGGGACGCG
+HWUSI-EAS1795_0092:3:1:18243:2597#0/1
hhhhhehhhhhghhhhhhghhhhhehgghgffh
@HWUSI-EAS1795_0092:3:1:18293:2592#0/1
AAACTAGCCGTTTGCCTCGGCGTGGCGGAGCAG
+HWUSI-EAS1795_0092:3:1:18293:2592#0/1
hhhhhhghhhhhhghhghhhhhehghhhcgegg
@HWUSI-EAS1795_0092:3:1:18414:2592#0/1
CGCCAATGGTCCCATTTCGATCGGCATCAATGC
+HWUSI-EAS1795_0092:3:1:18414:2592#0/1
gfhhhdhhhehhhhghhhhhhgcffcffhhhhh
@HWUSI-EAS1795_0092:3:1:19489:2592#0/1
GGGCAAGGCATCTTGATTGAGTTGTATTTCCTC
+HWUSI-EAS1795_0092:3:1:19489:2592#0/1
fcafdfdaff_fffcfWddaddccfffffffff
@HWUSI-EAS1795_0092:3:1:19791:2589#0/1
TGAGGCTCTATGGGCTGAGGCGATAAACACTGC
+HWUSI-EAS1795_0092:3:1:19791:2589#0/1
gggeg_ggffggggggg_adddaadc_dddbb]
@HWUSI-EAS1795_0092:3:1:1848:2600#0/1
GCAGGATGCCGCTGTTGGCCTACGAGCGTCTCT
+HWUSI-EAS1795_0092:3:1:1848:2600#0/1
gcgggggggggdfdaffgcgg^edac[ed_d_e
@HWUSI-EAS1795_0092:3:1:2465:2610#0/1
TCTCCATGTAGTCAATTGAACTAGTGGATTTAC
+HWUSI-EAS1795_0092:3:1:2465:2610#0/1
gggggagggfggf]fffgccccggggdafgg]g
@HWUSI-EAS1795_0092:3:1:2505:2605#0/1
CTGGTGCCTGAAGAAATGTTTCGTTAAGTTTGC
+HWUSI-EAS1795_0092:3:1:2505:2605#0/1
hhhhhghhghhhhhehchhhhghhhhhhhhhfh
@HWUSI-EAS1795_0092:3:1:2816:2601#0/1
CTGGCTTAATAGTGACATCTCACTCGATAGCTT
+HWUSI-EAS1795_0092:3:1:2816:2601#0/1
hhhhhhhhhhhhgfhhhhhhhghhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:3567:2601#0/1
TGCAGATCTGCTTTAGCTTCGAGTAGATGAGGA
+HWUSI-EAS1795_0092:3:1:3567:2601#0/1
hgghhhhhgghhhfhhhhhhhhhhhhfhhgghh
@HWUSI-EAS1795_0092:3:1:3747:2608#0/1
AGGGCCTCGTGGTGCATCTCCACGGACTTGACC
+HWUSI-EAS1795_0092:3:1:3747:2608#0/1
hhhhhhhhhhhhhhghhhghhehhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3881:2600#0/1
CTCGAACTTGTTCACTTGTTTACAAAAAAGGTA
+HWUSI-EAS1795_0092:3:1:3881:2600#0/1
accd^defd_ffc_f_ffffc]cff\cdcd\ff
@HWUSI-EAS1795_0092:3:1:4485:2607#0/1
GCTCCCTTGGCGCCAGCACCACCCTTGGTGACC
+HWUSI-EAS1795_0092:3:1:4485:2607#0/1
gggageggggggcggcffegggg`gggggg_ff
@HWUSI-EAS1795_0092:3:1:4952:2608#0/1
AGCAGCTTTTTGGCTCCAGCGGCGGGGGGTACA
+HWUSI-EAS1795_0092:3:1:4952:2608#0/1
gggcggeggggaf_fffafaffcccBBBBBBBB
@HWUSI-EAS1795_0092:3:1:5172:2601#0/1
CCTGGTTCTCGTGCTGGTTCCTCAGACCACGCT
+HWUSI-EAS1795_0092:3:1:5172:2601#0/1
hhhfhghhghghghhhhhhhghdhhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:5437:2604#0/1
GATCTTTTGCTGGATGGACTGGAGCTTGGCAAT
+HWUSI-EAS1795_0092:3:1:5437:2604#0/1
gdgggggggggggeegggggdgdfcffggcggg
@HWUSI-EAS1795_0092:3:1:5800:2607#0/1
AGCTCCTCGAGAATGGGATGCACGCACTTGTCG
+HWUSI-EAS1795_0092:3:1:5800:2607#0/1
hhhghhhhhhhhghhhhfhhghhghgfhhfhhh
@HWUSI-EAS1795_0092:3:1:5946:2600#0/1
GCCAGGATGCGGTTGCCATCGTTGTCCATGATG
+HWUSI-EAS1795_0092:3:1:5946:2600#0/1
hhhhghhghhhghhghffhhhhdgffhfhghhc
@HWUSI-EAS1795_0092:3:1:6277:2608#0/1
GGGTCTTCTCGTCTTTTAAATAAATTTTAGCTT
+HWUSI-EAS1795_0092:3:1:6277:2608#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6682:2608#0/1
TCCTGGACCATGTCGACTTTTTCGGGGTTCGAA
+HWUSI-EAS1795_0092:3:1:6682:2608#0/1
hhhghhhhhhhhhhhhhhhhhhghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:6720:2600#0/1
GTTTTTTTTCTCGCCTGTGCGTCGTCGGTGTCA
+HWUSI-EAS1795_0092:3:1:6720:2600#0/1
cffffeeggfcgfacfafcdcfdffdccb]eef
@HWUSI-EAS1795_0092:3:1:7303:2606#0/1
CTGTCCACCGACAGCCCCCTGAATCACGACCAG
+HWUSI-EAS1795_0092:3:1:7303:2606#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:8221:2609#0/1
CTTAGCCTCAATGGACGTGCGCCCGTTTGGCAG
+HWUSI-EAS1795_0092:3:1:8221:2609#0/1
_cdddc^\_S]ZdadadddcJ[aaa\af[fccd
@HWUSI-EAS1795_0092:3:1:8445:2603#0/1
TGTGTCGATATTTTCTCCTCGGACCTTGAAAAT
+HWUSI-EAS1795_0092:3:1:8445:2603#0/1
hhhhhhhhhfhhhhfghhhhhhhhhhhgghhgh
@HWUSI-EAS1795_0092:3:1:8849:2607#0/1
GGCGTTTGTATAATCCGTGAGCAGTCTTCACTG
+HWUSI-EAS1795_0092:3:1:8849:2607#0/1
hhhhhhhghhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9118:2600#0/1
GCTGGGCAGATTCCTTTTGACGCTGCAAATCAT
+HWUSI-EAS1795_0092:3:1:9118:2600#0/1
hhhhhhhhhhghhhhhhhhhgghhhhfhhfhhf
@HWUSI-EAS1795_0092:3:1:9561:2608#0/1
GGCGGCTATGTGAAGCTGTTCGACTGCTCCCTC
+HWUSI-EAS1795_0092:3:1:9561:2608#0/1
ggggggcgggggffefgccfffgggfgggggag
@HWUSI-EAS1795_0092:3:1:9726:2603#0/1
GCTAAACGCTTCAAATGCTTCTTGGGGCCACGA
+HWUSI-EAS1795_0092:3:1:9726:2603#0/1
hhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11457:2606#0/1
CAGCTACCTCCACCTGCCGCCCGAGATCGTGCC
+HWUSI-EAS1795_0092:3:1:11457:2606#0/1
hhhhfhhhhhhhhhhhhhghhgehghdhhachh
@HWUSI-EAS1795_0092:3:1:11509:2602#0/1
TTCGTTCGTCGTCGCAGCAGCATTGGTCGCAGA
+HWUSI-EAS1795_0092:3:1:11509:2602#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:12152:2602#0/1
ATGCATACCGATTCTTACTACAAAATATCGTTC
+HWUSI-EAS1795_0092:3:1:12152:2602#0/1
hhhhhghhhhhhhghhghhhghhghhhhhfhhh
@HWUSI-EAS1795_0092:3:1:12599:2603#0/1
TAAAAATAGAAGAAATGAAGAAAACAATGGACA
+HWUSI-EAS1795_0092:3:1:12599:2603#0/1
hhhhhhhhhghhghgghhhhghhhhhhhhhhhf
@HWUSI-EAS1795_0092:3:1:12637:2608#0/1
TCTTGGCTCCGGTGTTGTCGGCACAGTTCATCA
+HWUSI-EAS1795_0092:3:1:12637:2608#0/1
hhgghhhhghhhgghhhhgfhgghghghhhhhg
@HWUSI-EAS1795_0092:3:1:12747:2600#0/1
GTTGACCTTCTCCTTAAGGCCCACCAGTTCGTC
+HWUSI-EAS1795_0092:3:1:12747:2600#0/1
hhgdhhgghghghfhgghhhhhhhghghghegh
@HWUSI-EAS1795_0092:3:1:12890:2609#0/1
CGGTACGTGACTGCGTGCTGCTGCCTGTTCTTT
+HWUSI-EAS1795_0092:3:1:12890:2609#0/1
gfgggdggeggggagggggeggcgggfgefgfc
@HWUSI-EAS1795_0092:3:1:13087:2601#0/1
GTTGTGTCGGCCTCGATGATCTGATTATCGAAC
+HWUSI-EAS1795_0092:3:1:13087:2601#0/1
hhhhhhhhhhhhhhhhghhhghgfhhhghghgh
@HWUSI-EAS1795_0092:3:1:13424:2603#0/1
CGGCAACCGCGAGGACCAGATCAACCGTCTGCT
+HWUSI-EAS1795_0092:3:1:13424:2603#0/1
hhhghhhhchfahchhghgh]dhfddfffhfhg
@HWUSI-EAS1795_0092:3:1:13669:2610#0/1
ATTATCAACAGCAAATCCACCTCATAATCATTG
+HWUSI-EAS1795_0092:3:1:13669:2610#0/1
fcdfffaeggggd\dfcf_ffcfdfdfgdggdf
@HWUSI-EAS1795_0092:3:1:13888:2603#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:13888:2603#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14014:2607#0/1
TTTGGCTGGACGAGTGGCGTGATTTCTATTATT
+HWUSI-EAS1795_0092:3:1:14014:2607#0/1
YTZZa\Zaa^a_[VT\aWZXXT^aada`dfcff
@HWUSI-EAS1795_0092:3:1:14570:2601#0/1
CGGCGGTAGTGCTAGCAGCTTCCTGGGGGGTCT
+HWUSI-EAS1795_0092:3:1:14570:2601#0/1
ffffffBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:15184:2603#0/1
CGCGGGTCTGGCCGTTCTTCGAGATACCTGCCT
+HWUSI-EAS1795_0092:3:1:15184:2603#0/1
fgfgggggagggggdgfdgfggafcffgefgge
@HWUSI-EAS1795_0092:3:1:15276:2600#0/1
TCCTCGCCTTGCTGTGACTTTTCATCCTTCTTG
+HWUSI-EAS1795_0092:3:1:15276:2600#0/1
hhhhhhhhhhghhhhfhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15810:2600#0/1
TCCAGGTCTGCTCGGTTATGCTCGCTTAAGTTC
+HWUSI-EAS1795_0092:3:1:15810:2600#0/1
hhhhhhghhhhhhhhhhhhhhhhhfhhhghhhh
@HWUSI-EAS1795_0092:3:1:15880:2606#0/1
TCGGGACAGCAGTCGCTGGAGTCGTCCCGATCG
+HWUSI-EAS1795_0092:3:1:15880:2606#0/1
ffcf_cfb^ddacfc][f_a`_]Z^YYV]`]ZZ
@HWUSI-EAS1795_0092:3:1:15933:2605#0/1
ATATATATTTACATAAACGCGACTGTGTCTATA
+HWUSI-EAS1795_0092:3:1:15933:2605#0/1
fgdfcK_cedffggcfg_affadffffcdddcd
@HWUSI-EAS1795_0092:3:1:16127:2605#0/1
GGACGCAAGCGCAACGGTGTCCACCCCTCGCAC
+HWUSI-EAS1795_0092:3:1:16127:2605#0/1
ggggegdad^gcggggfffaffggggcfccfdg
@HWUSI-EAS1795_0092:3:1:16596:2606#0/1
TGAAAAACAAGTTCAAACTGCAACATCACACGG
+HWUSI-EAS1795_0092:3:1:16596:2606#0/1
hhhhhhhhhchhhgfhghhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16799:2604#0/1
CGTCGTCGCGCAGGAAGAACCGCAAGCGTCACT
+HWUSI-EAS1795_0092:3:1:16799:2604#0/1
fffdfadfdffffgggfafff_gggaddggefg
@HWUSI-EAS1795_0092:3:1:17293:2609#0/1
GAGGCTCCTTTGAACCCCAAGGCTAATCGCGAG
+HWUSI-EAS1795_0092:3:1:17293:2609#0/1
gaggefcfafffgegffgggegddffe_ddfdg
@HWUSI-EAS1795_0092:3:1:17538:2602#0/1
CTTCGCCCCTGCTAACATCACCACTGAGGTCAA
+HWUSI-EAS1795_0092:3:1:17538:2602#0/1
ggggggggggggfffffggeggdfffadfdfff
@HWUSI-EAS1795_0092:3:1:17560:2599#0/1
GCTAGACGCAATTTGTCCATTTAAGAAGCTAGT
+HWUSI-EAS1795_0092:3:1:17560:2599#0/1
hfhhhhhhhghhhhhhhghhhhhhghhhghghh
@HWUSI-EAS1795_0092:3:1:17654:2610#0/1
GTTTTCGTGGGCAGCACTTCGATGTGATTATCG
+HWUSI-EAS1795_0092:3:1:17654:2610#0/1
fdfffffgggeggggggggggYgggfgfgggge
@HWUSI-EAS1795_0092:3:1:18275:2606#0/1
AAGAGACAGAACTCAGTAGCAGCCTCATCAACT
+HWUSI-EAS1795_0092:3:1:18275:2606#0/1
ggfggdcggadcfffffggggggggggggaggg
@HWUSI-EAS1795_0092:3:1:18548:2608#0/1
CACGCTCATCAAAAGGATGGGAATATTCGCTGA
+HWUSI-EAS1795_0092:3:1:18548:2608#0/1
hhhhhhhhhghhhhhhfhhhhhhhhhhhhchhh
@HWUSI-EAS1795_0092:3:1:19304:2599#0/1
GCAGGAAGTACCAGAAGCGGGATTTGGCCACGA
+HWUSI-EAS1795_0092:3:1:19304:2599#0/1
hhhhhhhhhhhhdhhhfhhhhgghhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:1559:2615#0/1
TGAAAATCTGAAGAAGAAGCGTACCTTCAAGAA
+HWUSI-EAS1795_0092:3:1:1559:2615#0/1
^^^\Ya[a`]ddcafdcdccadffffcfff_ff
@HWUSI-EAS1795_0092:3:1:1850:2621#0/1
CAATGATCCTGTATCTCGAGCTAGCTCTTTTTT
+HWUSI-EAS1795_0092:3:1:1850:2621#0/1
cacdddf_Za_\cdedefffffff_ff_ffddc
@HWUSI-EAS1795_0092:3:1:1870:2618#0/1
GTATTATTTTCCTACTGTCATTCGGAAAATTTT
+HWUSI-EAS1795_0092:3:1:1870:2618#0/1
fcffcffdffcfacffffcfcfaeeaRYT__`f
@HWUSI-EAS1795_0092:3:1:1956:2621#0/1
TGAATGGGTATCTGCATGCGCATGTCTCGTACC
+HWUSI-EAS1795_0092:3:1:1956:2621#0/1
f\fdf]`_eedcaeeddgfdagffffdffdffg
@HWUSI-EAS1795_0092:3:1:2596:2617#0/1
CGACATCCTGACCCTTTTGGAATCCGAACGTGA
+HWUSI-EAS1795_0092:3:1:2596:2617#0/1
ScaYa^S\aa_acacc_^W_SWccccS\aa]bc
@HWUSI-EAS1795_0092:3:1:2624:2614#0/1
CGCGCTTCTACTTCGTTTCCCGATCGCCGCCGC
+HWUSI-EAS1795_0092:3:1:2624:2614#0/1
gfggdffffdffgfgggggggggcgcggggggg
@HWUSI-EAS1795_0092:3:1:2761:2619#0/1
GAACTTTTTCCAGCTGATGTAAGGCCACGCAAT
+HWUSI-EAS1795_0092:3:1:2761:2619#0/1
hghhhhhhhhhhhhhhhhghhhhhhhhghghhh
@HWUSI-EAS1795_0092:3:1:2851:2614#0/1
GGGCTCCGTTGCCAGTGCATCCGCAACACCGGG
+HWUSI-EAS1795_0092:3:1:2851:2614#0/1
