Upload File

Dataset Information

Number:101
Name:UNITE.fasta
Created:Thu May 24 19:57:29 2018 (UTC)
Filesize:503.3 MB
Dbkey:?
Format:fasta

Job Information

Galaxy Tool ID:upload1
Galaxy Tool Version:1.1.6
Tool Version:
Tool Standard Output:stdout
Tool Standard Error:stderr
Tool Exit Code:0
History Content API ID: bbd44e69cb8906b5547dd63ac4db32ec
Job API ID: bbd44e69cb8906b5579498bc9830d33f
History API ID: ce7f71df5c022ed6
UUID:bacb8c71-4ddf-43dd-90bd-42011f2f42b1

Inheritance Chain

UNITE.fasta

Dataset peek

>UDB016649|k__Fungi;p__Basidiomycota;c__Agaricomycetes;o__Thelephorales;f__Thelephoraceae;g__Thelephora;s__Thelephora_albomarginata|SH184509.07FU

TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAATTGTCAAACGGGTTGTTGCTGGTCTTCAAACGGGGACATGTGCACGCTCTGTTTACACATCCACTCACACCTGTGCACCCTCCGTAGTTCTATGGTCTGGGGGACCCTGTCTTCCTGCCGTGGTTCTACGTCTTTACACACACTCTGTAATAAAGTCTTATGGAATGTATGCCGCGTCTAACGCAATACAATA
CAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCTATTCCGAGGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCATGGTTCGCCATGATGAGCTTGGACTCTGGGGGTTTTGCTGGCCTGTGGTCGGCTCCCCTCAAATGAATCGGCCTCCCAGTGT
TTGGTGGCATCACGGGTGTGATAAATATCTACGCTCACGGTTGTCTGCCAGGTAACCTTTGGTGACAAAGGTTCGCTGGAGCTCACAGATGTCTCTCCTCGGCGAGGACAGCTTTTTTGAACGTTCGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

>UDB016650|k__Fungi;p__Basidiomycota;c__Agaricomycetes;o__Thelephorales;f__Thelephoraceae;g__Tomentella;s__Tomentella_sp|SH189365.07FU