>Feature 1 70 1404 CDS gene dnaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03831 locus_tag OGMAPBJC_00001 product chromosomal replication initiator protein DnaA; DNA-binding transcriptional dual regulator 1409 2509 CDS EC_number 2.7.7.7 gene dnaN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10242-MONOMER locus_tag OGMAPBJC_00002 product DNA polymerase III, holoenzyme 2509 3582 CDS gene recF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10828-MONOMER locus_tag OGMAPBJC_00003 product ssDNA and dsDNA binding, ATP binding 3611 6025 CDS EC_number 5.99.1.3 gene gyrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10424-MONOMER locus_tag OGMAPBJC_00004 product DNA gyrase, subunit B 6265 6663 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11196-MONOMER locus_tag OGMAPBJC_00005 note conserved protein product hypothetical protein 6778 7590 CDS EC_number 3.1.3.23 gene yidA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11195-MONOMER locus_tag OGMAPBJC_00006 product sugar phosphatase 8292 7636 CDS gene yidX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11719-MONOMER locus_tag OGMAPBJC_00007 product putative lipoprotein 8570 9259 CDS gene dgoR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7790-MONOMER locus_tag OGMAPBJC_00008 product putative DNA-binding transcriptional regulator 9256 10134 CDS EC_number 2.7.1.58 gene dgoK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DEHYDDEOXGALACTKIN-MONOMER locus_tag OGMAPBJC_00009 product 2-dehydro-3-deoxygalactonate kinase 10118 10735 CDS EC_number 4.1.2.21 gene dgoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DEHYDDEOXPHOSGALACT-ALDOL-MONOMER locus_tag OGMAPBJC_00010 product 2-oxo-3-deoxygalactonate 6-phosphate aldolase 10732 11880 CDS EC_number 4.2.1.6 gene dgoD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GALACTONATE-DEHYDRATASE-MONOMER locus_tag OGMAPBJC_00011 product D-galactonate dehydratase 12000 13292 CDS gene dgoT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIDT-MONOMER locus_tag OGMAPBJC_00012 product galactonate transporter 14353 13289 CDS gene cbrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11714-MONOMER locus_tag OGMAPBJC_00013 product colicin M resistance protein 14454 15668 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11713-MONOMER locus_tag OGMAPBJC_00014 note conserved protein product hypothetical protein 15930 15670 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11712-MONOMER locus_tag OGMAPBJC_00015 note conserved outer membrane protein product hypothetical protein 16308 16721 CDS gene ibpA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11534-MONOMER locus_tag OGMAPBJC_00016 product small heat shock protein IbpA 16833 17261 CDS gene ibpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11535-MONOMER locus_tag OGMAPBJC_00017 product small heat shock protein IbpB 17457 19118 CDS gene yidE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11536-MONOMER locus_tag OGMAPBJC_00018 product putative transporter 19831 19115 CDS gene yidP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11711-MONOMER locus_tag OGMAPBJC_00019 product putative DNA-binding transcriptional regulator 20127 21743 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00020 product hypothetical protein 21743 23065 CDS EC_number 3.2.1.122 db_xref COG:COG1486 gene aglB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q9AGA6 locus_tag OGMAPBJC_00021 product 6-phospho-alpha-glucosidase 23577 24842 CDS gene ydcM_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6743-MONOMER locus_tag OGMAPBJC_00022 product putative transposase 25013 25360 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11696-MONOMER locus_tag OGMAPBJC_00023 note conserved inner membrane protein product hypothetical protein 25350 25712 CDS gene yidG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11695-MONOMER locus_tag OGMAPBJC_00024 product putative inner membrane protein 25709 26206 CDS gene yidF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11694-MONOMER locus_tag OGMAPBJC_00025 product putative DNA-binding transcriptional regulator 27398 26214 CDS gene emrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EMRD-MONOMER locus_tag OGMAPBJC_00026 product multidrug efflux transporter EmrD 27767 27678 CDS gene tisB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1922 locus_tag OGMAPBJC_00027 product toxic peptide TisB 28536 30224 CDS EC_number 2.2.1.6 gene ilvB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LARGEILVB-MONOMER locus_tag OGMAPBJC_00028 product acetohydroxybutanoate synthase / acetolactate synthase 30228 30518 CDS EC_number 2.2.1.6 gene ilvN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SMALLILVN-MONOMER locus_tag OGMAPBJC_00029 product acetohydroxybutanoate synthase / acetolactate synthase 30593 31183 CDS gene fimZ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_00030 product FimZ transcriptional regulator 31183 32685 CDS EC_number 2.7.13.3 gene uhpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P09835 locus_tag OGMAPBJC_00031 product Signal transduction histidine-protein kinase/phosphatase UhpB 32695 34014 CDS gene glpT_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLPT-MONOMER locus_tag OGMAPBJC_00032 product glycerol-3-phosphate:phosphate antiporter 34152 35543 CDS gene uhpT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UHPT-MONOMER locus_tag OGMAPBJC_00033 product hexose-6-phosphate:phosphate antiporter 37354 35588 CDS EC_number 3.5.4.2 gene ade inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11692-MONOMER locus_tag OGMAPBJC_00034 product cryptic adenine deaminase monomer 37529 38863 CDS gene yicO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11691-MONOMER locus_tag OGMAPBJC_00035 product putative membrane protein with possible relationship to novobiocin and deoxycholate resistance 38916 39368 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11690-MONOMER locus_tag OGMAPBJC_00036 note conserved protein product hypothetical protein 39531 40769 CDS gene nepI_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YICM-MONOMER locus_tag OGMAPBJC_00037 product purine ribonucleoside efflux transporter 41103 40810 CDS gene yicS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2691 locus_tag OGMAPBJC_00038 product putative protein 41325 42143 CDS gene nlpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10657-MONOMER locus_tag OGMAPBJC_00039 product lipoprotein-28 43070 42147 CDS gene yicL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11688-MONOMER locus_tag OGMAPBJC_00040 product inhibitor of heme biosynthesis 44365 43181 CDS gene setC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B3659-MONOMER locus_tag OGMAPBJC_00041 product inner membrane protein SetC - putative arabinose efflux protein 45096 45002 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00042 product tRNA-SeC(tca) 45389 46771 CDS gene yicJ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YICJ-MONOMER locus_tag OGMAPBJC_00043 product YicJ GPH transporter 46781 49099 CDS gene yicI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11685-MONOMER locus_tag OGMAPBJC_00044 product alpha-xylosidase 50861 49152 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11684-MONOMER locus_tag OGMAPBJC_00045 note conserved protein product hypothetical protein 52373 50982 CDS gene xanP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YICE-MONOMER locus_tag OGMAPBJC_00046 product xanthine:H+ symporter XanP 52653 53858 CDS gene gltS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLTS-MONOMER locus_tag OGMAPBJC_00047 product glutamate:sodium symporter 56105 54024 CDS gene recG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10829-MONOMER locus_tag OGMAPBJC_00048 product RecG DNA helicase 56767 56111 CDS EC_number 2.1.1.34 gene trmH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10967-MONOMER locus_tag OGMAPBJC_00049 product tRNA (Gm18) 2'-O-methyltransferase 58915 56807 CDS EC_number 3.1.7.2 gene spoT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SPOT-MONOMER locus_tag OGMAPBJC_00050 product guanosine 3'-diphosphate 5'-triphosphate 3'-diphosphatase [multifunctional] 59209 58934 CDS EC_number 2.7.7.6 gene rpoZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10899-MONOMER locus_tag OGMAPBJC_00051 product RNA polymerase, o subunit 59887 59264 CDS EC_number 2.7.4.8 gene gmk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GUANYL-KIN-MONOMER locus_tag OGMAPBJC_00052 product guanylate kinase 60145 61827 CDS EC_number 6.5.1.2 gene ligB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11334-MONOMER locus_tag OGMAPBJC_00053 product DNA ligase 62441 61824 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11683-MONOMER locus_tag OGMAPBJC_00054 note conserved inner membrane protein product hypothetical protein 63557 62733 CDS gene dinD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11193-MONOMER locus_tag OGMAPBJC_00055 product DNA-damage-inducible protein 64641 63778 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11192-MONOMER locus_tag OGMAPBJC_00056 note conserved protein product hypothetical protein 64768 65484 CDS EC_number 2.7.7.56 gene rph inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10863-MONOMER locus_tag OGMAPBJC_00057 product RNase PH monomer 65550 66191 CDS EC_number 2.4.2.10 gene pyrE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OROPRIBTRANS-MONOMER locus_tag OGMAPBJC_00058 product orotate phosphoribosyltransferase 66824 66228 CDS gene slmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11191-MONOMER locus_tag OGMAPBJC_00059 product cell division inhibitor, nucleoid occlusion 67389 66931 CDS EC_number 3.6.1.23 gene dut inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DUTP-PYROP-MONOMER locus_tag OGMAPBJC_00060 product deoxyuridine triphosphatase 68587 67367 CDS EC_number 6.3.2.5 gene dfp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10004-MONOMER locus_tag OGMAPBJC_00061 product fused 4'-phosphopantothenoylcysteine decarboxylase and phosphopantothenoylcysteine synthetase 68759 69427 CDS gene yicR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11312-MONOMER locus_tag OGMAPBJC_00062 product hypothetical protein 69644 69880 CDS gene rpmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10886-MONOMER locus_tag OGMAPBJC_00063 product 50S ribosomal subunit protein L28 69901 70068 CDS gene rpmG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10891-MONOMER locus_tag OGMAPBJC_00064 product 50S ribosomal