hhhhehdhhhghhhhhfgfghghhhghehhhhf
@HWUSI-EAS1795_0092:3:1:3062:2615#0/1
TGAAGATCGTGGATGGCCTTAGATATCATTTCC
+HWUSI-EAS1795_0092:3:1:3062:2615#0/1
hhhhhhhhhhhhhhhhhhhghhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:3484:2621#0/1
GGATTCTTATATTCTTGTTTCTTGTTTCTTGTG
+HWUSI-EAS1795_0092:3:1:3484:2621#0/1
hhhhhhhhghhhhhhhhhhhghhhhhhhhhghh
@HWUSI-EAS1795_0092:3:1:3510:2611#0/1
AGGTGATCGAGCGTACGCCCAAGAGCACTGTAG
+HWUSI-EAS1795_0092:3:1:3510:2611#0/1
hhhehhhhhhhhhhhhhhhhhhchhchhghhfh
@HWUSI-EAS1795_0092:3:1:4072:2615#0/1
CTCCTCAATCTCCACAACGTTAACGGAATACTG
+HWUSI-EAS1795_0092:3:1:4072:2615#0/1
hfhhehhhhhhhghghhehhhhhhhhhhhahhh
@HWUSI-EAS1795_0092:3:1:4584:2622#0/1
GCAACGCCTACAGCAGCGGGGCCAAACTGCCGG
+HWUSI-EAS1795_0092:3:1:4584:2622#0/1
ggfgag^gggcggSgggeceggfa^cfeffegc
@HWUSI-EAS1795_0092:3:1:5616:2619#0/1
GCCGAGGCGATGGTGGGGTAGCCCACGGACAAA
+HWUSI-EAS1795_0092:3:1:5616:2619#0/1
hhhhghehhhhhhhhhhhcchhghhhhhhghhh
@HWUSI-EAS1795_0092:3:1:5912:2613#0/1
ATTGGACAGGCTGCCGGTGACCAGGTTGCTCAG
+HWUSI-EAS1795_0092:3:1:5912:2613#0/1
gggggggggggggaggg_ffcffffdffdcfeg
@HWUSI-EAS1795_0092:3:1:6177:2617#0/1
CCGAGACCCTGCAATTGCGCGGTACCCTCATTG
+HWUSI-EAS1795_0092:3:1:6177:2617#0/1
gggggfggggggggfggggdgggggggcfcggg
@HWUSI-EAS1795_0092:3:1:6437:2617#0/1
AAGAAAAGAAAGCGAGATGATCACCTGAATGAA
+HWUSI-EAS1795_0092:3:1:6437:2617#0/1
fgffggggggcggggcggedgggfgggggffgg
@HWUSI-EAS1795_0092:3:1:6612:2615#0/1
TTCCGGATTGACAGAGATGATTCAGAGAAAGGC
+HWUSI-EAS1795_0092:3:1:6612:2615#0/1
hghhhhgfhfhhhhghhhhhhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:6797:2615#0/1
CGGAGGCCACCACGGAATCGAACAGCAGGGAGC
+HWUSI-EAS1795_0092:3:1:6797:2615#0/1
hhhehhhhfhhehfgcghhhggghhahahhgcg
@HWUSI-EAS1795_0092:3:1:8384:2611#0/1
CAAGTAGTTGCTTTGGCTGACACTTTACAAACC
+HWUSI-EAS1795_0092:3:1:8384:2611#0/1
hhhghhhhhhhhhghhhhhhhghhhhhfhhhhh
@HWUSI-EAS1795_0092:3:1:8937:2614#0/1
CAAGGTTGTCAAGGTCGCCAACGTCTCCCTGTT
+HWUSI-EAS1795_0092:3:1:8937:2614#0/1
hhhhhhhhhhhhhhghhhhhhhhhhghhhhghe
@HWUSI-EAS1795_0092:3:1:9385:2614#0/1
TGTGGAGTAGGGGTAGCAGGCCTCCTTAGTGCC
+HWUSI-EAS1795_0092:3:1:9385:2614#0/1
ffffdffgggggfffcKffccffgggggggggf
@HWUSI-EAS1795_0092:3:1:9582:2612#0/1
AAGAACGGCAAGTTCGTGTCCTACATCACAGAG
+HWUSI-EAS1795_0092:3:1:9582:2612#0/1
hhghhhhhhhhhhghhhhhhhhhhhhhghhhgf
@HWUSI-EAS1795_0092:3:1:9600:2621#0/1
CTGGCATGGTCAGGCTTGGGGGGAGTAGATGGT
+HWUSI-EAS1795_0092:3:1:9600:2621#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:10131:2618#0/1
GAACACATGACCTTGCGAGTCCTTAATGTGCAC
+HWUSI-EAS1795_0092:3:1:10131:2618#0/1
fdcffffd[ffda^acacdbedfcffcddffff
@HWUSI-EAS1795_0092:3:1:10438:2617#0/1
GCCGGAGCTGGCCTATCCGAGACAGCCATCATG
+HWUSI-EAS1795_0092:3:1:10438:2617#0/1
gcgggdgggggfgagaggfggegg_gdggggag
@HWUSI-EAS1795_0092:3:1:10484:2618#0/1
GGCCGCTCGTGGCCTGTGCGCCATTGCCCAGGC
+HWUSI-EAS1795_0092:3:1:10484:2618#0/1
hhhhhhhhhhhhhhhfghhhghghhghhhghhh
@HWUSI-EAS1795_0092:3:1:10527:2613#0/1
AGCTTTTCCTTAGGTTTTTCAGATAGAAAGATA
+HWUSI-EAS1795_0092:3:1:10527:2613#0/1
hhhhhhhhhhhhhhhhhhhhhgfhhhhhhhgfh
@HWUSI-EAS1795_0092:3:1:10609:2619#0/1
TGCTGTTTCACTTTCCCTACTCTCATTCGGGTT
+HWUSI-EAS1795_0092:3:1:10609:2619#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11094:2616#0/1
CACCGAGGTGCGCGCTAATTTCACGGATCCACA
+HWUSI-EAS1795_0092:3:1:11094:2616#0/1
hhhghehhghhhhhhhhhhhhhhhhhfghhhhh
@HWUSI-EAS1795_0092:3:1:11214:2619#0/1
ATTGACAATGGTAGAGAATACTTGTCAAATGAG
+HWUSI-EAS1795_0092:3:1:11214:2619#0/1
dggggfgggggggggggggggggggfgffffdf
@HWUSI-EAS1795_0092:3:1:11353:2616#0/1
TGTAATTCCGTAGCTAAACGTACAGAGTGTTAT
+HWUSI-EAS1795_0092:3:1:11353:2616#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11701:2614#0/1
GATGTCGAGAACATGTTTCTCTACAACAGTGAC
+HWUSI-EAS1795_0092:3:1:11701:2614#0/1
gggggggfggggf_ffffddffgggggcggggg
@HWUSI-EAS1795_0092:3:1:12206:2612#0/1
GTTTACAAAAAAGGTAGGTATGGGCTATTTAGG
+HWUSI-EAS1795_0092:3:1:12206:2612#0/1
gggfgfgggeggggeggfcacfffcffggggcf
@HWUSI-EAS1795_0092:3:1:12280:2621#0/1
CCGGCACGCAGCTTGGTGTGGTAGCGGATGGTG
+HWUSI-EAS1795_0092:3:1:12280:2621#0/1
ggggggggggggggfggfdffdcffffdeffad
@HWUSI-EAS1795_0092:3:1:12556:2615#0/1
GAAAAAAAGAAAAAATAAATTAATGGAAACTAA
+HWUSI-EAS1795_0092:3:1:12556:2615#0/1
gggggggcggggggggggfgggggggggggggc
@HWUSI-EAS1795_0092:3:1:13193:2614#0/1
TGAAGGGGCACGGCTTCTAAGCGGTCGAACGAA
+HWUSI-EAS1795_0092:3:1:13193:2614#0/1
YaRVV^Ibab]X\ba\aP^aWaZZN_aTUWLZc
@HWUSI-EAS1795_0092:3:1:13232:2620#0/1
TCCCAGTAAGTGTGAGTCATTAACTCGCATTGA
+HWUSI-EAS1795_0092:3:1:13232:2620#0/1
hhhhhhhhhgefffhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13331:2611#0/1
ATCGAGGAGATGGACTTCCCGCGACTCATCAAG
+HWUSI-EAS1795_0092:3:1:13331:2611#0/1
gfgegggfgdcggggggggggcfggafffffdg
@HWUSI-EAS1795_0092:3:1:13917:2617#0/1
CAACGTAGAAAGGCCTTAGCTCCACTGAAAAAT
+HWUSI-EAS1795_0092:3:1:13917:2617#0/1
hhhhhhhfhghhghhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14178:2617#0/1
CTAGGACTACCATGGTTGCAACGGGTAACGGGG
+HWUSI-EAS1795_0092:3:1:14178:2617#0/1
hhhhhhhhgghhhfhhhhhhhhhhhghhhhhch
@HWUSI-EAS1795_0092:3:1:14538:2615#0/1
GCTGCCTCCAGAAGAGTTGATTTCGTTATCCTG
+HWUSI-EAS1795_0092:3:1:14538:2615#0/1
ddcfcfc___\Zaeade^eeeaff_ddfffad^
@HWUSI-EAS1795_0092:3:1:15743:2613#0/1
CCGTTTTGTGACCGTTTGAATTAAATTTTTTCT
+HWUSI-EAS1795_0092:3:1:15743:2613#0/1
gdggeggggegfgggggfgfggggfgggggggg
@HWUSI-EAS1795_0092:3:1:15761:2612#0/1
TGGCGGGGCGCTGGGCATACTTGGAGCCGATAA
+HWUSI-EAS1795_0092:3:1:15761:2612#0/1
fcf_f_c`]``Q^b^PZSZZ_a^W^^^BBBBBB
@HWUSI-EAS1795_0092:3:1:16444:2621#0/1
ATCTACCCCGGTCATGGCAAGACCATGGTCAAG
+HWUSI-EAS1795_0092:3:1:16444:2621#0/1
hhhhhhhhhhhhhhhhggghgghhhhggdhhgc
@HWUSI-EAS1795_0092:3:1:16572:2619#0/1
CGAATTCGGGGAAGTTCTTGTCATAGAAGTCAT
+HWUSI-EAS1795_0092:3:1:16572:2619#0/1
hhhgdhghhhhhghhhdhghhhhhhhhhghhgh
@HWUSI-EAS1795_0092:3:1:16964:2619#0/1
CACAGATTTCGCTAACCTTTATTTTTTGCGTTC
+HWUSI-EAS1795_0092:3:1:16964:2619#0/1
hhhhhhhhhggdhhhfhhhhghhhhhfgchhhh
@HWUSI-EAS1795_0092:3:1:17007:2613#0/1
ATCGAGCTGGGCACCGCCTGCGGTAAATACTTC
+HWUSI-EAS1795_0092:3:1:17007:2613#0/1
hhhghghgfhhhhhhghgfhghhhhghfhhhhh
@HWUSI-EAS1795_0092:3:1:17150:2615#0/1
TGGTAGCTGTTGGACCAACTGGCAGCAGCCAGG
+HWUSI-EAS1795_0092:3:1:17150:2615#0/1
hhhhhhghhcfhe[hhghhhhh\fff_affdfh
@HWUSI-EAS1795_0092:3:1:18640:2616#0/1
TTCCTACAGAGAATCAACTGGCTGACATATTTA
+HWUSI-EAS1795_0092:3:1:18640:2616#0/1
gggggggggfgggggggggggdfcggggggggg
@HWUSI-EAS1795_0092:3:1:18719:2613#0/1
ATCAAATTGCCGCTAAACGAGCCCTCAACCTCA
+HWUSI-EAS1795_0092:3:1:18719:2613#0/1
ghhhhhhghhhheahhhhfhhhhgghgfhhefg
@HWUSI-EAS1795_0092:3:1:19734:2615#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19734:2615#0/1
hfhhghhhhhghehhhhhfhhghhhhggcghgf
@HWUSI-EAS1795_0092:3:1:1799:2630#0/1
TCGCAAGTGTGTTGCACAGTATATTCGCCACAT
+HWUSI-EAS1795_0092:3:1:1799:2630#0/1
_fff[fdcdfdfff]aRaa\^^adadc]f[c[`
@HWUSI-EAS1795_0092:3:1:3140:2623#0/1
ATCGATTTCCGGCTCTGAACCTAACTTAAACAT
+HWUSI-EAS1795_0092:3:1:3140:2623#0/1
hhhhehhhhhghhghhhhhghhhhhghhghhge
@HWUSI-EAS1795_0092:3:1:4204:2630#0/1
CTGGCAGCAGCAGCAGGAGGAGCGCCTGCTGGG
+HWUSI-EAS1795_0092:3:1:4204:2630#0/1
c^f\fafcfc^fff_dfdfdffX`\^]ffcfff
@HWUSI-EAS1795_0092:3:1:4225:2632#0/1
GAATAGTGTTGCCAGTACGTAGGCGAACCCATT
+HWUSI-EAS1795_0092:3:1:4225:2632#0/1
gefffffhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4793:2628#0/1
CATGTCCGTGCTGCTGCAGCATGAGAAGCAGCC
+HWUSI-EAS1795_0092:3:1:4793:2628#0/1
gggggggggggggggggggggfggffgggdggg
@HWUSI-EAS1795_0092:3:1:4851:2629#0/1
GCCAAGTTCTGGCAGGGCAACCGCGAGATCTAC
+HWUSI-EAS1795_0092:3:1:4851:2629#0/1
hghhhhhhhghhghhhhhhhhhfhhhgghhhee
@HWUSI-EAS1795_0092:3:1:4888:2627#0/1
GATTTAAACAAAACTAGTGCTTTAACAAAGATC
+HWUSI-EAS1795_0092:3:1:4888:2627#0/1
ggggfagfcffff`fffff[fcfcffcgggggf
@HWUSI-EAS1795_0092:3:1:5311:2630#0/1
CTCGGTTTCAGTTGGTTTCACTTCGCAGTCGCT
+HWUSI-EAS1795_0092:3:1:5311:2630#0/1
hhhghhhhhhhhhgdghhhhehhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:5394:2631#0/1
GTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC
+HWUSI-EAS1795_0092:3:1:5394:2631#0/1
`T^Y\aS^`]]]ada`]QLSSMa^]aa^a^W^R
@HWUSI-EAS1795_0092:3:1:6535:2623#0/1
GTGCTTTCCAGTGGCCTGAACGGAGGGAAGGAG
+HWUSI-EAS1795_0092:3:1:6535:2623#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhfhhhc
@HWUSI-EAS1795_0092:3:1:7020:2627#0/1
CCCCACCATAAATTTTCAAGGTCCGAGGAGAAA
+HWUSI-EAS1795_0092:3:1:7020:2627#0/1
hhhhghghhhfgghhhfhhghghhhhhfhhghh
@HWUSI-EAS1795_0092:3:1:8160:2634#0/1
TGGGCATGTAAATCCTCTACAGACTGTCTGGCA
+HWUSI-EAS1795_0092:3:1:8160:2634#0/1
gggfggggggggggffgdgfggggcggf_fffg
@HWUSI-EAS1795_0092:3:1:8470:2628#0/1
CGCCGGTCTTCTTGTCCTTCTTAGCCTTCAGAC
+HWUSI-EAS1795_0092:3:1:8470:2628#0/1
gggggggf_fffgfgggggfggggggggggggg
@HWUSI-EAS1795_0092:3:1:9268:2630#0/1
CCCAAGGTGGAGAAGCAGGAGAAGAAGAAGAAG
+HWUSI-EAS1795_0092:3:1:9268:2630#0/1
hhhhhhhhhhhfhhhhhhhgghhhhghhghhhg
@HWUSI-EAS1795_0092:3:1:9716:2630#0/1
CCCCTCCCGAGGTGTACGGAAATCACAAGTGGT
+HWUSI-EAS1795_0092:3:1:9716:2630#0/1
hhhhehhhhhhhehhhahgghhhhhhhhhffhh
@HWUSI-EAS1795_0092:3:1:10146:2629#0/1
AGGATATCTATAAAAAAGCCCACCAGGCAATTC
+HWUSI-EAS1795_0092:3:1:10146:2629#0/1
hhhhhhhhhhhhhhhhhchhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:10921:2628#0/1
GTCTTTCCTTCGCGACGCCTTCGGAACTTGACT
+HWUSI-EAS1795_0092:3:1:10921:2628#0/1
ffggggfggfgfgggggfggggg_ggggggggf
@HWUSI-EAS1795_0092:3:1:11366:2629#0/1
CAGGTTCTTGCCGTCATTGAGGTCCCACAGCAG
+HWUSI-EAS1795_0092:3:1:11366:2629#0/1
ggffeffffffffdffffffffgggggcfdfdg
@HWUSI-EAS1795_0092:3:1:11570:2633#0/1
TAGCAGGCTATGTCCGTGGTCACGCTCTTGATG
+HWUSI-EAS1795_0092:3:1:11570:2633#0/1
ghhhhhghhfhhhhghdhhhhghhhhhhhafeh
