| Step | Annotation |
|---|---|
|
Step 1: Input dataset
select at runtime
|
|
|
Step 2: Reverse-Complement
Output dataset 'output' from step 1
|
Reverse complements the input sequence so the OH1 sequence (and barcode) is now on the 3' end of the sequenced data, and can be trimmed. |
|
Step 3: Clip
Output dataset 'output' from step 2
15
Enter custom sequence
GACTCCTGAGTTCATAGGTCAC
0
Yes
Output only clipped sequences (i.e. sequences which contained the adapter)
|
Trimming of the OH1 sequence and any barcoding sequences found downstream (3') |
|
Step 4: Reverse-Complement
Output dataset 'output' from step 3
|
Restoring direction of the sequenced data for alignment and comparison to the genomic sequence. |
dalec
All published workflows
Published workflows by dalec