subunit protein L33 70166 70975 CDS EC_number 3.2.2.23 gene mutM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10329-MONOMER locus_tag OGMAPBJC_00065 product formamidopyrimidine DNA glycosylase 71493 71014 CDS EC_number 2.7.7.3 gene coaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PANTEPADENYLYLTRAN-MONOMER locus_tag OGMAPBJC_00066 product pantetheine-phosphate adenylyltransferase monomer 72778 71501 CDS gene waaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDOTRANS-MONOMER locus_tag OGMAPBJC_00067 product KDO transferase 73191 74249 CDS gene waaQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11341-MONOMER locus_tag OGMAPBJC_00068 product lipopolysaccharide core heptosyl transferase III 74246 75370 CDS gene waaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11339-MONOMER locus_tag OGMAPBJC_00069 product lipopolysaccharide glucosyltransferase I 75363 76160 CDS gene waaP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11340-MONOMER locus_tag OGMAPBJC_00070 product lipopolysaccharide core heptose (I) kinase 76176 77192 CDS EC_number 2.4.1.44 gene waaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11352-MONOMER locus_tag OGMAPBJC_00071 product UDP-D-glucose:(glucosyl)LPS alpha-1,3-glucosyltransferase 77209 78204 CDS EC_number 2.4.1.58 gene waaJ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11353-MONOMER locus_tag OGMAPBJC_00072 product UDP-glucose:(glucosyl)LPS alpha-1,2-glucosyltransferase 78214 78906 CDS gene waaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11425-MONOMER locus_tag OGMAPBJC_00073 product lipopolysaccharide core heptose (II) kinase 78932 79957 CDS EC_number 2.4.1.58 gene waaJ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11353-MONOMER locus_tag OGMAPBJC_00074 product UDP-glucose:(glucosyl)LPS alpha-1,2-glucosyltransferase 80042 81025 CDS EC_number 2.4.2.53 gene arnC_1 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01164 locus_tag OGMAPBJC_00075 product Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase 81071 82324 CDS gene rfaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11424-MONOMER locus_tag OGMAPBJC_00076 product O-antigen ligase 83365 82394 CDS gene waaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11189-MONOMER locus_tag OGMAPBJC_00077 product ADP-heptose:LPS heptosyltransferase I 84415 83369 CDS gene waaF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12210-MONOMER locus_tag OGMAPBJC_00078 product ADP-heptose:LPS heptosyltransferase II 85357 84425 CDS EC_number 5.1.3.20 gene rfaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10838-MONOMER locus_tag OGMAPBJC_00079 product ADP-L-glycero-D-mannoheptose-6-epimerase 85571 86767 CDS EC_number 2.3.1.29 gene kbl_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AKBLIG-MONOMER locus_tag OGMAPBJC_00080 product 2-amino-3-ketobutyrate CoA ligase 86777 87802 CDS EC_number 1.1.1.103 gene tdh inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THREODEHYD-MONOMER locus_tag OGMAPBJC_00081 product threonine dehydrogenase 88041 89075 CDS gene yibD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11266-MONOMER locus_tag OGMAPBJC_00082 product putative glycosyl transferase 90021 89062 CDS gene yibQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12298-MONOMER locus_tag OGMAPBJC_00083 product putative nucleoside (IDP) diphosphatase 91284 90025 CDS gene envC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12297-MONOMER locus_tag OGMAPBJC_00084 product EnvC murein hydrolase 92862 91318 CDS gene gpmM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGMI-MONOMER locus_tag OGMAPBJC_00085 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 93107 93538 CDS gene yibN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12295-MONOMER locus_tag OGMAPBJC_00086 product putative rhodanese-related sulfurtransferase 93680 93931 CDS gene grxD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12181-MONOMER locus_tag OGMAPBJC_00087 product glutaredoxin 4 93994 94461 CDS gene secB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECB locus_tag OGMAPBJC_00088 product Sec Translocation Complex 94461 95480 CDS EC_number 1.1.1.94 gene gpsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYC3PDEHYDROGBIOSYN-MONOMER locus_tag OGMAPBJC_00089 product glycerol-3-phosphate dehydrogenase 95560 96381 CDS EC_number 2.3.1.30 gene cysE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SERINE-O-ACETTRAN-MONOMER locus_tag OGMAPBJC_00090 product serine acetyltransferase monomer 96916 96443 CDS gene trmL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11888-MONOMER locus_tag OGMAPBJC_00091 product tRNA (cytidine/uridine-2'-O)-ribose methyltransferase 98179 96989 CDS EC_number 1.1.2.3 gene lldD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:L-LACTDEHYDROGFMN-MONOMER locus_tag OGMAPBJC_00092 product L-lactate dehydrogenase 98952 98176 CDS gene lldR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11962-MONOMER locus_tag OGMAPBJC_00093 product LldR transcriptional repressor 100607 98952 CDS gene lldP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LCTP-MONOMER locus_tag OGMAPBJC_00094 product (R)-lactate / (S)-lactate / glycolate:H+ symporter LldP 105354 100975 CDS db_xref COG:COG5295 gene ehaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q7DJ60 locus_tag OGMAPBJC_00095 product Autotransporter adhesin EhaG 106081 105398 CDS gene sadB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q8ZL65 locus_tag OGMAPBJC_00096 product Inner membrane lipoprotein SadB 106987 106625 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11964-MONOMER locus_tag OGMAPBJC_00097 note conserved protein product hypothetical protein 107272 107481 CDS gene yibT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2690 locus_tag OGMAPBJC_00098 product putative protein 108080 107493 CDS gene mtlR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00369 locus_tag OGMAPBJC_00099 product MtlR DNA-binding transcriptional repressor 109228 108080 CDS EC_number 1.1.1.17 gene mtlD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANNPDEHYDROG-MONOMER locus_tag OGMAPBJC_00100 product mannitol-1-phosphate 5-dehydrogenase 111371 109458 CDS EC_number 2.7.1.69 gene mtlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MTLA-MONOMER locus_tag OGMAPBJC_00101 product mannitol PTS permease 111908 112270 CDS gene yibI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11765-MONOMER locus_tag OGMAPBJC_00102 product putative inner membrane protein 112273 113409 CDS gene yibH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11764-MONOMER locus_tag OGMAPBJC_00103 product putative membrane protein 115474 115013 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11763-MONOMER locus_tag OGMAPBJC_00104 note conserved protein product hypothetical protein 116424 115486 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00105 product hypothetical protein 117314 116472 CDS gene yibA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11187-MONOMER locus_tag OGMAPBJC_00106 product putative lyase containing HEAT-repeat protein 121468 117335 CDS gene rhsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10846-MONOMER locus_tag OGMAPBJC_00107 product RhsA protein in rhs element 121696 122304 CDS gene yibF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11762-MONOMER locus_tag OGMAPBJC_00108 product glutathione transferase-like protein possibly involved in selenium metabolism 122402 123793 CDS EC_number 2.9.1.1 gene selA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10941-MONOMER locus_tag OGMAPBJC_00109 product selenocysteine synthase monomer 123790 125634 CDS gene selB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10942-MONOMER locus_tag OGMAPBJC_00110 product selenocysteyl-tRNA-specific translation elongation factor 125824 126975 CDS EC_number 1.1.1.1 gene yiaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12293-MONOMER locus_tag OGMAPBJC_00111 product putative Fe-containing alcohol dehydrogenase 127140 128678 CDS gene aldB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALDDEHYDROGB-MONOMER locus_tag OGMAPBJC_00112 product acetaldehyde dehydrogenase 129109 128897 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00113 product hypothetical protein 129223 129546 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12291-MONOMER locus_tag OGMAPBJC_00114 note conserved inner membrane protein product hypothetical protein 129552 130688 CDS gene yiaV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12290-MONOMER locus_tag OGMAPBJC_00115 product putative membrane fusion protein (MFP) component of efflux pump, signal anchor 131659 130685 CDS gene yiaU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12289-MONOMER locus_tag OGMAPBJC_00116 product putative DNA-binding transcriptional regulator, LysR-type 131783 132523 CDS gene yiaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12288-MONOMER locus_tag OGMAPBJC_00117 product putative outer membrane protein 134623 132653 CDS EC_number 3.2.1.185 gene hypBA1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:E8MGH8 locus_tag OGMAPBJC_00118 product Non-reducing end beta-L-arabinofuranosidase 136034 134634 CDS gene yicJ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YICJ-MONOMER locus_tag OGMAPBJC_00119 product YicJ GPH transporter 136260 137075 CDS gene rhaR_1 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01533 locus_tag OGMAPBJC_00120 product HTH-type transcriptional activator RhaR 137802 137107 CDS EC_number 5.1.3.4 gene sgbE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12287-MONOMER locus_tag OGMAPBJC_00121 product L-ribulose-5-phosphate 4-epimerase 138656 137796 CDS EC_number 5.1.3.22 gene sgbU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12286-MONOMER locus_tag OGMAPBJC_00122 product putative L-xylulose 5-phosphate 3-epimerase 139311 138649 CDS EC_number 4.1.1.85 gene sgbH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12285-MONOMER locus_tag OGMAPBJC_00123 product 3-keto-L-gulonate 6-phosphate decarboxylase 140804 139308 CDS EC_number 2.7.1.53 gene lyxK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LYXK-MONOMER locus_tag OGMAPBJC_00124 product L-xylulose kinase 141794 140808 CDS gene yiaO_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12283-MONOMER locus_tag OGMAPBJC_00125 product 2,3-diketo-L-gulonate:Na+ symporter - periplasmic binding protein 143084 141807 CDS gene yiaN_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12282-MONOMER locus_tag OGMAPBJC_00126 product 2,3-diketo-L-gulonate:Na+ symporter - membrane subunit 143560 143087 CDS gene yiaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-422 locus_tag OGMAPBJC_00127 product 2,3-diketo-L-gulonate:Na+ symporter - membrane subunit 144145 143678 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12280-MONOMER locus_tag OGMAPBJC_00128 note conserved protein product hypothetical protein 145155 144157 CDS EC_number 1.1.1.130 gene yiaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12279-MONOMER locus_tag OGMAPBJC_00129 product 2,3-diketo-L-gulonate reductase monomer 145356 146204 CDS gene yiaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12278-MONOMER locus_tag OGMAPBJC_00130 product YiaJ DNA-binding transcriptional repressor 146306 146779 CDS gene ysaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12277-MONOMER locus_tag OGMAPBJC_00131 product putative hydrogenase, 4Fe-4S ferredoxin-type component 148183 146930 CDS EC_number 2.6.1.66 gene avtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:VALINE-PYRUVATE-AMINOTRANSFER-MONOMER locus_tag OGMAPBJC_00132 product valine-pyruvate aminotransferase 150391 148361 CDS EC_number 3.2.1.1 gene malS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALPHA-AMYL-PERI-MONOMER locus_tag OGMAPBJC_00133 product alpha-amylase 150711 151535 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11360-MONOMER locus_tag OGMAPBJC_00134 note conserved protein product hypothetical protein 152909 151731 CDS gene xylR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG20253-MONOMER locus_tag OGMAPBJC_00135 product XylR transcriptional activator 154168 152987 CDS gene xylH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLH-MONOMER locus_tag OGMAPBJC_00136 product xylose ABC transporter - membrane subunit 155687 154146 CDS gene xylG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLG-MONOMER locus_tag OGMAPBJC_00137 product xylose ABC transporter - ATP binding subunit 156757 155765 CDS gene xylF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLF-MONOMER locus_tag OGMAPBJC_00138 product xylose ABC transporter - periplasmic binding protein 157123 158445 CDS EC_number 5.3.1.5 gene xylA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLISOM-MONOMER locus_tag OGMAPBJC_00139 product xylose isomerase 158517 159971 CDS EC_number 2.7.1.17 gene xylB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLULOKIN-MONOMER locus_tag OGMAPBJC_00140 product xylulokinase 160140 160481 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11267-MONOMER locus_tag OGMAPBJC_00141 note conserved inner membrane protein product hypothetical protein 160527 160964 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11186-MONOMER locus_tag OGMAPBJC_00142 note conserved inner membrane protein product hypothetical protein 162001 161006 CDS gene wecH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12274-MONOMER locus_tag OGMAPBJC_00143 product O-acetyltransferase 162176 162475 CDS gene ysaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2689 locus_tag OGMAPBJC_00144 product putative protein 162570 163481 CDS EC_number 6.1.1.14 gene glyQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYQ-MONOMER locus_tag OGMAPBJC_00145 product glycyl-tRNA synthetase, alpha subunit 163491 165560 CDS EC_number 6.1.1.14 gene glyS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYS-MONOMER locus_tag OGMAPBJC_00146 product glycyl-tRNA synthetase, beta subunit 165823 166035 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00147 product hypothetical protein 166434 166222 CDS gene cspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03695 locus_tag OGMAPBJC_00148 product CspA DNA-binding transcriptional activator 167005 166715 CDS gene yiaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12624-MONOMER locus_tag OGMAPBJC_00149 product putative transcriptional regulator 167439 168149 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12273-MONOMER locus_tag OGMAPBJC_00150 note conserved protein product hypothetical protein 169173 168199 CDS EC_number 1.1.1.79 gene ghrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER-43 locus_tag OGMAPBJC_00151 product glyoxylate reductase / glyoxylate reductase B / 2-ketoaldonate reductase 169936 169277 CDS gene yiaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12271-MONOMER locus_tag OGMAPBJC_00152 product putative outer membrane lipoprotein 170089 172422 CDS gene bisC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10124-MONOMER locus_tag OGMAPBJC_00153 product biotin sulfoxide reductase 172831 172391 CDS gene yiaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12270-MONOMER locus_tag OGMAPBJC_00154 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 173391 172828 CDS EC_number 3.2.2.20 gene tag inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10986-MONOMER locus_tag OGMAPBJC_00155 product 3-methyl-adenine DNA glycosylase I, constitutive 173549 174247 CDS gene yhjY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12269-MONOMER locus_tag OGMAPBJC_00156 product putative lipase 174476 175684 CDS gene yhjX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHJX-MONOMER locus_tag OGMAPBJC_00157 product YhjX MFS transporter 176008 177699 CDS gene eptB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12267-MONOMER locus_tag OGMAPBJC_00158 product phosphoethanolamine transferase 177791 177867 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00159 product tRNA-Pro(cgg) 178610 180217 CDS gene dppA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DPPA-MONOMER locus_tag OGMAPBJC_00160 product dipeptide ABC transporter - periplasmic binding protein 180368 181387 CDS gene dppB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DPPB-MONOMER locus_tag OGMAPBJC_00161 product dipeptide ABC transporter - putative membrane subunit 181397 182299 CDS gene dppC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DPPC-MONOMER locus_tag OGMAPBJC_00162 product dipeptide ABC transporter - putative membrane subunit 182310 183293 CDS gene dppD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DPPD-MONOMER locus_tag OGMAPBJC_00163 product dipeptide ABC transporter - putative ATP binding subunit 183290 184294 CDS gene dppF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DPPF-MONOMER locus_tag OGMAPBJC_00164 product dipeptide ABC transporter - putative ABC binding subunit 185595 184324 CDS gene yhjV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHJV-MONOMER locus_tag OGMAPBJC_00165 product YhjV STP transporter 186071 186178 CDS gene ldrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-921 locus_tag OGMAPBJC_00166 product LdrD peptide of the LdrD-RdlD toxin-antitoxin system 187944 186265 CDS gene bcsG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12265-MONOMER locus_tag OGMAPBJC_00167 product putative inner membrane protein 188132 187941 CDS gene bcsF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12264-MONOMER locus_tag OGMAPBJC_00168 product putative protein 189301 188129 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12263-MONOMER locus_tag OGMAPBJC_00169 note conserved protein product hypothetical protein 189688 189311 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12263-MONOMER locus_tag OGMAPBJC_00170 note conserved protein product hypothetical protein 189973 190161 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12262-MONOMER locus_tag OGMAPBJC_00171 note conserved protein product hypothetical protein 190173 190925 CDS gene bcsQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12261-MONOMER locus_tag OGMAPBJC_00172 product putative cellulose biosynthesis protein 190922 191494 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00173 product hypothetical protein 191517 193394 CDS EC_number 2.4.1.12 gene bcsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12260-MONOMER locus_tag OGMAPBJC_00174 product cellulose synthase, catalytic subunit 193441 195744 CDS gene bcsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12259-MONOMER locus_tag OGMAPBJC_00175 product cellulose biosynthesis protein 195751 196857 CDS EC_number 3.2.1.4 gene bcsZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12258-MONOMER locus_tag OGMAPBJC_00176 product endo-1,4-D-glucanase 196839 200312 CDS gene bcsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12257-MONOMER locus_tag OGMAPBJC_00177 product oxidase involved in cellulose synthesis 200433 202382 CDS gene yhjK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12256-MONOMER locus_tag OGMAPBJC_00178 product putative diguanylate cyclase 202565 203851 CDS gene dctA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DCTA-MONOMER locus_tag OGMAPBJC_00179 product C4 dicarboxylate / orotate:H+ symporter 204072 205568 CDS gene yhjJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12254-MONOMER locus_tag OGMAPBJC_00180 product putative zinc-dependent peptidase 206593 205664 CDS EC_number 2.7.1.45 gene kdgK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DEOXYGLUCONOKIN-MONOMER locus_tag OGMAPBJC_00181 product 2-keto-3-deoxygluconokinase 206825 207592 CDS EC_number 3.1.4.52 gene yhjH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12252-MONOMER locus_tag OGMAPBJC_00182 product c-di-GMP phosphodiesterase 207662 209722 CDS gene yhjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12251-MONOMER locus_tag OGMAPBJC_00183 product putative outer membrane biogenesis protein 211226 209904 CDS gene yhjE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHJE-MONOMER locus_tag OGMAPBJC_00184 product YhjE MFS transporter 212650 211637 CDS gene yhjD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12248-MONOMER locus_tag OGMAPBJC_00185 product inner membrane protein associated with lipopolysaccharide transport 213670 212699 CDS gene yhjC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12247-MONOMER locus_tag OGMAPBJC_00186 product putative DNA-binding transcriptional regulator 214117 214719 CDS gene yhjB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12246-MONOMER locus_tag OGMAPBJC_00187 product putative DNA-binding response regulator in two-component regulatory system 216419 214770 CDS EC_number 3.2.1.28 gene treF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TREHALACYTO-MONOMER locus_tag OGMAPBJC_00188 product cytoplasmic trehalase 216823 218220 CDS EC_number 1.11.1.5 gene yhjA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12244-MONOMER locus_tag OGMAPBJC_00189 product putative cytochrome C peroxidase 218431 219831 CDS EC_number 4.1.1.15 gene