@HWUSI-EAS1795_0092:3:1:11615:2629#0/1
GCCAGCTCAGTGCGGACAGAAACCACACATAGA
+HWUSI-EAS1795_0092:3:1:11615:2629#0/1
[dfcf]faffcacff]fafcdffdffcfccf]g
@HWUSI-EAS1795_0092:3:1:12297:2630#0/1
TGCACAGACGGGAGTTGGCCGAGGCGGCAAAGT
+HWUSI-EAS1795_0092:3:1:12297:2630#0/1
gggggfggggggggfggggggcggegggegggg
@HWUSI-EAS1795_0092:3:1:13019:2623#0/1
GTAGTTATATGCTTGTCTCAAAGATTAAGCCAT
+HWUSI-EAS1795_0092:3:1:13019:2623#0/1
\\\\\\\XYYYXdccdadcdd^\__^Vda^daf
@HWUSI-EAS1795_0092:3:1:13593:2630#0/1
GCGGCAGGCTGGTCAGTGACTTCAGCAGAATGG
+HWUSI-EAS1795_0092:3:1:13593:2630#0/1
egggggggfcagadffdgggfgggggggfgcfg
@HWUSI-EAS1795_0092:3:1:14157:2632#0/1
GCACCAACGTCTACGTGGGCATCCATCCCAGCA
+HWUSI-EAS1795_0092:3:1:14157:2632#0/1
ffcgggdggggggfggggfggggfgegggadfd
@HWUSI-EAS1795_0092:3:1:14299:2624#0/1
CTTCGTCGTGGACAGCAATGACCGAGAGCGTAT
+HWUSI-EAS1795_0092:3:1:14299:2624#0/1
hhhhhhhhhhhhheghhhgchhhhffghhhghh
@HWUSI-EAS1795_0092:3:1:14638:2629#0/1
CCCAGGTGTTAAGTCATCGACTAAAGCCGGGAG
+HWUSI-EAS1795_0092:3:1:14638:2629#0/1
ffccf_ffcfffedfYcedeeedf]ffdfadaf
@HWUSI-EAS1795_0092:3:1:14720:2629#0/1
TGTTGATTAAATAAGTAGCAGTTAATACTGCTT
+HWUSI-EAS1795_0092:3:1:14720:2629#0/1
hfhhhghhghhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15468:2623#0/1
AGCGATTGACTGGCTTACAAACTGAACCGGATG
+HWUSI-EAS1795_0092:3:1:15468:2623#0/1
facdfafggfggg_ggecggg]geggggfggdg
@HWUSI-EAS1795_0092:3:1:16001:2629#0/1
CTGGCGTGCACCTGGGGGCTGTCCAGCGAGAAT
+HWUSI-EAS1795_0092:3:1:16001:2629#0/1
hhhhhhhhhhhhhhhhhghghgdhhhhhggahg
@HWUSI-EAS1795_0092:3:1:16322:2629#0/1
GAAAATATTGATCATTTAACGCTGTTTGTTCAA
+HWUSI-EAS1795_0092:3:1:16322:2629#0/1
hhhghhhhhfhhhhhhhhhhhhhfhhhhhghgh
@HWUSI-EAS1795_0092:3:1:16657:2627#0/1
GTTGATCATTCGCAACAACAACGCCTTCTTGTT
+HWUSI-EAS1795_0092:3:1:16657:2627#0/1
aRSPS^SS^ZSSPPSSSPTTXNRSTSVcc]]]Q
@HWUSI-EAS1795_0092:3:1:16740:2634#0/1
CGGCTCTGCTTTCTTTTTGGCATTTGCACATGT
+HWUSI-EAS1795_0092:3:1:16740:2634#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhhghhh
@HWUSI-EAS1795_0092:3:1:16852:2630#0/1
GGCAGGGGTCTGGAAGCGACCGTGACCCATCTT
+HWUSI-EAS1795_0092:3:1:16852:2630#0/1
ggggggggcdgffffffggggggggggcggggg
@HWUSI-EAS1795_0092:3:1:17122:2628#0/1
GTTCTTGTTGGCGCGCAGGTGTGTGAGGAAGAC
+HWUSI-EAS1795_0092:3:1:17122:2628#0/1
hfhhhhhhhhghhhhhfhhafgfhhfhhfafhh
@HWUSI-EAS1795_0092:3:1:17594:2623#0/1
CCACCACGGAGACGAAGGACCAAGTGAAGGGTG
+HWUSI-EAS1795_0092:3:1:17594:2623#0/1
hhghhhhhhghehffhghghhghhfhhfhheac
@HWUSI-EAS1795_0092:3:1:18022:2628#0/1
GGGAGATATTAGACCTCGGTTTGGTATCGTCAA
+HWUSI-EAS1795_0092:3:1:18022:2628#0/1
gggegaggeggggfggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:18372:2633#0/1
TGACCCTTGAGGGTATCAAGCAGTTTTACGTCA
+HWUSI-EAS1795_0092:3:1:18372:2633#0/1
dfegggecggfcfddfffffd_ggfggggcgeg
@HWUSI-EAS1795_0092:3:1:18466:2631#0/1
ATTTGGGCCGCAATGAGATTACGCTAAACAACA
+HWUSI-EAS1795_0092:3:1:18466:2631#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:18766:2629#0/1
GCGGTCGCTAGATTTGTAAATTTCTACAAAAAA
+HWUSI-EAS1795_0092:3:1:18766:2629#0/1
cggggggdgg_afffffdccffgfgeggggccg
@HWUSI-EAS1795_0092:3:1:1611:2646#0/1
CTCTTGTTCATCGTGTCGCCGGCATCGCAATCC
+HWUSI-EAS1795_0092:3:1:1611:2646#0/1
acafeabffdaffd^fdffafcc\_aaZX^aaB
@HWUSI-EAS1795_0092:3:1:2252:2642#0/1
GGCCAATCCATAGCTCTGCGCTCCACCATTGCC
+HWUSI-EAS1795_0092:3:1:2252:2642#0/1
Rbefdfbfffffcadfffcffcf[ff_cdeddc
@HWUSI-EAS1795_0092:3:1:2958:2641#0/1
GGGGTTTTCTAGTTTAATGTTAATACTAGTTAA
+HWUSI-EAS1795_0092:3:1:2958:2641#0/1
hhhhhhhhhhhhhhhhhhhhhhghffhehhhhh
@HWUSI-EAS1795_0092:3:1:3023:2640#0/1
AAATTCTTTGCCTTCCAGAATAAGAAAGTCATC
+HWUSI-EAS1795_0092:3:1:3023:2640#0/1
hhghhhhhhchhhfhghhhhfhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:3164:2637#0/1
CACAGTATATTCGCCACATTCAACCGCTTATTC
+HWUSI-EAS1795_0092:3:1:3164:2637#0/1
gggggggggfggggggggggfgggggggggegg
@HWUSI-EAS1795_0092:3:1:3993:2638#0/1
CGGACTTCAGATTGGGATAGCCCCAGATGATGT
+HWUSI-EAS1795_0092:3:1:3993:2638#0/1
hhhhhhhhhhhhhhhhhghhhhhhhhfhhhhhg
@HWUSI-EAS1795_0092:3:1:4412:2645#0/1
GGAACCCCCACGTGACCGCAAGAAGCAGAAGAA
+HWUSI-EAS1795_0092:3:1:4412:2645#0/1
hhhhhhhghhhhhhhhhdchhfhhfhghhhahh
@HWUSI-EAS1795_0092:3:1:4563:2640#0/1
ATCAGCAGTTCTAAGTAGAGCCTCAGCCGCATA
+HWUSI-EAS1795_0092:3:1:4563:2640#0/1
hhhhhhfhhhhhhfhfghfhhhfgfhhhhhghh
@HWUSI-EAS1795_0092:3:1:5144:2644#0/1
CCACTGGCGATGACGAGGACGTGGAGATGGTGG
+HWUSI-EAS1795_0092:3:1:5144:2644#0/1
hhhhhhhhhhhhhhhgfhdhfdffcfcfffaff
@HWUSI-EAS1795_0092:3:1:6438:2644#0/1
GGACACGACGCCAGAGGTCCTAGAGGCACTCCA
+HWUSI-EAS1795_0092:3:1:6438:2644#0/1
hhhhhhhghhhhhfgffhhhhhhhhghgghhhh
@HWUSI-EAS1795_0092:3:1:6783:2640#0/1
ATTTTGTTGGGGAGTGTGTGGAATAGTCAGCTG
+HWUSI-EAS1795_0092:3:1:6783:2640#0/1
gggggfgeggggeggggdffffgggdggggdgf
@HWUSI-EAS1795_0092:3:1:7245:2645#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:7245:2645#0/1
ggggggegeffgaffffgggdcddgagfdcfa^
@HWUSI-EAS1795_0092:3:1:7277:2640#0/1
CGGGTATACAATCTCCACTGGACGGGCACAATC
+HWUSI-EAS1795_0092:3:1:7277:2640#0/1
fca^fdfgdgggfegfgaaaffafa]cWc^Rad
@HWUSI-EAS1795_0092:3:1:7405:2638#0/1
GAAAGAGCTAACACATGGCTGGACATGAAGAAA
+HWUSI-EAS1795_0092:3:1:7405:2638#0/1
gggcgfgfcffcgggggffaggggfegggcgfg
@HWUSI-EAS1795_0092:3:1:7698:2638#0/1
TGGCGCTACCAGGGCCGTCAGATGGACGGCGTC
+HWUSI-EAS1795_0092:3:1:7698:2638#0/1
hhhghhhhhhhchghhhhhhhgahhhfhgahgh
@HWUSI-EAS1795_0092:3:1:7726:2638#0/1
CTAAGCCTCAGATATCCTATAATGAAGAGGATA
+HWUSI-EAS1795_0092:3:1:7726:2638#0/1
hhhhhhhfhhhhfhhhhhhhhhghhghhhghhh
@HWUSI-EAS1795_0092:3:1:8375:2642#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8375:2642#0/1
gggggg]ggffggggggggggfgfggfggggfg
@HWUSI-EAS1795_0092:3:1:9768:2642#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:9768:2642#0/1
hhhhehfhhhhhhfhhhhhhfhhghghhfhhhh
@HWUSI-EAS1795_0092:3:1:9937:2639#0/1
CTCAAACCAGCACAGCAAAATTCCACGTCTGTT
+HWUSI-EAS1795_0092:3:1:9937:2639#0/1
ggggggggggggggefgggggggcgdgfggggg
@HWUSI-EAS1795_0092:3:1:10557:2641#0/1
GTACTGCAAGAGGCAAAGGCCTGGTTTGTCTGC
+HWUSI-EAS1795_0092:3:1:10557:2641#0/1
hhghhhhhhhhhhhhhhgfhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10764:2637#0/1
GTTCCGGTACTTGTGCCAGAGCAACGCTTTGCC
+HWUSI-EAS1795_0092:3:1:10764:2637#0/1
hhhhhhhghhhhhhhhhhgghhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11312:2645#0/1
CTCATGGGCGTGGATGAGGGTAAAATGTACCAG
+HWUSI-EAS1795_0092:3:1:11312:2645#0/1
hhhhhhhhhhhhhahghhhhghhhghhhhhhfh
@HWUSI-EAS1795_0092:3:1:11848:2642#0/1
CGCTTGGTAAGATCGACATCGGCCTTCTTCAGC
+HWUSI-EAS1795_0092:3:1:11848:2642#0/1
hhhhhghhgghhhhffdhhhhhhghhhhhhghh
@HWUSI-EAS1795_0092:3:1:12554:2640#0/1
AGGACTCATATCCGAGGCCCTGTAATTGGAATG
+HWUSI-EAS1795_0092:3:1:12554:2640#0/1
gffggcggggggggcgegggfaggggggg]egf
@HWUSI-EAS1795_0092:3:1:12905:2638#0/1
ATCAAATGTGGGTGGTGTGCATTCTGGGAAGTG
+HWUSI-EAS1795_0092:3:1:12905:2638#0/1
hhhhhhhhhhhhhhhhgehhhhhhghhhhhhfh
@HWUSI-EAS1795_0092:3:1:13038:2645#0/1
GTTTAATCAGGCGGAGATTTAAACAAAACTAGT
+HWUSI-EAS1795_0092:3:1:13038:2645#0/1
gdgfgggggfgcff]c_cfffffgggggfafgf
@HWUSI-EAS1795_0092:3:1:13139:2640#0/1
TGCCGATGTGCATCGCGCTCATATATTTGGCCA
+HWUSI-EAS1795_0092:3:1:13139:2640#0/1
ggggggggggggggggggggggegggggggggg
@HWUSI-EAS1795_0092:3:1:13761:2642#0/1
ACTTGATGTATCGGCTAAACTGCCTTTTGAAGC
+HWUSI-EAS1795_0092:3:1:13761:2642#0/1
ghhhhhhhhhhhhhhhhhhhhfhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:14345:2639#0/1
GCCGCTGCTCCCGCTCCGCCGGCAGCCGCTCCT
+HWUSI-EAS1795_0092:3:1:14345:2639#0/1
gggfgggggggggcggfaYcacggcdfdfQddd
@HWUSI-EAS1795_0092:3:1:14531:2645#0/1
ATTCACTGTTGAACCTGACGTCAGCCGAGAAAA
+HWUSI-EAS1795_0092:3:1:14531:2645#0/1
gcgggggfggggggfgaggggfgggggfcgggg
@HWUSI-EAS1795_0092:3:1:15019:2640#0/1
ATGAACTTGGAAATCCAATTAGATACAAAGCTA
+HWUSI-EAS1795_0092:3:1:15019:2640#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhfgh
@HWUSI-EAS1795_0092:3:1:15133:2643#0/1
GCCTTGTCGCGCCTTGTCCTCGCTGTAAGCAGC
+HWUSI-EAS1795_0092:3:1:15133:2643#0/1
hhhfhfhhhhhhhfhhhhhhhfhhghhhhhhhg
@HWUSI-EAS1795_0092:3:1:15759:2641#0/1
GTCTGTGCGTGGATGCATCGTGGACGCCAACAT
+HWUSI-EAS1795_0092:3:1:15759:2641#0/1
hhhhhhhhhhhhghhghgfgghhggggfh_hhh
@HWUSI-EAS1795_0092:3:1:16273:2639#0/1
TCGGGGAATACGGGCCACAGCACGTCCGGTACC
+HWUSI-EAS1795_0092:3:1:16273:2639#0/1
hhhhhhhghhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:17965:2641#0/1
GCGTCGCTTCGTTGTGCGTCGCCCTTTGCCCGC
+HWUSI-EAS1795_0092:3:1:17965:2641#0/1
hhhhhhhhhhhhhfhhhhhhfhhhhhffhhghh
@HWUSI-EAS1795_0092:3:1:18528:2641#0/1
GCAGTTTTTACGATTTTTTTGTTGTGTGTTTTT
+HWUSI-EAS1795_0092:3:1:18528:2641#0/1
hhhhhhhhhhhghhhhhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:18900:2636#0/1
GCAAAATGTCGCTCGTCATCCCAGAGAAGTTCC
+HWUSI-EAS1795_0092:3:1:18900:2636#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhchhhhg
@HWUSI-EAS1795_0092:3:1:19568:2634#0/1
CTGATATAGCATTCCCACGAATAAATAATATAA
+HWUSI-EAS1795_0092:3:1:19568:2634#0/1
hhhhhhhhghhhhhhhhhhhhfhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:1352:2653#0/1
CGCGCTGGATCTTCTCGACGTAGACGACGAACT
+HWUSI-EAS1795_0092:3:1:1352:2653#0/1
WQ^H_XILaaa`afcfacd`ddaa\Xc\^Lb`f
@HWUSI-EAS1795_0092:3:1:3183:2650#0/1
GTCCGCTTGGGGTAGTCCTTACTGTGGTGAGTC
+HWUSI-EAS1795_0092:3:1:3183:2650#0/1
gdgcggggggggdffffggggggfggggfgggg
@HWUSI-EAS1795_0092:3:1:3421:2653#0/1
CTCCGCATTCTTGGTCGCCGATCGTGTAGTGGT
+HWUSI-EAS1795_0092:3:1:3421:2653#0/1
\Vaccccdgggggaggggggegcfd]fffdffd
@HWUSI-EAS1795_0092:3:1:3809:2657#0/1
GGATCTGTAGGGGGTGTGGCGTGTACACCGCCA
+HWUSI-EAS1795_0092:3:1:3809:2657#0/1
gggggegggggggeggggggggegggggggggg
@HWUSI-EAS1795_0092:3:1:4457:2646#0/1
GTCTAAAATATATATACAGCGATCAACTGAAGA
+HWUSI-EAS1795_0092:3:1:4457:2646#0/1
hhhhhhhhhghhhgghhhhghhhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:4592:2654#0/1
TTTGCCTGGCCGGTCGAGAACCGAGAGTGGGCT
+HWUSI-EAS1795_0092:3:1:4592:2654#0/1
gge^aggcggfggegggdffdfffefedgegge
@HWUSI-EAS1795_0092:3:1:5251:2651#0/1
GAGCTGGTCATGCGCGCCAGAAATCTTGTTTTT
+HWUSI-EAS1795_0092:3:1:5251:2651#0/1
gggcggggggfcggfgggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:5516:2653#0/1
CCCACAGCACCTCCGAGGGCAAGTAGCTGCTTC
+HWUSI-EAS1795_0092:3:1:5516:2653#0/1
hhhhhhhhhhhghhhhhhhhhhhhghhhhhhhh
@HWUSI-EAS1795_0092:3:1:5760:2648#0/1
TGAGCAGCGCCATCATCAGCCAGAGCCAGACTT
+HWUSI-EAS1795_0092:3:1:5760:2648#0/1
hhhhhhhhffhhfhhhhhhhhhghchhhhhggh
@HWUSI-EAS1795_0092:3:1:5849:2653#0/1
CTCGCATTGATTACGTCCCTGCCCTTTGTACAC
+HWUSI-EAS1795_0092:3:1:5849:2653#0/1
ggggdggggggcfffffggeagdffefgcgggg
@HWUSI-EAS1795_0092:3:1:5935:2647#0/1
GCTGAAGATCATGCCCGTCCAGAAGCAGACCCG
+HWUSI-EAS1795_0092:3:1:5935:2647#0/1
f_ffffdaaadafcf_fgggggggg[g`ffffg
@HWUSI-EAS1795_0092:3:1:5970:2650#0/1
CTTACATCAGCTGGAAAAAGTTCGCGTGGCATT
+HWUSI-EAS1795_0092:3:1:5970:2650#0/1
hhhhhhhhghhhhhhhhhhhghghhhehghghh
@HWUSI-EAS1795_0092:3:1:6417:2652#0/1
CTCTATTTTGTGCTGCCATTCCGGATCGAGTGC
+HWUSI-EAS1795_0092:3:1:6417:2652#0/1
ff_fcffa____e[Yeefaffaff]dcffcafd
@HWUSI-EAS1795_0092:3:1:6470:2649#0/1
GGGCAGGGACGTAATCAATGCGAGTTAATGACT
+HWUSI-EAS1795_0092:3:1:6470:2649#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:6856:2647#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:6856:2647#0/1
ggcfggggggffcgggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:7150:2651#0/1
GGGGAACTTGATGCGGTACTTGGTCAGATGCAG
+HWUSI-EAS1795_0092:3:1:7150:2651#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhgfhh
@HWUSI-EAS1795_0092:3:1:8129:2655#0/1
TGCTGAAGGTGAGCTTCCTATCGAGGGTAATAC
+HWUSI-EAS1795_0092:3:1:8129:2655#0/1
hhhhhhghhhhhhhhhhhhhhh[ffffhhfhhh
@HWUSI-EAS1795_0092:3:1:8710:2647#0/1
TTTTGATGACTATTTAAAGGCACATGGGATCGC
+HWUSI-EAS1795_0092:3:1:8710:2647#0/1
hhhhhhhhhhhhhhhhhhhhhhhfhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8797:2648#0/1
GGGAAAATGCAAATAGTTGTTTGTTTTGTTGTA
+HWUSI-EAS1795_0092:3:1:8797:2648#0/1
hhhhhhhhhhhhhhhhhhfhhhhhhhhhhhghg
@HWUSI-EAS1795_0092:3:1:9108:2657#0/1
AAACAAACCGAAAAATCATTAATTGTAATTTAT
+HWUSI-EAS1795_0092:3:1:9108:2657#0/1
hhghhhhhhhhhhhhhghhhhhghgfhhhhhhh
@HWUSI-EAS1795_0092:3:1:9463:2648#0/1
GCCTCATCGATGTCTGCGCGGACAAGCTGCAGG
+HWUSI-EAS1795_0092:3:1:9463:2648#0/1
hghhhhhhhhhhhhhhhhhfhhaghfhhhehhg
@HWUSI-EAS1795_0092:3:1:9876:2654#0/1
TTTCGGAGTGACCATCGTGCTGTTCGCCTTGGA
+HWUSI-EAS1795_0092:3:1:9876:2654#0/1
hhhhhhfhhhghhhhhhhgggfghhfhhhgghh
@HWUSI-EAS1795_0092:3:1:9904:2655#0/1
CAGGCAAATGCGTCTCCACTAGCTCATTAAGCA
+HWUSI-EAS1795_0092:3:1:9904:2655#0/1
\\\aY\Wb`]]_]]`b^UYHUTcacRcaWUaZa
@HWUSI-EAS1795_0092:3:1:10473:2647#0/1
CCTGTATAACGCCGCGTTGATGTGCAGGAACTT
+HWUSI-EAS1795_0092:3:1:10473:2647#0/1
hhhhhhhhhhhhhghhhhghghfhhhhhghghh
@HWUSI-EAS1795_0092:3:1:10535:2646#0/1
TCGGCCTCCACAACCTGTCCCATACGCTTCTCG
+HWUSI-EAS1795_0092:3:1:10535:2646#0/1
ggggfgggggggggg_ggggggfgggggggcgg
@HWUSI-EAS1795_0092:3:1:10609:2646#0/1
ACGCTCGCGACGATCCTTCTTGAGGACGCGGGG
+HWUSI-EAS1795_0092:3:1:10609:2646#0/1
cffffddcfac[\TYa\bdadRd`d`]YT[Y[Z
@HWUSI-EAS1795_0092:3:1:10910:2654#0/1
GCATTCTGGGAAGTGTTAACTGATCCAGCATTT
+HWUSI-EAS1795_0092:3:1:10910:2654#0/1
hhhhhhhhhhhhhhhhhgfhhghhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:11741:2647#0/1
CCTCGATCTTGCCAATCATAGACTCCTGATGCG
+HWUSI-EAS1795_0092:3:1:11741:2647#0/1
ffccccfafcffdfddf[_^c^f]ffffRc_cb
@HWUSI-EAS1795_0092:3:1:12429:2654#0/1
AAGACAGTGGGTGATAAGTGGACCCATGCCAAG
+HWUSI-EAS1795_0092:3:1:12429:2654#0/1
ffca`dda^aaL]TSWXa^Wa^d^dPO\]UZLa
@HWUSI-EAS1795_0092:3:1:12865:2647#0/1
TGCATAGGGGGCGGAGTATTTCAAGCAATAAAA
+HWUSI-EAS1795_0092:3:1:12865:2647#0/1
hhhhhhhhghhhhhghhhghhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:13015:2646#0/1
CTTGAGTCCGTAAATTGCCTTATTCAATTTACA
+HWUSI-EAS1795_0092:3:1:13015:2646#0/1
fcdcfffffac^caaadffff_fdfdWefddcf
@HWUSI-EAS1795_0092:3:1:13651:2652#0/1
CTGGTCTGGGACGAGCTCCTGTCCTTGTTGCCT
+HWUSI-EAS1795_0092:3:1:13651:2652#0/1
hhhghhghfhhhhhhhghhdghhhhhhhghhhh
@HWUSI-EAS1795_0092:3:1:13674:2650#0/1
TTCCTCCGTGTTGCCGTAATCGATGTAAAACAC
+HWUSI-EAS1795_0092:3:1:13674:2650#0/1
hhhfhhhhhghhhcfhhggehhhhhghhhhghh
@HWUSI-EAS1795_0092:3:1:14469:2647#0/1
ATCAACCAGACGTAATCGCGGGACACACCTGAC
+HWUSI-EAS1795_0092:3:1:14469:2647#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhehhhghh
@HWUSI-EAS1795_0092:3:1:14622:2652#0/1
GCGCCTGCTGCCTTCCTTAGATGTGGTAGCCGT
+HWUSI-EAS1795_0092:3:1:14622:2652#0/1
_fdffa[ffffafaf_fad_ddfcffaafc`]d
@HWUSI-EAS1795_0092:3:1:14797:2650#0/1
CATGAGTACGCAGCGTGGAGCAAGCGGATGCCG
+HWUSI-EAS1795_0092:3:1:14797:2650#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhegfhhhh
@HWUSI-EAS1795_0092:3:1:15828:2654#0/1
GCTCAACATCTCTGAACACAGGGGAGCAGTGGA
+HWUSI-EAS1795_0092:3:1:15828:2654#0/1
dacfafcagcagggggggdfgfgggec]fcfff
@HWUSI-EAS1795_0092:3:1:15922:2650#0/1
GTTTGTGAGTTTCTTAGCATTCCACCTTTTCTT
+HWUSI-EAS1795_0092:3:1:15922:2650#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:16070:2649#0/1
TTTCACGGCTCTATTTCTGATGGCACTCCTACT
+HWUSI-EAS1795_0092:3:1:16070:2649#0/1
ccaccca^^JaBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:16190:2649#0/1
CGGACGATTCCTTAGAACTGGCCGTCGCTACCC
+HWUSI-EAS1795_0092:3:1:16190:2649#0/1
hhhghhhhhhhhhhhhhhhhhhhhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:16789:2653#0/1
CGCCGATGTTGTGTACAACGCCTCCAACAACGA
+HWUSI-EAS1795_0092:3:1:16789:2653#0/1
hhdhhhhhhhhhhhhhfghghhehhhhhhhhge
@HWUSI-EAS1795_0092:3:1:17350:2655#0/1
ATTTGGAGTCACGCTGGACAAGGCGGCCACTCG
+HWUSI-EAS1795_0092:3:1:17350:2655#0/1
hhhhghhhhhhhhgghhhghhhghghghehagc
@HWUSI-EAS1795_0092:3:1:18005:2657#0/1
TGACCGTCGAGAATGCCGAGCGTGTGGCCCGCT
+HWUSI-EAS1795_0092:3:1:18005:2657#0/1
hfhhhhhfchhhhhdhhehfch_hdhhhhgca]
@HWUSI-EAS1795_0092:3:1:18167:2646#0/1
GCGGAGCATTCATTTATCATCGAAACGACATTG
+HWUSI-EAS1795_0092:3:1:18167:2646#0/1
gagggcgggggfgggagggggggeggggcggga
@HWUSI-EAS1795_0092:3:1:18413:2656#0/1
CACTGCTTCTCCCCCTTGGCAGTTTCCACTTCA
+HWUSI-EAS1795_0092:3:1:18413:2656#0/1
gggdaggggdfgc```fdgaggcffffdfcfaf
@HWUSI-EAS1795_0092:3:1:19026:2654#0/1
CACCGGTCTCCTCATCGAAGGCCGGTCTATTAA
+HWUSI-EAS1795_0092:3:1:19026:2654#0/1
hhhhhhhhhhhhhhfhcghdhhhhhahhghhhh
@HWUSI-EAS1795_0092:3:1:19418:2650#0/1
CTCAGTGCTTCATGTCAGACTGCACGGCGGCAT
+HWUSI-EAS1795_0092:3:1:19418:2650#0/1
hhhghhhhhhhhhhghhhhgghhfhhhhhhfhh
@HWUSI-EAS1795_0092:3:1:2560:2665#0/1
TGCGGATCTCCTTGAGGGTCTTGCGGTTGGCGT
+HWUSI-EAS1795_0092:3:1:2560:2665#0/1
ggggggggegggg_ggggggeggggggfegggg
@HWUSI-EAS1795_0092:3:1:2725:2664#0/1
CATGCGGCCGAGACTGCCCAGGCGGAGGCCTGT
+HWUSI-EAS1795_0092:3:1:2725:2664#0/1
ffb]eWdeddb^a[`[ddddW^UTWSXc`c`W`
@HWUSI-EAS1795_0092:3:1:3439:2668#0/1
GGGAGCGGCCTTCTTCTCCGCTGGCTTAGCGGC
+HWUSI-EAS1795_0092:3:1:3439:2668#0/1
hghhhfghhgfhghhdfhhhh[ahdhhehghgh
@HWUSI-EAS1795_0092:3:1:3865:2667#0/1
GTCGGCGGCATGGACATGGTAGCCCAGGGTCTT
+HWUSI-EAS1795_0092:3:1:3865:2667#0/1
ggggggggggdggggggdffffcffefffaffd
@HWUSI-EAS1795_0092:3:1:4094:2668#0/1
GCTTAAGATGATCAACTCACCAAAGGTTTACTC
+HWUSI-EAS1795_0092:3:1:4094:2668#0/1
egcgggfgggggfggagfgggggdggggggfgg
@HWUSI-EAS1795_0092:3:1:4358:2665#0/1
CAACATTTTGTTGATGCGAATGACGTGGAATGG
+HWUSI-EAS1795_0092:3:1:4358:2665#0/1
hhhhfhhhhhhhhhfhghghhghghhhhhhghh
@HWUSI-EAS1795_0092:3:1:4510:2663#0/1
CTCCTCCTCGTCGAACTCCACCTGCTCGTCTTG
+HWUSI-EAS1795_0092:3:1:4510:2663#0/1
hhhhhhhhhhehfhhfhghhhhhghhhegghhe
@HWUSI-EAS1795_0092:3:1:5277:2667#0/1
GCCTTTATTCTTTTGGGAACCCGCATCTTGTCG
+HWUSI-EAS1795_0092:3:1:5277:2667#0/1
hghhfhhhghfhhhghhfhfhcghchhfcffdh
@HWUSI-EAS1795_0092:3:1:6666:2658#0/1
AAACAAGCAGCAACCACAACATCAATGCTACCG
+HWUSI-EAS1795_0092:3:1:6666:2658#0/1
hhhhhhhhfhhghhghheghhhghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:6881:2662#0/1
TGGCTCTGAAGATTGAGATAGTCGGGCTTGATT
+HWUSI-EAS1795_0092:3:1:6881:2662#0/1
hhhhhhhhfhhhhhgghhhfghhhhhdhhhahh
@HWUSI-EAS1795_0092:3:1:6949:2659#0/1
TTAAAGGCAGCACCAGGCAAAGCTGCTTCCAAG
+HWUSI-EAS1795_0092:3:1:6949:2659#0/1
dfcfc\_ceedaaa^^bcccfcdccc^\caccf
@HWUSI-EAS1795_0092:3:1:7310:2664#0/1
TCGTCCTTGAATCCCTTTGACTGCTTGCAGAAT
+HWUSI-EAS1795_0092:3:1:7310:2664#0/1
hhhhhhhhhhhhhhhhhhfhhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:7706:2660#0/1
CCGGGACGTCCAGATACTCCGGGCAGACCGGCA
+HWUSI-EAS1795_0092:3:1:7706:2660#0/1
hhghhhhhhhhhfghhhhhhghhhghhhhhhgh
@HWUSI-EAS1795_0092:3:1:8497:2661#0/1
TGGTTGTTGTCGCGGCCCAGCGATCGATGAGTT
+HWUSI-EAS1795_0092:3:1:8497:2661#0/1
ggggggggggggggggggegfgggggggggggg
@HWUSI-EAS1795_0092:3:1:9662:2660#0/1
CGGCACAAGGACACGGCCAGCGTGTCAGATAAG
+HWUSI-EAS1795_0092:3:1:9662:2660#0/1
hhhhhghhgfhghhhggcfhhhhhdhggdghec
@HWUSI-EAS1795_0092:3:1:9733:2659#0/1
GGCTAAGTTACCAAACAGATCGTGAAGGATTCC
+HWUSI-EAS1795_0092:3:1:9733:2659#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9967:2668#0/1
TGTCGCCCCTGCGTCGCGTCAACCAGGCTATCT
+HWUSI-EAS1795_0092:3:1:9967:2668#0/1
hhhhhhhhhhhhhhhhhhdhhhhghhdhhhghg
@HWUSI-EAS1795_0092:3:1:11982:2667#0/1
GGCAAGGCATATTCGAAATTCGACTTTCTATAT
+HWUSI-EAS1795_0092:3:1:11982:2667#0/1
hhhhhhhhhhhhhhhhhhhhghhfhhhhhghhh
@HWUSI-EAS1795_0092:3:1:12039:2669#0/1
CGGAAACGGAAACCTGCCTGGACACGATGGGCA
+HWUSI-EAS1795_0092:3:1:12039:2669#0/1
fgggggfggggggfgggggggggggggggfffd
@HWUSI-EAS1795_0092:3:1:12097:2668#0/1
GTCAACTTCAAGGATGCCTCCGGTGGCAAGGTC
+HWUSI-EAS1795_0092:3:1:12097:2668#0/1
hhhhhhhhhhhghghhhhghhhhhhhghhhheh
@HWUSI-EAS1795_0092:3:1:14200:2669#0/1
TAGAAGGCTGCTCAATCTGGGCAAGTTGCATGC
+HWUSI-EAS1795_0092:3:1:14200:2669#0/1
