NGS RNP Knock In Trimming

Annotation:

StepAnnotation
Step 1: Input dataset
select at runtime
Step 2: Reverse-Complement
Output dataset 'output' from step 1
Reverse complements the input sequence so the OH1 sequence (and barcode) is now on the 3' end of the sequenced data, and can be trimmed.
Step 3: Clip
Output dataset 'output' from step 2
15
Enter custom sequence
GACTCCTGAGTTCATAGGTCAC
0
Yes
Output only clipped sequences (i.e. sequences which contained the adapter)
Trimming of the OH1 sequence and any barcoding sequences found downstream (3')
Step 4: Reverse-Complement
Output dataset 'output' from step 3
Restoring direction of the sequenced data for alignment and comparison to the genomic sequence.