gadA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTDECARBOXA-MONOMER locus_tag OGMAPBJC_00190 product glutamate decarboxylase A subunit 220201 221025 CDS gene gadX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12243-MONOMER locus_tag OGMAPBJC_00191 product GadX DNA-binding transcriptional dual regulator 221393 222121 CDS gene gadW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12242-MONOMER locus_tag OGMAPBJC_00192 product GadW DNA-binding transcriptional dual regulator 225597 222484 CDS gene mdtF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHIV-MONOMER locus_tag OGMAPBJC_00193 product MdtEF-TolC multidrug efflux transport system - permease subunit 226779 225622 CDS gene mdtE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12240-MONOMER locus_tag OGMAPBJC_00194 product MdtEF-TolC multidrug efflux transport system - membrane fusion protein 226839 227117 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00195 product hypothetical protein 227645 227118 CDS gene gadE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11544-MONOMER locus_tag OGMAPBJC_00196 product GadE DNA-binding transcriptional activator 229016 228444 CDS gene hdeD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11495-MONOMER locus_tag OGMAPBJC_00197 product acid-resistance membrane protein 229271 229603 CDS gene hdeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11398-MONOMER locus_tag OGMAPBJC_00198 product acid-resistance protein, possible chaperone 229707 230045 CDS gene hdeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11399-MONOMER locus_tag OGMAPBJC_00199 product acid stress chaperone 230181 230756 CDS gene yhiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11400-MONOMER locus_tag OGMAPBJC_00200 product putative Mg(2+) transport ATPase 231328 230798 CDS gene dctR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11889-MONOMER locus_tag OGMAPBJC_00201 product putative DNA-binding transcriptional regulator 232050 231484 CDS gene slp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11890-MONOMER locus_tag OGMAPBJC_00202 product starvation lipoprotein 233521 232298 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00203 product hypothetical protein 234575 234150 CDS EC_number 1.20.4.1 gene arsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12237-MONOMER locus_tag OGMAPBJC_00204 product arsenate reductase 235877 234588 CDS gene arsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARSF-MONOMER locus_tag OGMAPBJC_00205 product arsenite:H+ antiporter 236284 235931 CDS gene arsR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12235-MONOMER locus_tag OGMAPBJC_00206 product ArsR-antimonite 236996 236823 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00207 product hypothetical protein 238513 237161 CDS EC_number 1.8.1.7 gene gor inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTATHIONE-REDUCT-NADPH-MONOMER locus_tag OGMAPBJC_00208 product glutathione reductase (NADPH) 239427 238585 CDS gene rlmJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12234-MONOMER locus_tag OGMAPBJC_00209 product 23S rRNA methyltransferase 239630 241672 CDS gene prlC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11441-MONOMER locus_tag OGMAPBJC_00210 product oligopeptidase A 241680 242432 CDS gene rsmJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12233-MONOMER locus_tag OGMAPBJC_00211 product 16S rRNA methyltransferase 243950 242481 CDS gene dtpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHIP-MONOMER locus_tag OGMAPBJC_00212 product dipeptide / tripeptide:H+ symporter DtpB 244701 244267 CDS gene uspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11390-MONOMER locus_tag OGMAPBJC_00213 product universal stress global stress response regulator 245092 245427 CDS gene uspB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12231-MONOMER locus_tag OGMAPBJC_00214 product putative universal stress (ethanol tolerance) protein B 247170 245671 CDS gene pitA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PITA-MONOMER locus_tag OGMAPBJC_00215 product phosphate:H+ symporter PitA 247402 248604 CDS gene yhiN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12229-MONOMER locus_tag OGMAPBJC_00216 product putative oxidoreductase with FAD/NAD(P)-binding domain protein 248747 249589 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00217 product hypothetical protein 249576 250160 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00218 product hypothetical protein 250244 251698 CDS gene tnsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P13989 locus_tag OGMAPBJC_00219 product Transposon Tn7 transposition protein TnsB 251698 253146 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00220 product hypothetical protein 253187 254743 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00221 product hypothetical protein 254755 255681 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00222 product hypothetical protein 256896 258722 CDS gene recF_2 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_00365 locus_tag OGMAPBJC_00223 product DNA replication and repair protein RecF 259241 258891 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00224 product hypothetical protein 259820 259389 CDS gene silE_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q9Z4N3 locus_tag OGMAPBJC_00225 product Silver-binding protein SilE 261546 260065 CDS EC_number 2.7.13.3 db_xref COG:COG0642 gene cusS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P77485 locus_tag OGMAPBJC_00226 product Sensor histidine kinase CusS 262219 261539 CDS gene yedW_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_00227 product putative DNA-binding response regulator in two-component system with YedV 262409 263794 CDS gene cusC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6320-MONOMER locus_tag OGMAPBJC_00228 product copper / silver efflux transport system - outer membrane porin 263823 264176 CDS gene cusF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6321-MONOMER locus_tag OGMAPBJC_00229 product copper / silver efflux transport system - periplasmic binding protein 264290 265582 CDS gene cusB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6322-MONOMER locus_tag OGMAPBJC_00230 product copper / silver efflux transport system - membrane fusion protein 265593 268739 CDS gene cusA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBDE-MONOMER locus_tag OGMAPBJC_00231 product copper / silver efflux transport system - membrane subunit 268826 269266 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00232 product hypothetical protein 269394 271835 CDS gene copA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6260-MONOMER locus_tag OGMAPBJC_00233 product Cu+ efflux ATPase 271876 272073 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00234 product hypothetical protein 272844 272107 CDS gene yebA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10013-MONOMER locus_tag OGMAPBJC_00235 product putative peptidase 273582 273133 CDS gene silE_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q9Z4N3 locus_tag OGMAPBJC_00236 product Silver-binding protein SilE 273817 275634 CDS gene cueO_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12318-MONOMER locus_tag OGMAPBJC_00237 product multicopper oxidase with role in copper homeostasis 275634 276530 CDS gene copB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P12375 locus_tag OGMAPBJC_00238 product Copper resistance protein B 276570 276950 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7014-MONOMER locus_tag OGMAPBJC_00239 note conserved protein product hypothetical protein 276955 277884 CDS gene yebZ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7013-MONOMER locus_tag OGMAPBJC_00240 product putative resistance protein 277939 278619 CDS gene yedW_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_00241 product putative DNA-binding response regulator in two-component system with YedV 278616 280016 CDS EC_number 2.7.-.- gene sasA inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01837 locus_tag OGMAPBJC_00242 product Adaptive-response sensory-kinase SasA 280234 280668 CDS gene pcoE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q47459 locus_tag OGMAPBJC_00243 product putative copper-binding protein PcoE 282380 281328 CDS gene yhiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2489 locus_tag OGMAPBJC_00244 product inner membrane protein with a role in acid resistance 282763 284001 CDS gene yhiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12227-MONOMER locus_tag OGMAPBJC_00245 product putative protein 283998 284369 CDS gene yhiJ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12225-MONOMER locus_tag OGMAPBJC_00246 product putative protein 284631 286253 CDS gene yhiJ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12225-MONOMER locus_tag OGMAPBJC_00247 product putative protein 286619 287686 CDS gene yhiI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12224-MONOMER locus_tag OGMAPBJC_00248 product putative HlyD family secretion protein 287683 290418 CDS gene rbbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHIH-MONOMER locus_tag OGMAPBJC_00249 product ribosome-associated ATPase 290418 291542 CDS gene yhhJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHHJ-MONOMER locus_tag OGMAPBJC_00250 product putative transporter subunit: membrane component of ABC superfamily protein 292843 291707 CDS gene yhhI_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11525-MONOMER locus_tag OGMAPBJC_00251 product putative transposase 293334 293089 CDS gene yibA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11187-MONOMER locus_tag OGMAPBJC_00252 product putative lyase containing HEAT-repeat protein 293705 293439 CDS gene yhhH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11520-MONOMER locus_tag OGMAPBJC_00253 product putative protein 298025 293790 CDS gene rhsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10847-MONOMER locus_tag OGMAPBJC_00254 product RhsB protein in rhs element 298629 298228 CDS gene nikR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11519-MONOMER locus_tag OGMAPBJC_00255 product NikR DNA-binding transcriptional repressor, Ni-binding 299441 298635 CDS EC_number 3.6.3.24 gene nikE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIKE-MONOMER locus_tag OGMAPBJC_00256 product nickel ABC transporter - ATP binding subunit 300202 299438 CDS EC_number 3.6.3.24 gene nikD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIKD-MONOMER locus_tag OGMAPBJC_00257 product nickel ABC