gggcgggggggggfggggfgggggggggdggfd
@HWUSI-EAS1795_0092:3:1:14816:2663#0/1
CTTCTCTCACGGCTTCAAATAGGGCCATATACT
+HWUSI-EAS1795_0092:3:1:14816:2663#0/1
gfgfggggcggggggg]f_f_fggggeffgdcg
@HWUSI-EAS1795_0092:3:1:14922:2669#0/1
GGTGGAGCGCACGTTATTATTACACCGCTACCG
+HWUSI-EAS1795_0092:3:1:14922:2669#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15034:2659#0/1
CCGAAACAACGCCGCACCTTCTGCAAGAAGTGC
+HWUSI-EAS1795_0092:3:1:15034:2659#0/1
hhhhhhhhhhahhhhhhghhhfeghhhhfhfgh
@HWUSI-EAS1795_0092:3:1:16935:2661#0/1
CGACGACACCAAGGAGATGTTGAAGCTTCTGGA
+HWUSI-EAS1795_0092:3:1:16935:2661#0/1
hhhhhhhhhhhhdghghghhfcchhhhhghgeh
@HWUSI-EAS1795_0092:3:1:17159:2660#0/1
CTGGGCTAGGGAAACCAAACGTGTTCGGAAACG
+HWUSI-EAS1795_0092:3:1:17159:2660#0/1
gggf_ggggggcggdggggggcfffdfgggc_f
@HWUSI-EAS1795_0092:3:1:17269:2662#0/1
CGGCAATCTTGTTGCGCAGGGGCTTGGTGGGGA
+HWUSI-EAS1795_0092:3:1:17269:2662#0/1
hhhhhhhhhhhhhhhhhghhhhhhghhhhhhh]
@HWUSI-EAS1795_0092:3:1:17293:2665#0/1
TGCTTCTTGCCCTTTTTGGCCGACTTGGCCACC
+HWUSI-EAS1795_0092:3:1:17293:2665#0/1
hhhhhghhhhhhhhhhhfhhhgfhhhghhghhh
@HWUSI-EAS1795_0092:3:1:17436:2659#0/1
CAGCGGATCGCTCCCGCCTTTATTGTGGTCCTC
+HWUSI-EAS1795_0092:3:1:17436:2659#0/1
gagdgggggdgagggfggcggcggegggggggg
@HWUSI-EAS1795_0092:3:1:17794:2666#0/1
GCTGAACCAGGGACAATAAGCAAAGAGAAGGTG
+HWUSI-EAS1795_0092:3:1:17794:2666#0/1
dd\]^aaffaYffccafd^]ddfff[f\ab^`f
@HWUSI-EAS1795_0092:3:1:17956:2661#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17956:2661#0/1
ffdggggggdcgdfdffcfff]f]fffggfgfc
@HWUSI-EAS1795_0092:3:1:18329:2659#0/1
TTCGTTTCCTTTTCGCTTTTGTTGTGCTAATTT
+HWUSI-EAS1795_0092:3:1:18329:2659#0/1
hhhhhhhhhhhhhhhfhhhhahhhhgghhghhh
@HWUSI-EAS1795_0092:3:1:19199:2662#0/1
GACCAGGATAGGCGTTTGCGTGGCGCCCAGAAA
+HWUSI-EAS1795_0092:3:1:19199:2662#0/1
hghhhhhhhhhhhhhhhcheahhhchhhhghhg
@HWUSI-EAS1795_0092:3:1:19238:2666#0/1
CATCTAATTGAATGCTCCGCTATGCTAGCTCCC
+HWUSI-EAS1795_0092:3:1:19238:2666#0/1
d[a_dd_aadddaadWdZZ_V]]XPY^HZOVVa
@HWUSI-EAS1795_0092:3:1:19783:2667#0/1
CAACTGGTGCGAGTTCAAACTGACCGCATTGAG
+HWUSI-EAS1795_0092:3:1:19783:2667#0/1
hghhhhhhghhhhhhhghhhhhghhhhhghhgh
@HWUSI-EAS1795_0092:3:1:1908:2677#0/1
GCGCATCTTGCAGCATAAAAATGAGCTCATCAA
+HWUSI-EAS1795_0092:3:1:1908:2677#0/1
]e\ce\Yec^ddYecddffdcdfffddcecddc
@HWUSI-EAS1795_0092:3:1:2474:2676#0/1
TCGGCTTTTGAGCTGCTAATGGACGACGACGAG
+HWUSI-EAS1795_0092:3:1:2474:2676#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhgfgefd
@HWUSI-EAS1795_0092:3:1:3041:2681#0/1
CGCACCTCAATTGGTTGATCATTCGCAACAACA
+HWUSI-EAS1795_0092:3:1:3041:2681#0/1
ggda_fc_fffffcaff_ffffggdgggggcgg
@HWUSI-EAS1795_0092:3:1:3226:2675#0/1
TCCAAATTCAGATGTGTGCCCACCACACGGAAT
+HWUSI-EAS1795_0092:3:1:3226:2675#0/1
hghgghhhhhghhchhhheghfhghhhghffhg
@HWUSI-EAS1795_0092:3:1:4056:2671#0/1
CAACAGCAGAGGTGGGCTTTCAGAGAACGCGTT
+HWUSI-EAS1795_0092:3:1:4056:2671#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhghhghhhh
@HWUSI-EAS1795_0092:3:1:4448:2672#0/1
GCGTAAAACGGCCGTCAAAAATATCCAAAAATT
+HWUSI-EAS1795_0092:3:1:4448:2672#0/1
gggggggggcggacfffggggffgggfgggcfg
@HWUSI-EAS1795_0092:3:1:4477:2678#0/1
ACGGCATGGGGTATTGCAGTCTTCATCTGAATT
+HWUSI-EAS1795_0092:3:1:4477:2678#0/1
hfhhhhhhhghhdhhghhhcchhhchghhhhhh
@HWUSI-EAS1795_0092:3:1:4658:2678#0/1
TGGCAGAGGACGAGCTGAGGGATGCAGTCTTAC
+HWUSI-EAS1795_0092:3:1:4658:2678#0/1
eggggggggegggfegg_gggcggggggggggg
@HWUSI-EAS1795_0092:3:1:5045:2678#0/1
GCGACAAGATGATCTGCCGCAAGTGCTACGCCC
+HWUSI-EAS1795_0092:3:1:5045:2678#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:5303:2672#0/1
GTATTTGCCCATCAGCTTTGTGACGTGGGGCTT
+HWUSI-EAS1795_0092:3:1:5303:2672#0/1
[cfda\^fba\effefefcffdf]YfcBBBBBB
@HWUSI-EAS1795_0092:3:1:5951:2672#0/1
GGAATCCAAGAGACACGCGCCCCGCGGTACAAC
+HWUSI-EAS1795_0092:3:1:5951:2672#0/1
hghhhhdhhghfgghhchghhghgchhhhaghf
@HWUSI-EAS1795_0092:3:1:6441:2670#0/1
AAGAAATCCGCCTGCGGCTGCTCCAAGTGAGCT
+HWUSI-EAS1795_0092:3:1:6441:2670#0/1
ggggggggfgggggggggggadffdffcfeefg
@HWUSI-EAS1795_0092:3:1:6796:2675#0/1
CTTGCCGAAGTAACCAGGATGGTATTTGTCGAA
+HWUSI-EAS1795_0092:3:1:6796:2675#0/1
ffdcfffdda_fffffff_dff[ddddfffffW
@HWUSI-EAS1795_0092:3:1:6976:2675#0/1
CCGCAGCGTGCGCCGCCTGAACCCCCTGACCAA
+HWUSI-EAS1795_0092:3:1:6976:2675#0/1
a\ffdcdddaea^YUaaSZaaaeceaRaZ^a\^
@HWUSI-EAS1795_0092:3:1:7222:2673#0/1
TCGGCGGATGCGTTGGCGCCCTCCAGCTTGATA
+HWUSI-EAS1795_0092:3:1:7222:2673#0/1
_fd[ac\SaWa^d_dad]]aaXd__^BBBBBBB
@HWUSI-EAS1795_0092:3:1:7837:2677#0/1
CCTTGTACTATTACTTCTTCATCTTATACCCCT
+HWUSI-EAS1795_0092:3:1:7837:2677#0/1
f]ffff]a^aa_ffca__aa^_dfccfdfdfcd
@HWUSI-EAS1795_0092:3:1:7963:2676#0/1
CAGAGGATGAAGGCCAGGAAGGGCGAGATTTCG
+HWUSI-EAS1795_0092:3:1:7963:2676#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8178:2675#0/1
CCTACCTGTATCCACGCTGGCCACGTAGATATC
+HWUSI-EAS1795_0092:3:1:8178:2675#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8310:2677#0/1
CTCCGATTCGCGCTGCAGATCAGCGGTAACCGC
+HWUSI-EAS1795_0092:3:1:8310:2677#0/1
hhhhhhhhhhhghhhhhhhhhghhhfhhhhhhh
@HWUSI-EAS1795_0092:3:1:8619:2673#0/1
CGAGGACTTCAAGAAGTCAAAGGAGAGCGTCTT
+HWUSI-EAS1795_0092:3:1:8619:2673#0/1
hhhhhchhgghhghghhhhhhhghhahhhghhg
@HWUSI-EAS1795_0092:3:1:8764:2670#0/1
GTTCAAATTTTAAGTCTGTTCGACTTTTAAATT
+HWUSI-EAS1795_0092:3:1:8764:2670#0/1
hhhhhhhhhhhhhfhhhfhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9418:2681#0/1
CGACTGGTGGACAAACACGGCTCACTATAATCG
+HWUSI-EAS1795_0092:3:1:9418:2681#0/1
fffffacZ`b^]ZZZWZZ`]]]fcaac]^Z[^b
@HWUSI-EAS1795_0092:3:1:10253:2672#0/1
TGTAGAGCTCTTCTATATTTGCGAGACCCATTA
+HWUSI-EAS1795_0092:3:1:10253:2672#0/1
hhhhhhhhhhhhhhfhhhhhfhhhfhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10340:2676#0/1
GAAGACTTGAAGGTTCCAGAGGGCGAATTGGGT
+HWUSI-EAS1795_0092:3:1:10340:2676#0/1
hhhghhhhhhhhhhhhhhhghhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10933:2676#0/1
CGCACAGCGAAGCGACCCAGAGGGGGGAACTCC
+HWUSI-EAS1795_0092:3:1:10933:2676#0/1
hhhhhhhhhhghhghhghhhchhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11171:2681#0/1
CGTGGTATCACCATCGATATCGCCCTGTGGAAG
+HWUSI-EAS1795_0092:3:1:11171:2681#0/1
ffffd__ddefdgcgfgbabfdggfacgggggf
@HWUSI-EAS1795_0092:3:1:11252:2681#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:11252:2681#0/1
hhhhhhhhghhgfhhhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11584:2673#0/1
TGGGTTTCGGTCTGTTCGACTAAGCTGGATCCC
+HWUSI-EAS1795_0092:3:1:11584:2673#0/1
ccaddd^a^\Zaff_fffZf_ffffYcY\\acf
@HWUSI-EAS1795_0092:3:1:12183:2675#0/1
GGCGGCCTCGTCTGCATTTAGCATTCGTATCCG
+HWUSI-EAS1795_0092:3:1:12183:2675#0/1
gggggggcfcfffgegfggdggggggggggggg
@HWUSI-EAS1795_0092:3:1:12706:2679#0/1
GCGATTTAATTATTGCTATTTAAAGCGGCAGTC
+HWUSI-EAS1795_0092:3:1:12706:2679#0/1
hhhhhhhhghhhhhgdhhhhhhhggfhhhhhhf
@HWUSI-EAS1795_0092:3:1:12750:2675#0/1
CCGTCGGATCCCTCCTTCTTCTTTTGTGTCTTT
+HWUSI-EAS1795_0092:3:1:12750:2675#0/1
hhhhhghdhhhhhhhhhhhhghhhhghhhhhhh
@HWUSI-EAS1795_0092:3:1:12944:2672#0/1
GTTTATTACAAAATCAATCGGTGCATTATTCAC
+HWUSI-EAS1795_0092:3:1:12944:2672#0/1
ggggggggg_ggggggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:13672:2671#0/1
GCCCGGGGCCCTCTGGAAGGCCACATGTCCGCC
+HWUSI-EAS1795_0092:3:1:13672:2671#0/1
hhhhhhhhhhhhhfhhahhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:13701:2679#0/1
GACTCGTACGTGGGTGATGAGGCGCAGAGCAAG
+HWUSI-EAS1795_0092:3:1:13701:2679#0/1
hhhhhhhhhhhhhhehfhfchhhhgghgghhhh
@HWUSI-EAS1795_0092:3:1:13779:2675#0/1
GGAGAACGGAGCACCCAACGGCAAGGACAAGTA
+HWUSI-EAS1795_0092:3:1:13779:2675#0/1
hhhfhhhhhhghghhhhhhghhghgh]chhfhh
@HWUSI-EAS1795_0092:3:1:14182:2673#0/1
CCTTGATGTACTCCTTGATGGTGGTCGCCTCCT
+HWUSI-EAS1795_0092:3:1:14182:2673#0/1
fggfggegggggggggggggg_ffdffgggggg
@HWUSI-EAS1795_0092:3:1:14472:2678#0/1
GCGGTTGCTGCTGGGCAGCCGAGAGCAGTTCCT
+HWUSI-EAS1795_0092:3:1:14472:2678#0/1
Yfff[df^deY]fdffffffadaabfWa``aaU
@HWUSI-EAS1795_0092:3:1:15367:2676#0/1
ACTACAAATTATATTGGTATAAGTTTTACGCAA
+HWUSI-EAS1795_0092:3:1:15367:2676#0/1
\ZIMVYPMMJPQ\]YY]TW__\a]^^]ccXcaB
@HWUSI-EAS1795_0092:3:1:15533:2679#0/1
GATAGTCGCAGAATTGCAGAGCCGGTTCCAGTT
+HWUSI-EAS1795_0092:3:1:15533:2679#0/1
caaccc[ccc[ccccYcBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:15697:2680#0/1
GGGACATCTTTCTGCTCAAATTACCGTGAGTCC
+HWUSI-EAS1795_0092:3:1:15697:2680#0/1
_^Ya`_`ff_acdfdfcdceddffff]_\a[ae
@HWUSI-EAS1795_0092:3:1:16125:2675#0/1
AGCGTCGCGACAACTACGTCCCGGCCGTCTCCG
+HWUSI-EAS1795_0092:3:1:16125:2675#0/1
hhhhhhhhghhhdgghhhfhhhdhchhghahh]
@HWUSI-EAS1795_0092:3:1:17056:2679#0/1
CCTTGCGCTTCTTGTCACCGCCCAGCTCGAAGT
+HWUSI-EAS1795_0092:3:1:17056:2679#0/1
gggegffagggggggagggaggccaffgdgggc
@HWUSI-EAS1795_0092:3:1:18232:2671#0/1
CTCCACTTCAGTCCTCCAAGGTCTCATTCGATT
+HWUSI-EAS1795_0092:3:1:18232:2671#0/1
hhhhhhhhhghhhhghhghhhhhghhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18287:2676#0/1
CGGGTCTTCTCGTCTTTTAAATAAATTTTAGCT
+HWUSI-EAS1795_0092:3:1:18287:2676#0/1
hhhhghghhhghhhhhhhhhhfhhghhhhhhch
@HWUSI-EAS1795_0092:3:1:18789:2681#0/1
TCTAGTTGTTAGTCGGAGTAGATTAAGCCGCCT
+HWUSI-EAS1795_0092:3:1:18789:2681#0/1
hhhhhhhhhhhhhhhhfghghhghhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:19271:2680#0/1
GCGGTGTGTACCGCGAGACAGCAGCCAACCGAA
+HWUSI-EAS1795_0092:3:1:19271:2680#0/1
hhfdfcdcffffchhhhhhhhhgghhgghfghh
@HWUSI-EAS1795_0092:3:1:19376:2676#0/1
CTCCATTCTCAACTCCCTGGTTATTGTCCTTTT
+HWUSI-EAS1795_0092:3:1:19376:2676#0/1
afggggggfgggggggggggfcggggggggggg
@HWUSI-EAS1795_0092:3:1:19689:2679#0/1
CCTGGGCCTCCTTCTCGAACTTCTCGATGGTAC
+HWUSI-EAS1795_0092:3:1:19689:2679#0/1
fcb`f[fdffffggggg_gggdgdgggeaeedf
@HWUSI-EAS1795_0092:3:1:1340:2683#0/1
CTTGATGCGGTACTTGGTCAGATGCAGATTGTT
