Screen.seqs

Dataset Information

Number:87
Name:Screen.seqs on data 84 and data 79: good.fasta
Created:Thu May 24 19:08:21 2018 (UTC)
Filesize:39.7 MB
Dbkey:?
Format:fasta

Job Information

Galaxy Tool ID:toolshed.g2.bx.psu.edu/repos/iuc/mothur_screen_seqs/mothur_screen_seqs/1.39.5.0
Galaxy Tool Version:1.39.5.0
Tool Version:v.1.39.5
Tool Standard Output:stdout
Tool Standard Error:stderr
Tool Exit Code:0
History Content API ID: bbd44e69cb8906b5ece9881f1387fb2c
Job API ID: bbd44e69cb8906b58e0e8d941ab01d79
History API ID: ce7f71df5c022ed6
UUID:95cc1b3f-1ca4-4d9a-9883-148ff969e31e

Inheritance Chain

Screen.seqs on data 84 and data 79: good.fasta

Job Dependencies

Dependency Dependency Type Version
mothur conda 1.39.5

Dataset peek

>M03992_221_000000000-BGWB9_1_2107_7524_2686	

AACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCATCAAAACCTTTTCCTTTGATCCTCTTTTGGTCGGGAAAAGGATTTTTGGACTTGGAGGTTCTATGCTCGCTTTTGAAAGCGAGCTCCTCTCAAATGAATTAGTGGGGTCTGCTTTGCTGATCCTTGACGTGATAAGATGTTTCTACGTTTTGGATTTGGCACTGTCCCTTGGACGCCTGCTCCTAACCGTCTGTTG
GACGACGATGGTGCTTCGGTCACTGCCATCTACATTGGCGGGAGGCTGGACCCACAAAAAAGACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA

>M03992_221_000000000-BGWB9_1_2107_7544_2693	

AACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTTAAATCATCAAAACCTTTTCCTTTGATCCTCTTTTGGTCGGGAAAAGGATTTTTGGACTTGGAGGTTCTATGCTCGCTTTTGAAAGCGAGCTCCTCTCAAATGAATTAGTGGGGTCTGCTTTGCTGATCCTTGACGTGATAAGATGTTTCTACGTTTTGGATTTGGCACTGTCCCTTGGACGCCTGCTCCTAACCGTCTGTTG