transporter - ATP binding subunit 301035 300202 CDS gene nikC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIKC-MONOMER locus_tag OGMAPBJC_00258 product nickel ABC transporter - membrane subunit 301976 301032 CDS gene nikB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIKB-MONOMER locus_tag OGMAPBJC_00259 product nickel ABC transporter - membrane subunit 303550 301976 CDS gene nikA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIKA-MONOMER locus_tag OGMAPBJC_00260 product nickel ABC transporter - periplasmic binding protein 304248 303661 CDS gene acpT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12221-MONOMER locus_tag OGMAPBJC_00261 product holo-[acyl carrier protein] synthase 2 305352 304303 CDS gene yhhT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12220-MONOMER locus_tag OGMAPBJC_00262 product putative inner membrane protein 305451 306701 CDS gene yhhS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHHS-MONOMER locus_tag OGMAPBJC_00263 product putative transport protein YhhS 307262 306705 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7767-MONOMER locus_tag OGMAPBJC_00264 note conserved protein involved in bacteriophage adsorption product hypothetical protein 308000 307335 CDS gene yhhQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12217-MONOMER locus_tag OGMAPBJC_00265 product hypothetical protein; gene is a predicted member of the purine regulon 308221 308466 CDS gene tusA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12216-MONOMER locus_tag OGMAPBJC_00266 product sulfur transfer protein 310766 308568 CDS EC_number 3.6.3.5 gene zntA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHHO-MONOMER locus_tag OGMAPBJC_00267 product zinc, cadmium and lead efflux system 311466 310840 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12214-MONOMER locus_tag OGMAPBJC_00268 note conserved inner membrane enzyme product hypothetical protein 311607 311966 CDS gene yhhM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12213-MONOMER locus_tag OGMAPBJC_00269 product putative receptor 312238 311969 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12212-MONOMER locus_tag OGMAPBJC_00270 note conserved inner membrane protein product hypothetical protein 312824 312228 CDS EC_number 2.1.1.171 gene rsmD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10343-MONOMER locus_tag OGMAPBJC_00271 product 16S rRNA m2G966 methyltransferase 312974 314470 CDS gene ftsY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10346-MONOMER locus_tag OGMAPBJC_00272 product SRP receptor 314473 315141 CDS gene ftsE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FTSE-MONOMER locus_tag OGMAPBJC_00273 product cell division protein FtsE 315134 316192 CDS gene ftsX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FTSX-MONOMER locus_tag OGMAPBJC_00274 product cell division protein FtsX 316437 317291 CDS gene rpoH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOH-MONOMER locus_tag OGMAPBJC_00275 product RNA polymerase, sigma 32 (sigma H) factor 317562 318665 CDS gene livJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIVJ-MONOMER locus_tag OGMAPBJC_00276 product branched chain amino acid ABC transporter - periplasmic binding protein 319248 318865 CDS gene yhhK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12211-MONOMER locus_tag OGMAPBJC_00277 product putative maturation factor for PanD 319672 320781 CDS gene livK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIVK-MONOMER locus_tag OGMAPBJC_00278 product leucine ABC transporter - periplasmic binding protein 320829 321755 CDS gene livH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIVH-MONOMER locus_tag OGMAPBJC_00279 product branched chain amino acid transporter - membrane subunit 321752 323029 CDS gene livM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIVM-MONOMER locus_tag OGMAPBJC_00280 product branched chain amino acid transporter - membrane subunit 323026 323793 CDS gene livG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIVG-MONOMER locus_tag OGMAPBJC_00281 product branched chain amino acid transporter - ATP binding subunit 323795 324508 CDS gene livF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIVF-MONOMER locus_tag OGMAPBJC_00282 product branched chain amino acid ABC transporter - ATP binding subunit 324905 326221 CDS gene ugpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UGPB-MONOMER locus_tag OGMAPBJC_00283 product glycerol-3-phosphate / glycerol-2-phosphate ABC transporter - putative periplasmic binding protein 326319 327206 CDS gene ugpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UGPA-MONOMER locus_tag OGMAPBJC_00284 product glycerol-3-phosphate / glycerol-2-phosphate ABC transporter - putative membrane subunit 327203 328048 CDS gene ugpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UGPE-MONOMER locus_tag OGMAPBJC_00285 product glycerol-3-phosphate / glycerol-2-phosphate ABC transporter - putative membrane subunit 328050 329120 CDS EC_number 3.6.3.20 gene ugpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UGPC-MONOMER locus_tag OGMAPBJC_00286 product glycerol-3-phosphate / glycerol-2-phosphate ABC transporter - putative ATP binding subunit 329117 329860 CDS EC_number 3.1.4.46 gene ugpQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCPDIESTER-CYTO-MONOMER locus_tag OGMAPBJC_00287 product glycerophosphodiester phosphodiesterase, cytosolic 330287 329847 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11184-MONOMER locus_tag OGMAPBJC_00288 note conserved protein product hypothetical protein 330407 332149 CDS EC_number 3.4.19.13 db_xref COG:COG0405 gene ggt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P18956 locus_tag OGMAPBJC_00289 product Glutathione hydrolase proenzyme 332471 332187 CDS gene yrhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7763-MONOMER locus_tag OGMAPBJC_00290 product putative protein with chaperone-like activity 332826 332671 CDS gene yrhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2826 locus_tag OGMAPBJC_00291 product hypothetical protein 333415 332921 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00292 product hypothetical protein 334590 333412 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7759-MONOMER locus_tag OGMAPBJC_00293 note conserved protein product hypothetical protein 335315 334827 CDS gene yhhY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7758-MONOMER locus_tag OGMAPBJC_00294 product putative acetyltransferase 335648 336685 CDS gene yhhX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7757-MONOMER locus_tag OGMAPBJC_00295 product putative oxidoreductase with NAD(P)-binding Rossmann-fold domain protein 336808 337503 CDS EC_number 1.13.11.24 gene yhhW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7756-MONOMER locus_tag OGMAPBJC_00296 product pirin-like protein 337727 338722 CDS gene gntR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03585 locus_tag OGMAPBJC_00297 product GntR DNA-binding transcriptional repressor 338861 339388 CDS EC_number 2.7.1.12 gene gntK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUCONOKINII-MONOMER locus_tag OGMAPBJC_00298 product D-gluconate kinase, thermostable 339392 340732 CDS gene gntU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GNTU-MONOMER locus_tag OGMAPBJC_00299 product gluconate transporter GntU 341382 340789 CDS gene yhgN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7753-MONOMER locus_tag OGMAPBJC_00300 product putative inner membrane protein 341575 342678 CDS EC_number 1.2.1.11 gene asd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASP-SEMIALDEHYDE-DEHYDROGENASE-MONOMER locus_tag OGMAPBJC_00301 product aspartate semialdehyde dehydrogenase 342951 345137 CDS EC_number 2.4.1.18 gene glgB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCOGEN-BRANCH-MONOMER locus_tag OGMAPBJC_00302 product 1,4-alpha-glucan branching enzyme 345134 347107 CDS gene glgX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10381-MONOMER locus_tag OGMAPBJC_00303 product glycogen phosphorylase-limit dextrin alpha-1,6-glucohydrolase 347125 348420 CDS EC_number 2.7.7.27 gene glgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUC1PADENYLTRANS-MONOMER locus_tag OGMAPBJC_00304 product glucose-1-phosphate adenylyltransferase 348420 349853 CDS EC_number 2.4.1.21 gene glgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCOGENSYN-MONOMER locus_tag OGMAPBJC_00305 product glycogen synthase 349872 352319 CDS gene glgP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCOPHOSPHORYL-MONOMER locus_tag OGMAPBJC_00306 product glycogen phosphorylase 352448 352729 CDS gene yzgL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7752-MONOMER locus_tag OGMAPBJC_00307 product putative protein 354440 352935 CDS EC_number 1.1.5.3 gene glpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AERGLYC3PDEHYDROG-MONOMER locus_tag OGMAPBJC_00308 product glycerol-3-phosphate dehydrogenase, aerobic 354630 354956 CDS EC_number 2.8.1.1 gene glpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10395-MONOMER locus_tag OGMAPBJC_00309 product thiosulfate sulfurtransferase 355001 355831 CDS gene glpG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10397-MONOMER locus_tag OGMAPBJC_00310 product intramembrane serine protease GlpG 355848 356606 CDS gene glpR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03576 locus_tag OGMAPBJC_00311 product GlpR DNA-binding transcriptional repressor 358186 356588 CDS gene rtcR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12356-MONOMER locus_tag OGMAPBJC_00312 product RtcR DNA-binding transcriptional activator 358375 359601 CDS gene rtcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7751-MONOMER locus_tag OGMAPBJC_00313 product RNA ligase 359605 360621 CDS EC_number 6.5.1.4 gene rtcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7750-MONOMER locus_tag OGMAPBJC_00314 product RNA 3'-terminal phosphate cyclase 363369 360664 CDS gene malT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00237 locus_tag OGMAPBJC_00315 product MalT transcriptional activator 363980 366373 CDS gene malP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALDEXPHOSPHORYL-MONOMER locus_tag OGMAPBJC_00316 product maltodextrin phosphorylase monomer 366383 368467 CDS EC_number 2.4.1.25 gene malQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AMYLOMALT-MONOMER locus_tag OGMAPBJC_00317 product amylomaltase 369894 368578 CDS gene gntT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GNTT-MONOMER locus_tag OGMAPBJC_00318 