+HWUSI-EAS1795_0092:3:1:1340:2683#0/1
gfggdggfggggcffccfffffcffffgdcggg
@HWUSI-EAS1795_0092:3:1:1581:2690#0/1
ACGAGGCCTACTACAAACTGATTGACCCCAAAG
+HWUSI-EAS1795_0092:3:1:1581:2690#0/1
fc`ccdR\aa`]ffffacdfdcf^ffffRffff
@HWUSI-EAS1795_0092:3:1:2394:2691#0/1
GCGTACTCTGGCGGGATGATGGCGTATGCAATT
+HWUSI-EAS1795_0092:3:1:2394:2691#0/1
fggg]ggc]ffafdcV_d[dfd[a^c_cfaffB
@HWUSI-EAS1795_0092:3:1:2810:2688#0/1
CGGCACTCCACCTGGTAGTCGAGACGACGCTTC
+HWUSI-EAS1795_0092:3:1:2810:2688#0/1
fdacfdfacedff_ccfcdacdafaffa]R]_f
@HWUSI-EAS1795_0092:3:1:3426:2686#0/1
AGGAGATCGAGGTGCTGACGAACAGCAAGAATC
+HWUSI-EAS1795_0092:3:1:3426:2686#0/1
hhfhhhhhhhghgghhhhhhhhghhhhfghhhf
@HWUSI-EAS1795_0092:3:1:3830:2690#0/1
TCCCTTACATCAATAAGAAAGCAAGTTTATTCA
+HWUSI-EAS1795_0092:3:1:3830:2690#0/1
aggfgggggcgfdgfgagfgfefggggggec`g
@HWUSI-EAS1795_0092:3:1:3932:2689#0/1
TGAAACTTGATTGCCCGTCTTCGAAGCAAAAGC
+HWUSI-EAS1795_0092:3:1:3932:2689#0/1
ggffg_ggggcggfgggggggfggdgedfffcg
@HWUSI-EAS1795_0092:3:1:4015:2684#0/1
AAACGGACCACTAGCGAGCTACAACTCTGCCAC
+HWUSI-EAS1795_0092:3:1:4015:2684#0/1
hghhhhhhghhfhhhhhhhghhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:4236:2682#0/1
GGCCTTCTTGCCACCCTTGGCCTTCTCGGCACG
+HWUSI-EAS1795_0092:3:1:4236:2682#0/1
f_ccdf_fffcf^ffcccff[fffcfcffffaa
@HWUSI-EAS1795_0092:3:1:4328:2682#0/1
GCTGGGGCTAAACTACATCAGTTCTGCTCTAGA
+HWUSI-EAS1795_0092:3:1:4328:2682#0/1
fgfadfacaffdfdfffdf[dfffffcgggggc
@HWUSI-EAS1795_0092:3:1:4428:2686#0/1
GGATACGACCTTAGAGGCGTTCAGGCATAATCC
+HWUSI-EAS1795_0092:3:1:4428:2686#0/1
hhhhhhhhhfhhhhhhhfffghhhhhhhhhghf
@HWUSI-EAS1795_0092:3:1:4725:2691#0/1
GTTGTCCAGCTGCTTTGGCTGCCACTCGCCCTT
+HWUSI-EAS1795_0092:3:1:4725:2691#0/1
gggfgcgggfggegggfgfggaggfgggcgggg
@HWUSI-EAS1795_0092:3:1:4988:2684#0/1
TCGTGACCGCCGGAGTGCGCCAAAAGGAGGGCG
+HWUSI-EAS1795_0092:3:1:4988:2684#0/1
ggfggggfad_ff[fcfaffffggggfdggg`f
@HWUSI-EAS1795_0092:3:1:5503:2682#0/1
AGAGCCGAGATGCGTTCCTTCACCTACCCCGAG
+HWUSI-EAS1795_0092:3:1:5503:2682#0/1
gegfe^g^faafaffff]ffffgcggggfggcf
@HWUSI-EAS1795_0092:3:1:5936:2692#0/1
TCCACATACACGCTGACCTTTACCATTGAGTTC
+HWUSI-EAS1795_0092:3:1:5936:2692#0/1
aacaccaac]cc^_VW_ccccccc^accYc^\\
@HWUSI-EAS1795_0092:3:1:6434:2690#0/1
GTCCTTTCGTACTAAAATATCACAATTTTTTAA
+HWUSI-EAS1795_0092:3:1:6434:2690#0/1
hhhhhhhghhhhhhhhhhhhhhhhdhhhhhhhh
@HWUSI-EAS1795_0092:3:1:6491:2683#0/1
TCTATGCGAAGCTCCACTACTGCGTGTCCTGCG
+HWUSI-EAS1795_0092:3:1:6491:2683#0/1
ggfdffcddacfgegaggggeggggggcf_ffc
@HWUSI-EAS1795_0092:3:1:6672:2687#0/1
TCGGTTTTGCTTTCTGGTTTATGCTCCTAAATA
+HWUSI-EAS1795_0092:3:1:6672:2687#0/1
c^acc^^dY^cda^c\ca[Ka\ac\ccfffcSc
@HWUSI-EAS1795_0092:3:1:7170:2684#0/1
CGCTACACGGCGCACGACATCAGCTTTGAGAAG
+HWUSI-EAS1795_0092:3:1:7170:2684#0/1
hhhhhhhhdhhhfhghdhgfhhhhhhhhhhhgh
@HWUSI-EAS1795_0092:3:1:7503:2683#0/1
TATTGAGTGGTGTTGTTGGCTGCATTATGATGT
+HWUSI-EAS1795_0092:3:1:7503:2683#0/1
cccc_WccccOcac_bccccQca]cc]\aPY\T
@HWUSI-EAS1795_0092:3:1:7855:2686#0/1
GGCTGTCAACTTCAAGGATGCCTCCGGTGGCAA
+HWUSI-EAS1795_0092:3:1:7855:2686#0/1
hdhhhhhhhhhhhhhhggghhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7885:2682#0/1
TTTTGACTGTGCAAAGGTAGCATAATCATTAGT
+HWUSI-EAS1795_0092:3:1:7885:2682#0/1
hhhhhhhhhhhhhhhhhhhhhhghghhhhhhhh
@HWUSI-EAS1795_0092:3:1:8359:2689#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:8359:2689#0/1
hhhhhghhhhhghhhhhghhhhdhhfhghhhgg
@HWUSI-EAS1795_0092:3:1:8467:2691#0/1
CGCAGCGCGACCAGGCCATCAAGGTGGCCAAGG
+HWUSI-EAS1795_0092:3:1:8467:2691#0/1
ggggggggggggggfgecafffggdgfggggga
@HWUSI-EAS1795_0092:3:1:8537:2687#0/1
GGACGATTCCCTTGGCGTGGGAAGCACCTCCGA
+HWUSI-EAS1795_0092:3:1:8537:2687#0/1
hhhhhhhfhhhhhhhhhhhhheghhhhhghhhh
@HWUSI-EAS1795_0092:3:1:8810:2682#0/1
GCCTAGATCCACCAATTGTCTGGGAGTATCTAT
+HWUSI-EAS1795_0092:3:1:8810:2682#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:9086:2685#0/1
GAAGGAAGCCCGGAAGACGGCCAAACGGGAGGC
+HWUSI-EAS1795_0092:3:1:9086:2685#0/1
hhhhhhhhhhhhhhhhhhghhhhhhghgeghhe
@HWUSI-EAS1795_0092:3:1:9284:2681#0/1
CCGTGGTCAACTCCACTGCCCAGAAGGACGAAC
+HWUSI-EAS1795_0092:3:1:9284:2681#0/1
hhhhghhhhhhhhhhhhhhhhhghhhhgghhhh
@HWUSI-EAS1795_0092:3:1:9756:2692#0/1
GTTCTCGCAGGTCTGGATCAGCTTGCGGATGGA
+HWUSI-EAS1795_0092:3:1:9756:2692#0/1
ggggggggfgdgffeggcfggcgggdcffcfff
@HWUSI-EAS1795_0092:3:1:9849:2684#0/1
GGGTGATCCCGTGGAGTTTCTCCTTGCACTGAC
+HWUSI-EAS1795_0092:3:1:9849:2684#0/1
afggffacddfafffaffgfgaggddfaff_fd
@HWUSI-EAS1795_0092:3:1:9885:2689#0/1
CAACTTTCAGGAGGACGTCAGCGATGAGCAATT
+HWUSI-EAS1795_0092:3:1:9885:2689#0/1
hhhhhhhhhhhghhhhhhhhhghghhfhhhhhh
@HWUSI-EAS1795_0092:3:1:10265:2685#0/1
CCACAATGTACCGGTTGGGTTGCTTCCGCGACG
+HWUSI-EAS1795_0092:3:1:10265:2685#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:10674:2684#0/1
CGGCATATTCACCATCATCATGCTGGCCACTCA
+HWUSI-EAS1795_0092:3:1:10674:2684#0/1
[QLVZU]aaddeffdffdffdefefffffdefa
@HWUSI-EAS1795_0092:3:1:11732:2687#0/1
GTTTAATCCGACCATGTTAATTTGTGATCATAT
+HWUSI-EAS1795_0092:3:1:11732:2687#0/1
hhhhhhhhhhhhhhhhhhhhhhhfhhghhhhhg
@HWUSI-EAS1795_0092:3:1:11869:2683#0/1
GTCCACTGTCTCATCCGACGGTGTGCTGACCCT
+HWUSI-EAS1795_0092:3:1:11869:2683#0/1
hhhhhhhfhhhhhhhhhhghhghgdhhhhhhhe
@HWUSI-EAS1795_0092:3:1:12459:2684#0/1
AGGGCTTGCCCTGGAGCGGAGTCACCACCGGGA
+HWUSI-EAS1795_0092:3:1:12459:2684#0/1
hhhhhhhhhhhhghhhfhhghhhhhhhhdhhhh
@HWUSI-EAS1795_0092:3:1:12922:2683#0/1
CGCAGAGCGATTGCCTGGACCAATGGTGGGGCC
+HWUSI-EAS1795_0092:3:1:12922:2683#0/1
gggfggeegggdcaggggegggggggdffccfg
@HWUSI-EAS1795_0092:3:1:13048:2685#0/1
CGGCTACACCCAAAATTATATCTTAATCCAACA
+HWUSI-EAS1795_0092:3:1:13048:2685#0/1
hhhhhhhhhhhhhhhhhhhhhghhhhg^L^a^]
@HWUSI-EAS1795_0092:3:1:13075:2692#0/1
GTGGAATTCCGAACCAACACATCGCCAGCACCA
+HWUSI-EAS1795_0092:3:1:13075:2692#0/1
hhhhhhhhhhhhhhhhfhhhhhhhhhhhghhgg
@HWUSI-EAS1795_0092:3:1:13596:2685#0/1
CTGGGTCTGCTGTGTGTAGTGCTGCTTGCAGAT
+HWUSI-EAS1795_0092:3:1:13596:2685#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:14154:2682#0/1
CGCAATCCCCGCAAGGTTACGTGGACCGTGCTG
+HWUSI-EAS1795_0092:3:1:14154:2682#0/1
NSTTVVVa[a]^_[]c_VVVXKcccac^ccYca
@HWUSI-EAS1795_0092:3:1:14348:2688#0/1
CAAACCCTTTTGCAGGAGTCTAAGGCAGAGATT
+HWUSI-EAS1795_0092:3:1:14348:2688#0/1
gggffggggcgaccfffgggeffffdefffffg
@HWUSI-EAS1795_0092:3:1:14405:2689#0/1
TGGGGTTCAGCGGGGCCTCGGTCAGCAGCACGG
+HWUSI-EAS1795_0092:3:1:14405:2689#0/1
afa^^_a\acaaff``fffffBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14813:2691#0/1
ATGAGCTGGCACAATCATACGTATTTCAGGAAC
+HWUSI-EAS1795_0092:3:1:14813:2691#0/1
hhhhhhfhhhhhhhghhhhhhhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:15246:2685#0/1
GCCGATTTGTCCAGTTTTTTCAATCGCTGCAGT
+HWUSI-EAS1795_0092:3:1:15246:2685#0/1
gggggggfYfffggggggggfgggggggggggg
@HWUSI-EAS1795_0092:3:1:15849:2685#0/1
GAGGGAGCCTGGAAGTGACGCTTGCGGTTCTTC
+HWUSI-EAS1795_0092:3:1:15849:2685#0/1
hhhhhhhhfhhhghhhhhhhchhhghhhfhfhg
@HWUSI-EAS1795_0092:3:1:16960:2685#0/1
CTTCAGCACAGAGCCAAACAACTTGGCCAGCGT
+HWUSI-EAS1795_0092:3:1:16960:2685#0/1
gfggggggggggf_ggggggggfgfggggggf_
@HWUSI-EAS1795_0092:3:1:17155:2691#0/1
CGCGCGAGTGCACCATTCACTTGGCCAAGCGTG
+HWUSI-EAS1795_0092:3:1:17155:2691#0/1
hhhhhhefhhhhhhhhhhfghhgfhghhhhhgh
@HWUSI-EAS1795_0092:3:1:17504:2691#0/1
GCTTAGCGCACAGATCTTGGTCGTATTCCAGGA
+HWUSI-EAS1795_0092:3:1:17504:2691#0/1
cc]]]]JZ__W_a]]ccacc[acZ]cac^[aac
@HWUSI-EAS1795_0092:3:1:17608:2683#0/1
AAGCAAGTGAACTACATCCGCGGCATCCTCATC
+HWUSI-EAS1795_0092:3:1:17608:2683#0/1
hhhhhhhhhhhhhhhhghhhhhfce]ghahggh
@HWUSI-EAS1795_0092:3:1:17832:2687#0/1
ATGAAACTGATTAATTCCGTGAATACTATTCAG
+HWUSI-EAS1795_0092:3:1:17832:2687#0/1
ffgggggggfggggggggggggggggggggggg
@HWUSI-EAS1795_0092:3:1:19196:2688#0/1
TGCCTCGTCATCTAATTAGTGACGCGCATGAAT
+HWUSI-EAS1795_0092:3:1:19196:2688#0/1
hghhhhhhhhghhhhhhhghhhhhhhfhhhhgf
@HWUSI-EAS1795_0092:3:1:19317:2688#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:19317:2688#0/1
ggdgggggggegggggggggcggfggggcggfg
@HWUSI-EAS1795_0092:3:1:1889:2703#0/1
CACCACTCAATAATACCAGCAACAGCAGCAGCG
+HWUSI-EAS1795_0092:3:1:1889:2703#0/1
^cfffdfggggegggaggg^ggdgfdgggfggg
@HWUSI-EAS1795_0092:3:1:2468:2695#0/1
AAACCCACCGCCCACTCGGCCATTCAAGTGGAA
+HWUSI-EAS1795_0092:3:1:2468:2695#0/1
aYcc^ccc_]ac^Ia`S\\a^Scc_cccccccc
@HWUSI-EAS1795_0092:3:1:3062:2701#0/1
CATTGTGGTCTTCAGCAGTCTGCTCCACCTGTA
+HWUSI-EAS1795_0092:3:1:3062:2701#0/1
hhhhhhfhghhhhhghhfhhhdehhhhhhghhh
@HWUSI-EAS1795_0092:3:1:3168:2700#0/1
GGATTCCTATATATGATATGATAAAACGAAGTC
+HWUSI-EAS1795_0092:3:1:3168:2700#0/1
ggggfgaggcgdf[_dfeggeggggggggggga
@HWUSI-EAS1795_0092:3:1:3287:2697#0/1
TGAAAAACAAGTTCAAACTGCAACATCACACGG
+HWUSI-EAS1795_0092:3:1:3287:2697#0/1
hhhhhhhhhghhhhhfhhhhhhhhhhghhhghh
@HWUSI-EAS1795_0092:3:1:3309:2697#0/1
GCCGATTCCGAGCCCGTCGAGGAGACCGAGGAG
+HWUSI-EAS1795_0092:3:1:3309:2697#0/1
hhhhhfhhhhhhhhhhhhhghfgfhhgfdffdf
@HWUSI-EAS1795_0092:3:1:3342:2698#0/1
GTGCCGCAGAAGGTGTGGGTGACAATACCCTCT
+HWUSI-EAS1795_0092:3:1:3342:2698#0/1
ffhhhhhhghggfefhhhhfhhhhhghhhfhhh
@HWUSI-EAS1795_0092:3:1:3526:2702#0/1
GCGAAACTTGCTTCTGAATTTCATCATCCCTGA
+HWUSI-EAS1795_0092:3:1:3526:2702#0/1
hhhhhhhhhhhhhehhfghhhhhhgghhhhghh
@HWUSI-EAS1795_0092:3:1:4191:2699#0/1
GTCATTTACACTAAGCACCACGATGGCCTCGTC
+HWUSI-EAS1795_0092:3:1:4191:2699#0/1
gfgggggggggggfgfggggggdcdf_fffffd
@HWUSI-EAS1795_0092:3:1:4267:2700#0/1
TGAAGATCTGGCTACGGCGATCCTGAAGCGCAA
+HWUSI-EAS1795_0092:3:1:4267:2700#0/1
hhhhhhhhhghhhhghhfhghhhhhgghhhhhf
@HWUSI-EAS1795_0092:3:1:6097:2701#0/1
CCAATTCGCAAGTCACACGCTTTAAAAACCGTC
+HWUSI-EAS1795_0092:3:1:6097:2701#0/1
gggfgggfcf_fbeceefffffgggfggggggc
@HWUSI-EAS1795_0092:3:1:6223:2696#0/1
AGAACATCTGCCTGCCGGCAGTGTTCAAGGCGC