product gluconate transporter GntT 370829 370254 CDS gene nfuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7748-MONOMER locus_tag OGMAPBJC_00319 product iron-sulfur cluster scaffold protein 371571 370888 CDS gene gntX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7747-MONOMER locus_tag OGMAPBJC_00320 product protein involved in utilization of DNA as a carbon source 371609 372379 CDS gene bioH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10122-MONOMER locus_tag OGMAPBJC_00321 product pimeloyl-[acp] methyl ester esterase 373286 372408 CDS gene yhgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11750-MONOMER locus_tag OGMAPBJC_00322 product putative transposase 373725 373489 CDS gene feoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12933-MONOMER locus_tag OGMAPBJC_00323 product putative DNA-binding transcriptional regulator 376046 373725 CDS gene feoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FEOB-MONOMER locus_tag OGMAPBJC_00324 product Fe(2+) transporter FeoB 376290 376063 CDS gene feoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12101-MONOMER locus_tag OGMAPBJC_00325 product ferrous iron transport protein A 379068 376747 CDS gene yhgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7746-MONOMER locus_tag OGMAPBJC_00326 product putative transcriptional accessory protein 379641 379165 CDS gene greB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11578-MONOMER locus_tag OGMAPBJC_00327 product transcription elongation factor GreB 379869 380588 CDS gene torR_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TORR-MONOMER locus_tag OGMAPBJC_00328 product TorR transcriptional dual regulator 380585 381937 CDS gene envZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ENVZ-MONOMER locus_tag OGMAPBJC_00329 product EnvZ sensory histidine kinase 383635 382013 CDS EC_number 4.1.1.49 gene pck inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PEPCARBOXYKIN-MONOMER locus_tag OGMAPBJC_00330 product phosphoenolpyruvate carboxykinase (ATP) 384014 385738 CDS gene yhgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7745-MONOMER locus_tag OGMAPBJC_00331 product putative transport protein 386679 385801 CDS gene hslO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7744-MONOMER locus_tag OGMAPBJC_00332 product molecular chaperone Hsp33 387105 386704 CDS gene hslR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7743-MONOMER locus_tag OGMAPBJC_00333 product heat shock protein Hsp15 involved in ribosome recycling 387784 387116 CDS gene yrfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7742-MONOMER locus_tag OGMAPBJC_00334 product purine nucleotidase 389984 387849 CDS gene yrfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7741-MONOMER locus_tag OGMAPBJC_00335 product putative dehydrogenase 390304 390864 CDS gene nudE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7740-MONOMER locus_tag OGMAPBJC_00336 product ADP-sugar pyrophosphorylase 393582 391030 CDS gene mrcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10748-MONOMER locus_tag OGMAPBJC_00337 product peptidoglycan synthetase; penicillin-binding protein 1A 393702 394481 CDS gene hofM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7739-MONOMER locus_tag OGMAPBJC_00338 product protein involved in utilization of DNA as a carbon source 394481 395020 CDS gene hofN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7738-MONOMER locus_tag OGMAPBJC_00339 product protein involved in utilization of DNA as a carbon source 395004 395444 CDS gene hofO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7737-MONOMER locus_tag OGMAPBJC_00340 product protein involved in utilization of DNA as a carbon source 395434 395838 CDS gene hofP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7736-MONOMER locus_tag OGMAPBJC_00341 product protein involved in utilization of DNA as a carbon source 395780 396988 CDS gene hofQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12113-MONOMER locus_tag OGMAPBJC_00342 product protein involved in utilization of DNA as a carbon source 397389 397910 CDS EC_number 2.7.1.71 gene aroK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROK-MONOMER locus_tag OGMAPBJC_00343 product shikimate kinase I 397967 399055 CDS EC_number 4.2.3.4 gene aroB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROB-MONOMER locus_tag OGMAPBJC_00344 product 3-dehydroquinate synthase 399147 400433 CDS gene damX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11183-MONOMER locus_tag OGMAPBJC_00345 product cell division protein DamX 400540 401376 CDS EC_number 2.1.1.72 gene dam inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10204-MONOMER locus_tag OGMAPBJC_00346 product DNA adenine methyltransferase 401394 402071 CDS EC_number 5.1.3.1 gene rpe inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBULP3EPIM-MONOMER locus_tag OGMAPBJC_00347 product ribulose-5-phosphate 3-epimerase 402064 402822 CDS EC_number 3.1.3.18 gene gph inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GPH-MONOMER locus_tag OGMAPBJC_00348 product phosphoglycolate phosphatase 402815 403819 CDS EC_number 6.1.1.2 gene trpS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRPS-MONOMER locus_tag OGMAPBJC_00349 product tryptophanyl-tRNA synthetase 404109 405005 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7735-MONOMER locus_tag OGMAPBJC_00350 note conserved protein product hypothetical protein 405035 405952 CDS db_xref COG:COG3039 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISEc35 locus_tag OGMAPBJC_00351 product IS5 family transposase ISEc35 406171 406533 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7734-MONOMER locus_tag OGMAPBJC_00352 note conserved protein product hypothetical protein 406617 407780 CDS gene yhfX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7733-MONOMER locus_tag OGMAPBJC_00353 product putative amino acid racemase 407780 409006 CDS gene yhfW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7732-MONOMER locus_tag OGMAPBJC_00354 product putative mutase 409003 409881 CDS gene php_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7731-MONOMER locus_tag OGMAPBJC_00355 product putative hydrolase 409892 410245 CDS gene yhfU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7730-MONOMER locus_tag OGMAPBJC_00356 product putative protein 410257 411561 CDS gene yhfT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7729-MONOMER locus_tag OGMAPBJC_00357 product putative inner membrane protein 411573 412658 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7728-MONOMER locus_tag OGMAPBJC_00358 note conserved protein product hypothetical protein 413541 412810 CDS gene frlR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7727-MONOMER locus_tag OGMAPBJC_00359 product putative DNA-binding transcriptional regulator 414426 413641 CDS gene frlD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7726-MONOMER locus_tag OGMAPBJC_00360 product fructoselysine 6-kinase 415253 414423 CDS gene frlC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7724-MONOMER locus_tag OGMAPBJC_00361 product fructoselysine 3-epimerase 416325 415303 CDS gene frlB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7723-MONOMER locus_tag OGMAPBJC_00362 product fructoselysine 6-phosphate deglycase monomer 417683 416346 CDS gene frlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHFM-MONOMER locus_tag OGMAPBJC_00363 product fructoselysine / psicoselysine transporter 418145 417978 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7722-MONOMER locus_tag OGMAPBJC_00364 note conserved secreted peptide product hypothetical protein 419765 418392 CDS EC_number 4.99.1.4 gene cysG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SIROHEMESYN-MONOMER locus_tag OGMAPBJC_00365 product uroporphyrin III C-methyltransferase [multifunctional] 420590 419784 CDS gene nirC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIRC-MONOMER locus_tag OGMAPBJC_00366 product nitrite transporter NirC 421042 420716 CDS EC_number 1.7.1.4 gene nirD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIRD-MONOMER locus_tag OGMAPBJC_00367 product nitrite reductase, small subunit 423582 421039 CDS EC_number 1.7.1.4 gene nirB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NIRB-MONOMER locus_tag OGMAPBJC_00368 product nitrite reductase, large subunit 425025 423844 CDS gene tsgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHFC-MONOMER locus_tag OGMAPBJC_00369 product YhfC MFS transporter 425296 425868 CDS EC_number 5.2.1.8 gene ppiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10757-MONOMER locus_tag OGMAPBJC_00370 product peptidyl-prolyl cis-trans isomerase A (rotamase A) 425973 426140 CDS gene yhfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12374-MONOMER locus_tag OGMAPBJC_00371 product putative protein 426130 426732 CDS EC_number 2.7.7 gene fic inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10307-MONOMER locus_tag OGMAPBJC_00372 product stationary-phase protein with possible role in p-aminobenzoate or folate biosynthesis 426764 427327 CDS EC_number 2.6.1.85 gene pabA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PABASYN-COMPII-MONOMER locus_tag OGMAPBJC_00373 product para-aminobenzoate synthase multi-enzyme complex 427413 428633 CDS EC_number 2.6.1.17 gene argD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETYLORNTRANSAM-MONOMER locus_tag OGMAPBJC_00374 product N-succinyldiaminopimelate-aminotransferase / acetylornithine transaminase 430790 428700 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7721-MONOMER locus_tag OGMAPBJC_00375 note conserved inner membrane protein product hypothetical protein 431473 430841 CDS gene crp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00257 locus_tag OGMAPBJC_00376 product CRP transcriptional dual regulator 431775 432179 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11182-MONOMER locus_tag OGMAPBJC_00377 note conserved protein product hypothetical protein 433103 432234 CDS EC_number 2.7.1.19 gene prkB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12365-MONOMER locus_tag OGMAPBJC_00378 product putative phosphoribulokinase 433375 433157 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7719-MONOMER locus_tag OGMAPBJC_00379 note conserved protein product hypothetical protein 434391 433369 CDS gene yheT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7718-MONOMER locus_tag OGMAPBJC_00380 product putative hydrolase 436304 434391 CDS gene yheS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHES-MONOMER