+HWUSI-EAS1795_0092:3:1:6223:2696#0/1
ggggggfgggggfggggffcfdfafffgggggg
@HWUSI-EAS1795_0092:3:1:7263:2698#0/1
CCACCGTATACCGCCGGTCCCACGGTGTCCATG
+HWUSI-EAS1795_0092:3:1:7263:2698#0/1
ggdgegggagggdgggggggggfffdfgggffg
@HWUSI-EAS1795_0092:3:1:7328:2698#0/1
TGTCGAGAAGTTTTCTAGAGGATTTAGTCGAAC
+HWUSI-EAS1795_0092:3:1:7328:2698#0/1
hhhhhhhghhhhhhhhfghhhfghgghhhhhhh
@HWUSI-EAS1795_0092:3:1:7364:2697#0/1
GTCCGGTCTTTGGATCCGCCACACCGGATACCA
+HWUSI-EAS1795_0092:3:1:7364:2697#0/1
hhhhhhhghhhhhhdhhghhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7531:2701#0/1
GTTGCAGCTTCTTAATTTCCATTTTAGCATCGG
+HWUSI-EAS1795_0092:3:1:7531:2701#0/1
hhhhhhhhhhhhhhhhhhhhdhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8560:2698#0/1
CTCGCCCCAAAAGCTTTTATCTAGCTTTGCACC
+HWUSI-EAS1795_0092:3:1:8560:2698#0/1
hhhhhdhghhgffghghhhhhhhheghfhghhh
@HWUSI-EAS1795_0092:3:1:10019:2694#0/1
CGAGCCGGACGAGGATGCGGCCGCCATCGAGGA
+HWUSI-EAS1795_0092:3:1:10019:2694#0/1
hhhhhhhhhhhghhhhhghghhahhhehgdhgh
@HWUSI-EAS1795_0092:3:1:11088:2695#0/1
CAGCGGGATAGGTGGGGTCGGTGCGGACCTTTC
+HWUSI-EAS1795_0092:3:1:11088:2695#0/1
gggggcgccfffdgggggggaegggggggggdg
@HWUSI-EAS1795_0092:3:1:11691:2697#0/1
CTCTGGCTGACGTTTGTGTTGTTACCTCCTCCC
+HWUSI-EAS1795_0092:3:1:11691:2697#0/1
hhhhhhhhhhhhhhhghhhhehhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:11752:2701#0/1
ACAAGAAGCCAGAGCAGAAGAAGACTGCTGCGG
+HWUSI-EAS1795_0092:3:1:11752:2701#0/1
fcfgfgggggfcdgdgccfgge^ffafgg_gff
@HWUSI-EAS1795_0092:3:1:12649:2702#0/1
TCTTGACCTTGCACAACTTGTACTTGGCCTCCT
+HWUSI-EAS1795_0092:3:1:12649:2702#0/1
hhhhhhhhhgchhhhhhhhchhfhghfhghhhg
@HWUSI-EAS1795_0092:3:1:14881:2703#0/1
AGGCGCCTTGGGGCAAGTCTCCGGCTTACACTC
+HWUSI-EAS1795_0092:3:1:14881:2703#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:15408:2694#0/1
TCCACATCCAGGCACCAGACCGCACCCTGGTGA
+HWUSI-EAS1795_0092:3:1:15408:2694#0/1
hhhhhhhhhhhhhhhhhfhhhhhhhgghhghhh
@HWUSI-EAS1795_0092:3:1:15536:2700#0/1
GCCAATGTCAAATTTTCTTCAGATAATGTCTCT
+HWUSI-EAS1795_0092:3:1:15536:2700#0/1
hhehhghhhhgghhhhhhhghhfhhhghhghhh
@HWUSI-EAS1795_0092:3:1:16235:2696#0/1
TGCAAATTGTGGGTGGTAAATGTGAGACGGTGC
+HWUSI-EAS1795_0092:3:1:16235:2696#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhfhghghhh
@HWUSI-EAS1795_0092:3:1:16280:2700#0/1
GCTGGTTGCAGTCCGGAGTGGATCCGTTTCCGA
+HWUSI-EAS1795_0092:3:1:16280:2700#0/1
ggggggggggggggggeffffdgggggggggg]
@HWUSI-EAS1795_0092:3:1:16420:2693#0/1
TGGAAGCCTTGCAGGCAGTCGCAGGATTCGGCC
+HWUSI-EAS1795_0092:3:1:16420:2693#0/1
hhhhhhhhhhhhhhhhhhhgggaffffhgfhhh
@HWUSI-EAS1795_0092:3:1:16898:2701#0/1
AGCTGAACAAGTTCAAGGAGGAGCACAATATCA
+HWUSI-EAS1795_0092:3:1:16898:2701#0/1
ggggfagggggegggggdfff_gfgggcgdfag
@HWUSI-EAS1795_0092:3:1:17780:2703#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:17780:2703#0/1
gggdccgabaab[fcffgfgggg]gggggdf[X
@HWUSI-EAS1795_0092:3:1:18439:2700#0/1
GCGACGACGAGGGGTTCGCTGAGCCCAGCAATG
+HWUSI-EAS1795_0092:3:1:18439:2700#0/1
f]fdfddRd^c^FWTXZ^aVaZ`dW[[^a^^^f
@HWUSI-EAS1795_0092:3:1:19214:2704#0/1
CTTGGTCTTGATGATCTTGCGTATGTGCTTACG
+HWUSI-EAS1795_0092:3:1:19214:2704#0/1
hhhghhhghghchhhhhhhchghhchhghhfgh
@HWUSI-EAS1795_0092:3:1:1520:2711#0/1
TTCAGGTAGGAGTTGACGGGGTGCTTCTTGCCC
+HWUSI-EAS1795_0092:3:1:1520:2711#0/1
gffcfffead[effcffffffffcdffcafffg
@HWUSI-EAS1795_0092:3:1:1669:2713#0/1
CGATTTCATTTCATGTTGCAAGAGTGTGGAGGA
+HWUSI-EAS1795_0092:3:1:1669:2713#0/1
WHSc]^cfcfffafWafafffaa`c`f``a^dg
@HWUSI-EAS1795_0092:3:1:1796:2710#0/1
GTCAAATCGGGTATGTCACCCTTGTCTATGCCC
+HWUSI-EAS1795_0092:3:1:1796:2710#0/1
fhf_ffffdfffghhhffghhfhhhhhhffhhg
@HWUSI-EAS1795_0092:3:1:2772:2712#0/1
AAAAGTTCGAGCCGCAGAATTATCTGTCATCTG
+HWUSI-EAS1795_0092:3:1:2772:2712#0/1
fac_f_fgggggggggeggfgfcfgggggcggg
@HWUSI-EAS1795_0092:3:1:3623:2710#0/1
GGTAGATGTTAACAATCTCCTGCAACAGGGCGC
+HWUSI-EAS1795_0092:3:1:3623:2710#0/1
adaddcd_aaaa\abYbffc_ffffccfdfaff
@HWUSI-EAS1795_0092:3:1:3655:2705#0/1
CCGCGGTTTGACGGACCCAATGGCGAGTTGCAT
+HWUSI-EAS1795_0092:3:1:3655:2705#0/1
ggggggggcfacffgegggg]ggcgefggg_gd
@HWUSI-EAS1795_0092:3:1:4016:2709#0/1
CTTGGGATTAAAGTATATATGTATATGTGACCT
+HWUSI-EAS1795_0092:3:1:4016:2709#0/1
hhhhhhhhhhhhhhhhhhhhghghhhhhhhghh
@HWUSI-EAS1795_0092:3:1:5605:2711#0/1
GTTTATATATACATTTTTCCTGTATGTAAATTT
+HWUSI-EAS1795_0092:3:1:5605:2711#0/1
hhhhfgghhfhhhghhhhhhhhhhhdhhghhhh
@HWUSI-EAS1795_0092:3:1:5758:2706#0/1
TTGCCATCGGGGCGGGGGCGGCGAATGAACTTG
+HWUSI-EAS1795_0092:3:1:5758:2706#0/1
c^fffff^fffffdccO_____caaWcBBBBBB
@HWUSI-EAS1795_0092:3:1:5942:2716#0/1
GGAGCGCATGTAGTGGATGGTGGCCTGGTTGTG
+HWUSI-EAS1795_0092:3:1:5942:2716#0/1
hghhhdgghghhhhhhcffd`ffffffhfhfcf
@HWUSI-EAS1795_0092:3:1:6148:2709#0/1
TCCGGACAACATCACCACGATATCGCCCACCCA
+HWUSI-EAS1795_0092:3:1:6148:2709#0/1
cd_fffdfacff^Z^^b`daWeSWXZWbdb`BB
@HWUSI-EAS1795_0092:3:1:9366:2715#0/1
GCGAGGTGGGAGCAGTGAGGAAGCCACCATAGC
+HWUSI-EAS1795_0092:3:1:9366:2715#0/1
ggf_gcggggegggggggfggdggggggceggf
@HWUSI-EAS1795_0092:3:1:10390:2710#0/1
GCGTGCTTGAAGATATCAGCCAGTCGCTGCTGC
+HWUSI-EAS1795_0092:3:1:10390:2710#0/1
hhhghhhhhhhhhghhhhhhhhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:10588:2710#0/1
CTCTGGCTACCCCCTCCACGGATGACGAGATCA
+HWUSI-EAS1795_0092:3:1:10588:2710#0/1
ggggggggggggggfggggfggggeggfcfefg
@HWUSI-EAS1795_0092:3:1:10992:2707#0/1
GTGGAGAGGAGCGGGAAACTTTTTGTAACTGCG
+HWUSI-EAS1795_0092:3:1:10992:2707#0/1
b\``]]Vddeaaaaadabbeedffaccfddfff
@HWUSI-EAS1795_0092:3:1:11115:2715#0/1
CGGAAAAGTTCAATGTTCTGCAGCAGCAGTTTG
+HWUSI-EAS1795_0092:3:1:11115:2715#0/1
ffggggggagggggcffgdggggcaggdgffgg
@HWUSI-EAS1795_0092:3:1:12493:2705#0/1
CGAACCCATTGGGGAACGGATCTGTTCTGCTTC
+HWUSI-EAS1795_0092:3:1:12493:2705#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhfhghhh
@HWUSI-EAS1795_0092:3:1:12663:2715#0/1
CTGTGCTCCAGAAGCGCCTGAAGGTCCCACCAC
+HWUSI-EAS1795_0092:3:1:12663:2715#0/1
hgfhhhhhhhhhhfhhfhghfhghhghgfhhhh
@HWUSI-EAS1795_0092:3:1:12795:2705#0/1
AGACGATCAAAATACCACGCAGCGTCAAATTTA
+HWUSI-EAS1795_0092:3:1:12795:2705#0/1
aff\_ffcfacfS^[Ya\_Y__X]WZ]cc^aBB
@HWUSI-EAS1795_0092:3:1:13314:2710#0/1
CCTACACAAGCTACGGTGGATGAGGATAGTTCT
+HWUSI-EAS1795_0092:3:1:13314:2710#0/1
ggggfcggegfgggggeffa[ffdccafafdf`
@HWUSI-EAS1795_0092:3:1:13530:2711#0/1
AGCTATTTCGATCAGAACAACATCGATCTTCCG
+HWUSI-EAS1795_0092:3:1:13530:2711#0/1
hhhhfhhhhhhhhhehhhhhghghhghhhhhhh
@HWUSI-EAS1795_0092:3:1:13636:2707#0/1
TGGCAGTGCGCTACGAGCTGGCTATTGGCCTGA
+HWUSI-EAS1795_0092:3:1:13636:2707#0/1
hhhhhhhhfhhhhhhhhhhhhhhhhghhhhhhf
@HWUSI-EAS1795_0092:3:1:15226:2716#0/1
CAACCCAGCCGCCGTTGCCTTCGTGCCCATTTC
+HWUSI-EAS1795_0092:3:1:15226:2716#0/1
ggfggdgggggeggegWffcfcfddfffWdffg
@HWUSI-EAS1795_0092:3:1:15244:2714#0/1
TTGAGAAGATGTTGAAATCCCTGCACAAACTGG
+HWUSI-EAS1795_0092:3:1:15244:2714#0/1
hhghhhhhhhhhhhghhhhhfghhhhhhfghhc
@HWUSI-EAS1795_0092:3:1:15802:2707#0/1
CCAAGGTGAACGTGCTCATCCGGCCCGATGGCC
+HWUSI-EAS1795_0092:3:1:15802:2707#0/1
hhhhhhhhhhhhhhhhhhhhhhghhhhhfhghh
@HWUSI-EAS1795_0092:3:1:15913:2707#0/1
CGCAGAGATCCGGTGCCAAGTCTATCAGATCAA
+HWUSI-EAS1795_0092:3:1:15913:2707#0/1
afcfcfcd^daec^ddaa[a`adffffd]cffe
@HWUSI-EAS1795_0092:3:1:16016:2709#0/1
CACAGCACTTCGACATGTCCACCAAAGCCGAGC
+HWUSI-EAS1795_0092:3:1:16016:2709#0/1
ggggggggggggggggfgggfggfgdagcgfgg
@HWUSI-EAS1795_0092:3:1:16853:2714#0/1
CTCAATATCCTTGATCTTGTTCTTCTCCTCCAG
+HWUSI-EAS1795_0092:3:1:16853:2714#0/1
hhhhhhfhghhhghhhhhghheghhhhghhhhh
@HWUSI-EAS1795_0092:3:1:16973:2707#0/1
CACCGACCTATCAGGGGAAATACAAGCGCTGGC
+HWUSI-EAS1795_0092:3:1:16973:2707#0/1
hhfhhdhehhhhhhhhehhhghfhhhcghhhhh
@HWUSI-EAS1795_0092:3:1:19090:2707#0/1
CACACACGGCATTTTTAACTCCAATCCGCAGCA
+HWUSI-EAS1795_0092:3:1:19090:2707#0/1
gggagfcgggfgaffcccfdffgdggfgcgggf
@HWUSI-EAS1795_0092:3:1:2074:2722#0/1
TGCCAAAGTAGATGCCGTGCGCGGTGGAGAATT
+HWUSI-EAS1795_0092:3:1:2074:2722#0/1
hhfhhhdhhhchhhhhfhhfhhcb`fdffcdfc
@HWUSI-EAS1795_0092:3:1:2451:2721#0/1
AACATTTCTTCAGGCACCAGCCGCATCCACCTA
+HWUSI-EAS1795_0092:3:1:2451:2721#0/1
gggafgg[fcfcaffffeaWdeV_WS]fffffg
@HWUSI-EAS1795_0092:3:1:2641:2726#0/1
GCTCACCTTTGCTACCATCGGATCCATCCCGAC
+HWUSI-EAS1795_0092:3:1:2641:2726#0/1
fffc[dfgggaafdffdffffc[faff]cdbRd
@HWUSI-EAS1795_0092:3:1:3853:2722#0/1
ATGGCATAGATGCGGGACTCCATTTGAAAATCG
+HWUSI-EAS1795_0092:3:1:3853:2722#0/1
hhhhghhhghghhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:4954:2723#0/1
CCTTCATCGAGTGCAACGGCGCCAAGGGCACGT
+HWUSI-EAS1795_0092:3:1:4954:2723#0/1
ggcggggggge_ffdffffdffffegcgfa^dg
@HWUSI-EAS1795_0092:3:1:5013:2720#0/1
TTGGTGGCACGTGTGTAGATGACCTGGGAATGA
+HWUSI-EAS1795_0092:3:1:5013:2720#0/1
hhhhhhhhhhhhhhghfhfgghhghhhhhdhhg
@HWUSI-EAS1795_0092:3:1:5256:2725#0/1
GTTTCTGCTACTCGAAGAGATAAGAAGAAATAA
+HWUSI-EAS1795_0092:3:1:5256:2725#0/1
hhhhhhhhhhhhghhggfhfghghhghghffhg
@HWUSI-EAS1795_0092:3:1:5529:2721#0/1
AGCGCCCCTCCAAGGCAAACTTCAGCGAGCACA
+HWUSI-EAS1795_0092:3:1:5529:2721#0/1
hhhffhhghhfhhgfhhhgghgfhffhhgghhh
@HWUSI-EAS1795_0092:3:1:6257:2723#0/1
CAACTAACGAAGTTGTTAGCGAATTGGACGAGA
+HWUSI-EAS1795_0092:3:1:6257:2723#0/1
gggggggfggcgggeggggdggafggeggggf[
@HWUSI-EAS1795_0092:3:1:6313:2719#0/1
TGATCGCCAAGTTTACGGATAAGGGTATTTATG
+HWUSI-EAS1795_0092:3:1:6313:2719#0/1
hhhhhhhhhhhhhhhhhhhhhhhhgghhhhhhh
@HWUSI-EAS1795_0092:3:1:6821:2723#0/1
CTGGAATGAATGGTTGGACGAAATATTAACTGT
+HWUSI-EAS1795_0092:3:1:6821:2723#0/1
hhhhhhhhghhhfhhhhfhhhhhhfhhhhgghh
@HWUSI-EAS1795_0092:3:1:6862:2728#0/1
TGTCGCGATCTACGAGTACCTCTTCAAGGAGGG
+HWUSI-EAS1795_0092:3:1:6862:2728#0/1
hghhhhhghhhhghhgchhhfhhhhhhhhchhh
@HWUSI-EAS1795_0092:3:1:6903:2723#0/1
GCCTGACGCAGCTTCCGCTCGATCACGAAGTTA
+HWUSI-EAS1795_0092:3:1:6903:2723#0/1