locus_tag OGMAPBJC_00381 product fused predicted transporter subunits of ABC superfamily: ATP-binding components 436435 436986 CDS gene kefG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7717-MONOMER locus_tag OGMAPBJC_00382 product protein required for KefB activity 436986 438791 CDS gene kefB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KEFB-MONOMER locus_tag OGMAPBJC_00383 product K+ : H+ antiporter KefB 438801 439001 CDS gene yheV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2688 locus_tag OGMAPBJC_00384 product putative protein 439096 439686 CDS EC_number 5.2.1.8 gene slyD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11663-MONOMER locus_tag OGMAPBJC_00385 product FKBP-type peptidyl prolyl cis-trans isomerase 439953 439735 CDS gene slyX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11664-MONOMER locus_tag OGMAPBJC_00386 product host factor for lysis of phX174 infection 440174 440986 CDS EC_number 5.2.1.8 gene fkpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7716-MONOMER locus_tag OGMAPBJC_00387 product peptidyl-prolyl cis-trans isomerase; in protein folding 441153 441875 CDS gene yheO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7715-MONOMER locus_tag OGMAPBJC_00388 product putative DNA-binding transcriptional regulator 441875 442261 CDS gene tusD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7714-MONOMER locus_tag OGMAPBJC_00389 product sulfur transfer protein complex, TusD subunit 442261 442620 CDS gene tusC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7713-MONOMER locus_tag OGMAPBJC_00390 product sulfur transfer protein complex, TusC subunit 442628 442915 CDS gene tusB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7712-MONOMER locus_tag OGMAPBJC_00391 product sulfur transfer protein complex, TusB subunit 443041 443415 CDS gene rpsL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10911-MONOMER locus_tag OGMAPBJC_00392 product 30S ribosomal subunit protein S12 443512 443982 CDS gene rpsG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10906-MONOMER locus_tag OGMAPBJC_00393 product 30S ribosomal subunit protein S7 444079 446193 CDS gene fusA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10360-MONOMER locus_tag OGMAPBJC_00394 product elongation factor G 446264 447448 CDS gene tufA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11036-MONOMER locus_tag OGMAPBJC_00395 product elongation factor Tu 447740 450433 CDS EC_number 3.2.1.17 gene chiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11237-MONOMER locus_tag OGMAPBJC_00396 product endochitinase 450602 450796 CDS gene bfd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11181-MONOMER locus_tag OGMAPBJC_00397 product bacterioferritin-associated ferredoxin 450868 451344 CDS EC_number 1.16.3.1 gene bfr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10113-MONOMER locus_tag OGMAPBJC_00398 product bacterioferritin monomer 452050 451373 CDS gene gspO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11359-MONOMER locus_tag OGMAPBJC_00399 product leader peptidase, integral membrane protein 452511 452050 CDS gene gspM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12173-MONOMER locus_tag OGMAPBJC_00400 product putative protein secretion protein 453671 452508 CDS gene gspL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7711-MONOMER locus_tag OGMAPBJC_00401 product putative protein secretion protein for export 454669 453686 CDS gene gspK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7710-MONOMER locus_tag OGMAPBJC_00402 product putative protein secretion protein for export 455249 454662 CDS gene gspJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7709-MONOMER locus_tag OGMAPBJC_00403 product putative protein secretion protein for export 455619 455242 CDS gene gspI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7708-MONOMER locus_tag OGMAPBJC_00404 product putative protein secretion protein for export 456125 455616 CDS gene gspH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7707-MONOMER locus_tag OGMAPBJC_00405 product putative protein secretion protein for export 456570 456133 CDS gene gspG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7706-MONOMER locus_tag OGMAPBJC_00406 product putative protein secretion protein for export 457776 456580 CDS gene gspF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7705-MONOMER locus_tag OGMAPBJC_00407 product putative protein secretion protein for export 459254 457773 CDS gene gspE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7704-MONOMER locus_tag OGMAPBJC_00408 product putative protein secretion protein for export 461216 459264 CDS gene gspD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7703-MONOMER locus_tag OGMAPBJC_00409 product putative protein secretion protein for export 462015 461200 CDS gene gspC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7702-MONOMER locus_tag OGMAPBJC_00410 product putative protein secretion protein for export 462195 463664 CDS gene gspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7701-MONOMER locus_tag OGMAPBJC_00411 product general secretory pathway component, cryptic 463666 464085 CDS gene gspB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11263-MONOMER locus_tag OGMAPBJC_00412 product calcium-binding protein required for initiation of chromosome replication 464323 464634 CDS gene rpsJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10909-MONOMER locus_tag OGMAPBJC_00413 product 30S ribosomal subunit protein S10 464667 465296 CDS gene rplC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10866-MONOMER locus_tag OGMAPBJC_00414 product 50S ribosomal subunit protein L3 465307 465912 CDS gene rplD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10867-MONOMER locus_tag OGMAPBJC_00415 product 50S ribosomal subunit protein L4 465909 466211 CDS gene rplW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10883-MONOMER locus_tag OGMAPBJC_00416 product 50S ribosomal subunit protein L23 466229 467050 CDS gene rplB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10865-MONOMER locus_tag OGMAPBJC_00417 product 50S ribosomal subunit protein L2 467067 467345 CDS gene rpsS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10918-MONOMER locus_tag OGMAPBJC_00418 product 30S ribosomal subunit protein S19 467360 467692 CDS gene rplV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10882-MONOMER locus_tag OGMAPBJC_00419 product 50S ribosomal subunit protein L22 467710 468411 CDS gene rpsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10902-MONOMER locus_tag OGMAPBJC_00420 product 30S ribosomal subunit protein S3 468424 468834 CDS gene rplP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10877-MONOMER locus_tag OGMAPBJC_00421 product 50S ribosomal subunit protein L16 468834 469025 CDS gene rpmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10887-MONOMER locus_tag OGMAPBJC_00422 product 50S ribosomal subunit protein L29 469025 469279 CDS gene rpsQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10916-MONOMER locus_tag OGMAPBJC_00423 product 30S ribosomal subunit protein S17 469444 469815 CDS gene rplN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10875-MONOMER locus_tag OGMAPBJC_00424 product 50S ribosomal subunit protein L14 469826 470140 CDS gene rplX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10884-MONOMER locus_tag OGMAPBJC_00425 product 50S ribosomal subunit protein L24 470155 470694 CDS gene rplE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10868-MONOMER locus_tag OGMAPBJC_00426 product 50S ribosomal subunit protein L5 470709 471014 CDS gene rpsN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10913-MONOMER locus_tag OGMAPBJC_00427 product 30S ribosomal subunit protein S14 471048 471440 CDS gene rpsH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10907-MONOMER locus_tag OGMAPBJC_00428 product 30S ribosomal subunit protein S8 471453 471986 CDS gene rplF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10869-MONOMER locus_tag OGMAPBJC_00429 product 50S ribosomal subunit protein L6 471996 472349 CDS gene rplR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10879-MONOMER locus_tag OGMAPBJC_00430 product 50S ribosomal subunit protein L18 472364 472867 CDS gene rpsE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10904-MONOMER locus_tag OGMAPBJC_00431 product 30S ribosomal subunit protein S5 472871 473050 CDS gene rpmD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10888-MONOMER locus_tag OGMAPBJC_00432 product 50S ribosomal subunit protein L30 473054 473488 CDS gene rplO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10876-MONOMER locus_tag OGMAPBJC_00433 product 50S ribosomal subunit protein L15 473496 474827 CDS gene secY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECY locus_tag OGMAPBJC_00434 product Sec Translocation Complex 474859 474975 CDS gene rpmJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11232-MONOMER locus_tag OGMAPBJC_00435 product 50S ribosomal subunit protein L36 475122 475478 CDS gene rpsM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10912-MONOMER locus_tag OGMAPBJC_00436 product 30S ribosomal subunit protein S13 475495 475884 CDS gene rpsK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10910-MONOMER locus_tag OGMAPBJC_00437 product 30S ribosomal subunit protein S11 475918 476538 CDS gene rpsD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10903-MONOMER locus_tag OGMAPBJC_00438 product 30S ribosomal subunit protein S4 476564 477553 CDS EC_number 2.7.7.6 gene rpoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10893-MONOMER locus_tag OGMAPBJC_00439 product RNA polymerase, alpha subunit 477594 477977 CDS gene rplQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10878-MONOMER locus_tag OGMAPBJC_00440 product 50S ribosomal subunit protein L17 478084 478452 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11970-MONOMER locus_tag OGMAPBJC_00441 note conserved protein product hypothetical protein 478463 478888 CDS gene zntR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11969-MONOMER locus_tag OGMAPBJC_00442 product ZntR transcriptional activator 478944 479162 CDS gene arfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2687 locus_tag OGMAPBJC_00443 product ribosome rescue factor 479569 479159 CDS gene mscL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11180-MONOMER locus_tag OGMAPBJC_00444 product mechanosensitive channel MscL 481075 479699 CDS gene trkA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRKA-MONOMER