af^^ffadfdcf[bfdcYa]ddc_cf]_`eaef
@HWUSI-EAS1795_0092:3:1:7001:2718#0/1
GTGCCCGCCATGTCTGGGCGGTAAATTGCGTCC
+HWUSI-EAS1795_0092:3:1:7001:2718#0/1
hhhhhhhhghhfhgfhhhchgghhhhhhfgghh
@HWUSI-EAS1795_0092:3:1:7337:2718#0/1
CAATCGCTTGCTTTGTGGCCATCCTCATTGGAC
+HWUSI-EAS1795_0092:3:1:7337:2718#0/1
hhdhhhhhhhhhhhfhfhhhhfhhhhhhhfhgg
@HWUSI-EAS1795_0092:3:1:9231:2719#0/1
AACGACTATGTCGAGACCGCCACCCGTCATGTG
+HWUSI-EAS1795_0092:3:1:9231:2719#0/1
hhhhhhhhhhhhhcghhhhhhghhhehhcc]gh
@HWUSI-EAS1795_0092:3:1:9349:2720#0/1
CTCGCTTCCGACCCCTCCTTCATCGCCGGCATG
+HWUSI-EAS1795_0092:3:1:9349:2720#0/1
hhhhhhhhhhhhhhhfhhggfgdhghhgdhhhh
@HWUSI-EAS1795_0092:3:1:9557:2723#0/1
GCCAGCGAGGTGCCAAAGGTGTATGTCTCGGCC
+HWUSI-EAS1795_0092:3:1:9557:2723#0/1
hhhhhghhgfhhhhhghhh_hhhhhhhghhhhh
@HWUSI-EAS1795_0092:3:1:9597:2724#0/1
AGAAGGCCGATGTCGATCTTACCAAGCGCGCCG
+HWUSI-EAS1795_0092:3:1:9597:2724#0/1
gfgggfgggdgegdgggfgggggfgggggfggg
@HWUSI-EAS1795_0092:3:1:9994:2719#0/1
GATGCACGCGCGGTAATAACTTCGGGGGCCGGG
+HWUSI-EAS1795_0092:3:1:9994:2719#0/1
hhhhhhhehhhhhehhhfhhfhhgcfghhfhhh
@HWUSI-EAS1795_0092:3:1:11693:2719#0/1
CGAAATATTAACTGTTTCATTTAAAATTTTTAT
+HWUSI-EAS1795_0092:3:1:11693:2719#0/1
hhggghhhhhhhhghhhhhhhhhhgfhhhhhhh
@HWUSI-EAS1795_0092:3:1:11718:2722#0/1
AGAAGAAGGTCGCCGCCAAGAAGCCAGCGGCCA
+HWUSI-EAS1795_0092:3:1:11718:2722#0/1
hhhhhhhhggfhhhehghhdghfhhhhghfghg
@HWUSI-EAS1795_0092:3:1:12302:2721#0/1
AAGCTGCCTCGCCGAAAGAATTTCAAGGCATCG
+HWUSI-EAS1795_0092:3:1:12302:2721#0/1
hhhhgfhhfhhghghggddfffhhhghghhfhh
@HWUSI-EAS1795_0092:3:1:12572:2726#0/1
GGGCCATCCTGAGGTATCTCATTTCGGTCATCC
+HWUSI-EAS1795_0092:3:1:12572:2726#0/1
fghhghhhhhhhheghhhhhhhhhhhghhhhhh
@HWUSI-EAS1795_0092:3:1:12623:2724#0/1
GTTGCATTTTTGGTGCAGTTCCGGGGCTCGCAC
+HWUSI-EAS1795_0092:3:1:12623:2724#0/1
fcfaddfgc_ggggcgaffcf]ffffcaffafa
@HWUSI-EAS1795_0092:3:1:13035:2717#0/1
CCGCAAGGTAGGATGGACGAAGGCGTACCGCAA
+HWUSI-EAS1795_0092:3:1:13035:2717#0/1
ggggaggfdfffcffcfgggdagafggfffffg
@HWUSI-EAS1795_0092:3:1:13230:2727#0/1
CTGGGGCGGTCCCATGGAGGACTTGACGTGCAG
+HWUSI-EAS1795_0092:3:1:13230:2727#0/1
gggggggggggggfgggdffdfggegdgggg[g
@HWUSI-EAS1795_0092:3:1:13733:2726#0/1
CGGCCGCTTCACGCCCGGTGCCTTCACCAACCA
+HWUSI-EAS1795_0092:3:1:13733:2726#0/1
hhhhhhhhhhhhhhhhhhghhhhhhhhhhghhh
@HWUSI-EAS1795_0092:3:1:14272:2718#0/1
CGCGGGAGCCACCTTCTTGGTCACTGGCTTCTT
+HWUSI-EAS1795_0092:3:1:14272:2718#0/1
gfggggggedgggggfddfcdffgggfgggafg
@HWUSI-EAS1795_0092:3:1:14405:2728#0/1
TCCACCTTCTTGTCGCCGCCCTTGGACTCCGTG
+HWUSI-EAS1795_0092:3:1:14405:2728#0/1
fgggggcggggcgggggafff]f[fffffffaf
@HWUSI-EAS1795_0092:3:1:14429:2721#0/1
TCGGGTACTATGGCCTGAGTTATAACATTAATG
+HWUSI-EAS1795_0092:3:1:14429:2721#0/1
hhhhhghhhhhhhhhehghhhhghhhhhhhhgg
@HWUSI-EAS1795_0092:3:1:14585:2718#0/1
CTGCTCGTCTGCCTCCGATTCACTGCCGCTCTC
+HWUSI-EAS1795_0092:3:1:14585:2718#0/1
^\Z\Z_Za^acWZ_\_Zfcf]dTSaBBBBBBBB
@HWUSI-EAS1795_0092:3:1:14613:2722#0/1
GGAATTTTCCGACCTGGAACCAGCTTTATGGGC
+HWUSI-EAS1795_0092:3:1:14613:2722#0/1
hhhhhhhhhhhhhhhhhhhhghhhhhhhhghhe
@HWUSI-EAS1795_0092:3:1:14905:2716#0/1
TATTGAGTGGTGTTGTTGGCTGCATTATGATGT
+HWUSI-EAS1795_0092:3:1:14905:2716#0/1
hehhhhhhhhhhhhhhhhhhhhhhhhghg_fhh
@HWUSI-EAS1795_0092:3:1:14942:2725#0/1
TTACGACGCGAGAGGTGAAATTCTTGGACCGTC
+HWUSI-EAS1795_0092:3:1:14942:2725#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhghhfhhd
@HWUSI-EAS1795_0092:3:1:15120:2719#0/1
GCGGCGGCAGCCAAGACCTCCCCATGCGTCCGG
+HWUSI-EAS1795_0092:3:1:15120:2719#0/1
fcfdfddcc]cd``Z]^VSSXYUQWWUfacc]U
@HWUSI-EAS1795_0092:3:1:16252:2725#0/1
GTTTTATTGTTGATTATTTTTGATATGTTTATG
+HWUSI-EAS1795_0092:3:1:16252:2725#0/1
hhhhhhhhhhhhhhhhhhhhhfhhhhghhhghe
@HWUSI-EAS1795_0092:3:1:16835:2720#0/1
CGGCCGTATCGGCAAGCACCGCAAGCATCCCGG
+HWUSI-EAS1795_0092:3:1:16835:2720#0/1
ggcggggeagggaff_fcffcfW`ffc_dfffg
@HWUSI-EAS1795_0092:3:1:17191:2724#0/1
GATCGGAACTGGATTTTGATCCTCGTCCCTTAA
+HWUSI-EAS1795_0092:3:1:17191:2724#0/1
hhhhhhhhhhghhhhhhfghhhhhghhhhhhhf
@HWUSI-EAS1795_0092:3:1:17241:2724#0/1
CTTGTTTATGACATGAGGGGTTGTTTGCTATGC
+HWUSI-EAS1795_0092:3:1:17241:2724#0/1
hhhfhhhghghhhhfchhghhhhhghhchahfh
@HWUSI-EAS1795_0092:3:1:17324:2717#0/1
CGCCTGTACACTGTCGTACCCCGGCTGACAAAG
+HWUSI-EAS1795_0092:3:1:17324:2717#0/1
hhhhhhhhfhhhhhhhhhhhhhfhhhhhfhhhh
@HWUSI-EAS1795_0092:3:1:17936:2722#0/1
TGTTGCCCTACGACCCCAAGAACAAGATCGGCC
+HWUSI-EAS1795_0092:3:1:17936:2722#0/1
hhhhhhhhhhhhhhhhhghfghhhhfeghhghf
@HWUSI-EAS1795_0092:3:1:18135:2719#0/1
GCCAAACACACGGGCACCAGTTGTAGTACGAGC
+HWUSI-EAS1795_0092:3:1:18135:2719#0/1
hghhhgchhhhghhhhhhaghhhhhhehhhgfh
@HWUSI-EAS1795_0092:3:1:18359:2719#0/1
GCACACGCCACGCCACAGGGCGTAAAGCTATTA
+HWUSI-EAS1795_0092:3:1:18359:2719#0/1
ghhhhhhfhhhfhhfghghhghhfhhehhhhhf
@HWUSI-EAS1795_0092:3:1:18528:2725#0/1
GCTGGATCAGCAGTGTGTGGGCGCTTTGATTGG
+HWUSI-EAS1795_0092:3:1:18528:2725#0/1
hhhhhhhhhhhfhhhhfhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:18614:2718#0/1
AATTATTCCAAGCCCGTTCCCTTGGCTGTGGTT
+HWUSI-EAS1795_0092:3:1:18614:2718#0/1
ddfafffgege_fdc]ffffffaffcf_c[cf`
@HWUSI-EAS1795_0092:3:1:18668:2717#0/1
GGGATTGTGAACTGAAACTGTTCACATGAACTT
+HWUSI-EAS1795_0092:3:1:18668:2717#0/1
gdggggdggggggggdefffffgggfgggcggg
@HWUSI-EAS1795_0092:3:1:18692:2717#0/1
GGAGATCGGAAGAGCGGTTCAGCAGGAATGCCG
+HWUSI-EAS1795_0092:3:1:18692:2717#0/1
hfhhhhhhdhhfffffffff[f^aeedhghhhh
@HWUSI-EAS1795_0092:3:1:19380:2719#0/1
CCTATCTTGGCCTACCGCAAGGGTCACGGCTTG
+HWUSI-EAS1795_0092:3:1:19380:2719#0/1
hhhhhhhhhhhhhhhhhhhhhhhfhhhhfhdec
@HWUSI-EAS1795_0092:3:1:1449:2729#0/1
GTTGTACTTGTTCTTGTCCTGAAATGTTAGGCG
+HWUSI-EAS1795_0092:3:1:1449:2729#0/1
dfffdfffcdffgggfgegggggagfgg^gggf
@HWUSI-EAS1795_0092:3:1:1507:2735#0/1
GGCCAATTGTCCCACGGGCAATTGCGTTGGAGT
+HWUSI-EAS1795_0092:3:1:1507:2735#0/1
ccfcfffgafgegdgdgfgggW[^ceffffRfc
@HWUSI-EAS1795_0092:3:1:2102:2735#0/1
TCGGCACTTCCTTGTACAGCTTCTCGTAGGTGG
+HWUSI-EAS1795_0092:3:1:2102:2735#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWUSI-EAS1795_0092:3:1:2811:2730#0/1
TCCACCTTCTCCTCCAAATGCCGCTTGGGGTCC
+HWUSI-EAS1795_0092:3:1:2811:2730#0/1
ggfgggggf_gcfdfffggggg_cfafgfggg^
@HWUSI-EAS1795_0092:3:1:3119:2734#0/1
TAATCTCATGGTCATTCCGTAGTCGGACAATAC
+HWUSI-EAS1795_0092:3:1:3119:2734#0/1
hhhhhhehhhhhchhghhhgfhedfffhhfh_h
@HWUSI-EAS1795_0092:3:1:3477:2733#0/1
CGAACTTGTCGTACGCACTGGACCTGGATTTGT
+HWUSI-EAS1795_0092:3:1:3477:2733#0/1
ffcfffffffffggggggggg]fcfffggggfg
@HWUSI-EAS1795_0092:3:1:3754:2729#0/1
CTCAAATCACCGGGGAATCCCCATTGCCACTAG
+HWUSI-EAS1795_0092:3:1:3754:2729#0/1
ggggggggggggga_gggggggggfggcgdggg
@HWUSI-EAS1795_0092:3:1:4164:2735#0/1
AAAAGATTGGTGGACGAAAGGAACCTAATCTTG
+HWUSI-EAS1795_0092:3:1:4164:2735#0/1
gdfggcgeggggggcgffcfffgggadffffdc
@HWUSI-EAS1795_0092:3:1:4460:2732#0/1
CCAAGACAAAACCCTACCTACCAAAGGATAAGC
+HWUSI-EAS1795_0092:3:1:4460:2732#0/1
fff_fW]\`\XU`b]`^bfbaf_ffd_bb]bbX
@HWUSI-EAS1795_0092:3:1:4639:2739#0/1
CTGCTTCCTCGACTTCTCCTCCTCCTCCTCCAG
+HWUSI-EAS1795_0092:3:1:4639:2739#0/1
hhhhhhhhhhhhhhhgghhhhghhfhhhghhhh
@HWUSI-EAS1795_0092:3:1:5140:2737#0/1
GGTCACCAAGGCCGCCGAGAAGGCCACCAAGGG
+HWUSI-EAS1795_0092:3:1:5140:2737#0/1
hhhhhhhhhhhghhhhhhhhhhghehhhggghh
@HWUSI-EAS1795_0092:3:1:5543:2733#0/1
CAACAATTGAGGAAATGCCTGCTAATATTGCCG
+HWUSI-EAS1795_0092:3:1:5543:2733#0/1
gcggggggfggfggfgcgggacfg]gggggdgd
@HWUSI-EAS1795_0092:3:1:5834:2739#0/1
GAAGGATCCCTTTCCCATCTCCTGGGCCTCCTT
+HWUSI-EAS1795_0092:3:1:5834:2739#0/1
ffaffffhggfhgfhgghghhhaghghhfhfhf
@HWUSI-EAS1795_0092:3:1:6793:2731#0/1
GCCATGTGCATGTTGGGGAACATATCGGTGGGC
+HWUSI-EAS1795_0092:3:1:6793:2731#0/1
hhhhdhhhhhachhhhhhghhggghhhgchhhc
@HWUSI-EAS1795_0092:3:1:6997:2740#0/1
TATTAATGGATGTGGGGGGCTGCTGTTCACATG
+HWUSI-EAS1795_0092:3:1:6997:2740#0/1
hhhhhhhhhhhhhhhhhhhhhhfhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:7050:2730#0/1
CCGCGCTATCCGCAAGGCCCTGTCTCCGCGCGA
+HWUSI-EAS1795_0092:3:1:7050:2730#0/1
gggcggggggge_fffcgdgfgdfdffgggggg
@HWUSI-EAS1795_0092:3:1:7272:2739#0/1
TGGAGGACAAGATCTGCGAACTGACAATGGAGG
+HWUSI-EAS1795_0092:3:1:7272:2739#0/1
hhhghghhhhhhhdhhhhghhfghhhdhhfhhf
@HWUSI-EAS1795_0092:3:1:7433:2730#0/1
CACAATCACAAAACACCCGAAATATAGTCGTAA
+HWUSI-EAS1795_0092:3:1:7433:2730#0/1
hhhhhhhhhhhhhhghfhdhhhehhhhefgghh
@HWUSI-EAS1795_0092:3:1:7505:2734#0/1
GAGGTTTCCCAGGATGCCACCATTGCCGGAGTC
+HWUSI-EAS1795_0092:3:1:7505:2734#0/1
hhhhhhhhhhhhghhhhhhhhfhhhhhhghhgd
@HWUSI-EAS1795_0092:3:1:7755:2729#0/1
AGATGGACTCCTCCGAGCCACCATACAGCGAGG
+HWUSI-EAS1795_0092:3:1:7755:2729#0/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8149:2730#0/1
GGGAGAGATCGCCCGCCTGCACTCGATTCAGAA
+HWUSI-EAS1795_0092:3:1:8149:2730#0/1
hhhhghhhhhghhhfhhhhghhehhhhhhhggh
@HWUSI-EAS1795_0092:3:1:8471:2734#0/1
CTCGGATCGCATTACCATGATACGGAATGCGGT
+HWUSI-EAS1795_0092:3:1:8471:2734#0/1
fhhhhhhhghhhhhhhhheghhhhhhhhhhhhg
@HWUSI-EAS1795_0092:3:1:8511:2736#0/1
GTGGCATCTTCCCCGCATGGTGCTCCATGGAAA
+HWUSI-EAS1795_0092:3:1:8511:2736#0/1
hhhhhhhhhhhhhhhfhhghefhhhhhhhhhhh
@HWUSI-EAS1795_0092:3:1:8737:2736#0/1
ATTGGTCGTTGCCAAGTTTCTTCTTCTCCTCGG
+HWUSI-EAS1795_0092:3:1:8737:2736#0/1
hhhgghhhhfghhhhhhhhchhhhhghhhehhh
@HWUSI-EAS1795_0092:3:1:8795:2738#0/1
GATGAGGAGAAGGTGCCACGCTACGATAGAATG
+HWUSI-EAS1795_0092:3:1:8795:2738#0/1
hhhhhhhhhhhhhghghhhgdhhhhgghhhghh
@HWUSI-EAS1795_0092:3:1:8860:2736#0/1
GAGCAAGCAACAGAAGAAGGCCAAGAAGTCCAA
+HWUSI-EAS1795_0092:3:1:8860:2736#0/1
ggfgggggggggggeagf]fdfgfegafcf]ff
@HWUSI-EAS1795_0092:3:1:8889:2730#0/1
AAGGGCCACAAGACCTCGAAGATCAGGAATGTG
+HWUSI-EAS1795_0092:3:1:8889:2730#0/1
gffffffffffffgggcgggg_gagg_ggcggf
@HWUSI-EAS1795_0092:3:1:9135:2737#0/1