locus_tag OGMAPBJC_00445 product NAD-binding component of TrK potassium transporter 482386 481097 CDS gene rsmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12163-MONOMER locus_tag OGMAPBJC_00446 product 16S rRNA m5C967 methyltransferase 483379 482432 CDS EC_number 2.1.2.9 gene fmt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11268-MONOMER locus_tag OGMAPBJC_00447 product 10-formyltetrahydrofolate:L-methionyl-tRNAfMet N-formyltransferase 483903 483394 CDS EC_number 3.5.1.88 gene def inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11440-MONOMER locus_tag OGMAPBJC_00448 product peptide deformylase 484033 485157 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11604-MONOMER locus_tag OGMAPBJC_00449 note conserved protein product hypothetical protein 485129 485602 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11605-MONOMER locus_tag OGMAPBJC_00450 note conserved protein product hypothetical protein 485631 486173 CDS gene yrdD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7699-MONOMER locus_tag OGMAPBJC_00451 product putative DNA topoisomerase 486178 486750 CDS gene tsaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7698-MONOMER locus_tag OGMAPBJC_00452 product protein involved in synthesis of threonylcarbamoyladenosine-modified tRNA 486755 487573 CDS EC_number 1.1.1.25 gene aroE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROE-MONOMER locus_tag OGMAPBJC_00453 product shikimate dehydrogenase 487570 487827 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7697-MONOMER locus_tag OGMAPBJC_00454 note conserved protein product hypothetical protein 488357 487803 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7696-MONOMER locus_tag OGMAPBJC_00455 note conserved protein product hypothetical protein 488834 490371 rRNA locus_tag OGMAPBJC_00456 product 16S ribosomal RNA score 0 490441 490517 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00457 product tRNA-Ile(gat) 490560 490635 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00458 product tRNA-Ala(tgc) 490812 493712 rRNA locus_tag OGMAPBJC_00459 product 23S ribosomal RNA score 0 493810 493920 rRNA locus_tag OGMAPBJC_00460 product 5S ribosomal RNA score 7e-12 493938 494013 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00461 product tRNA-Thr(ggt) 494055 494165 rRNA locus_tag OGMAPBJC_00462 product 5S ribosomal RNA score 4.4e-11 495157 494399 CDS gene yhdZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHDZ-MONOMER locus_tag OGMAPBJC_00463 product YhdW/YhdX/YhdY/YhdZ ABC transporter 496268 495165 CDS gene yhdY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHDY-MONOMER locus_tag OGMAPBJC_00464 product YhdW/YhdX/YhdY/YhdZ ABC transporter 497459 496278 CDS gene yhdX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHDX-MONOMER locus_tag OGMAPBJC_00465 product YhdW/YhdX/YhdY/YhdZ ABC transporter 498552 497527 CDS gene yhdW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHDW-MONOMER locus_tag OGMAPBJC_00466 product YhdW/YhdX/YhdY/YhdZ ABC transporter 499204 498983 CDS gene yhdV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7695-MONOMER locus_tag OGMAPBJC_00467 product putative outer membrane lipoprotein 499310 499600 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00468 product hypothetical protein 502561 499457 CDS gene acrF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACRF-MONOMER locus_tag OGMAPBJC_00469 product AcrEF-TolC multidrug efflux transport system - permease subunit 503730 502573 CDS gene acrE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10266-MONOMER locus_tag OGMAPBJC_00470 product AcrEF-TolC multidrug efflux transport system - membrane fusion protein 504129 504791 CDS gene envR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11741-MONOMER locus_tag OGMAPBJC_00471 product EnvR DNA-binding transcriptional repressor 504973 504794 CDS gene yhdU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7694-MONOMER locus_tag OGMAPBJC_00472 product putative membrane protein 505941 505057 CDS EC_number 2.1.1.72 gene yhdJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11498-MONOMER locus_tag OGMAPBJC_00473 product DNA adenine methyltransferase 506323 506027 CDS gene fis inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00196 locus_tag OGMAPBJC_00474 product Fis DNA-binding transcriptional dual regulator 507209 506349 CDS gene dusB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11311-MONOMER locus_tag OGMAPBJC_00475 product tRNA-dihydrouridine synthase B 508524 507643 CDS gene prmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11497-MONOMER locus_tag OGMAPBJC_00476 product methyltransferase for 50S ribosomal subunit protein L11 509987 508536 CDS gene panF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PANF-MONOMER locus_tag OGMAPBJC_00477 product pantothenate:Na+ symporter 510219 509977 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7693-MONOMER locus_tag OGMAPBJC_00478 note conserved inner membrane protein product hypothetical protein 511677 510328 CDS EC_number 6.4.1.2 gene accC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BIOTIN-CARBOXYL-MONOMER locus_tag OGMAPBJC_00479 product acetyl-CoA carboxylase 512158 511688 CDS db_xref COG:COG0511 gene accB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0ABD8 locus_tag OGMAPBJC_00480 product Biotin carboxyl carrier protein of acetyl-CoA carboxylase 514110 513136 CDS gene yhdH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11315-MONOMER locus_tag OGMAPBJC_00481 product putative oxidoreductase, NAD(P)-binding 514262 516202 CDS gene csrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10018-MONOMER locus_tag OGMAPBJC_00482 product regulator of CsrB and CsrC decay 516507 517550 CDS gene mreB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10608-MONOMER locus_tag OGMAPBJC_00483 product longitudinal peptidoglycan synthesis/chromosome segregation-directing complex 517616 518719 CDS gene mreC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10609-MONOMER locus_tag OGMAPBJC_00484 product longitudinal peptidoglycan synthesis/chromosome segregation-directing complex 518719 519207 CDS gene mreD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10610-MONOMER locus_tag OGMAPBJC_00485 product longitudinal peptidoglycan synthesis/chromosome segregation-directing complex 519216 519809 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11298-MONOMER locus_tag OGMAPBJC_00486 note conserved protein product hypothetical protein 519799 521268 CDS gene rng inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11299-MONOMER locus_tag OGMAPBJC_00487 product ribonuclease G (RNAse G) monomer 521336 525136 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7690-MONOMER locus_tag OGMAPBJC_00488 note conserved membrane protein, predicted transporter product hypothetical protein 525566 527011 CDS gene tldD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7689-MONOMER locus_tag OGMAPBJC_00489 product protease involved in Microcin B17 maturation and in sensitivity to the DNA gyrase inhibitor LetD 528074 527145 CDS gene aaeR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7688-MONOMER locus_tag OGMAPBJC_00490 product quorum sensing transcriptional regulator of LYSR-type 528257 528460 CDS gene aaeX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7687-MONOMER locus_tag OGMAPBJC_00491 product hypothetical protein 528468 529400 CDS gene aaeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7686-MONOMER locus_tag OGMAPBJC_00492 product hydroxylated, aromatic carboxylic acid efflux transporter - putative membrane fusion protein 529406 531373 CDS gene aaeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7685-MONOMER locus_tag OGMAPBJC_00493 product hydroxylated, aromatic carboxylic acid efflux transporter - putative membrane subunit 531465 531737 CDS gene yhcO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7684-MONOMER locus_tag OGMAPBJC_00494 product putative barnase inhibitor 532056 531793 CDS gene yhcN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7683-MONOMER locus_tag OGMAPBJC_00495 product stress-induced protein 532891 532421 CDS gene argR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00194 locus_tag OGMAPBJC_00496 product ArgR-arg 533326 534264 CDS EC_number 1.1.1.37 gene mdh inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALATE-DEHASE-MONOMER locus_tag OGMAPBJC_00497 product malate dehydrogenase 535394 534327 CDS gene degS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11652-MONOMER locus_tag OGMAPBJC_00498 product DegS serine endoprotease 536851 535484 CDS gene degQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7682-MONOMER locus_tag OGMAPBJC_00499 product serine endoprotease, periplasmic 537403 537005 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7681-MONOMER locus_tag OGMAPBJC_00500 note conserved protein product hypothetical protein 537597 538724 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7680-MONOMER locus_tag OGMAPBJC_00501 note conserved protein with nucleoside triphosphate hydrolase domain product hypothetical protein 538943 539371 CDS gene rplM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10874-MONOMER locus_tag OGMAPBJC_00502 product 50S ribosomal subunit protein L13 539387 539779 CDS gene rpsI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10908-MONOMER locus_tag OGMAPBJC_00503 product 30S ribosomal subunit protein S9 540174 540812 CDS gene sspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10977-MONOMER locus_tag OGMAPBJC_00504 product stringent starvation protein A 540818 541315 CDS gene sspB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10978-MONOMER locus_tag OGMAPBJC_00505 product ClpXP protease specificity-enhancing factor 542725 541358 CDS gene dcuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHCL-MONOMER locus_tag OGMAPBJC_00506 product YhcL DcuC transporter 543105 543896 CDS gene nanR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7678-MONOMER locus_tag OGMAPBJC_00507 product NanR DNA-binding transcriptional dual regulator 544018 544911 CDS EC_number 4.1.3.3 gene nanA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACNEULY-MONOMER locus_tag OGMAPBJC_00508 product N-acetylneuraminate lyase 545020 546510 CDS gene nanT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NANT-MONOMER locus_tag OGMAPBJC_00509 product N-acetylneuraminate:H+ symporter 546558 547247 CDS EC_number 5.1.3.9 gene nanE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NANE-MONOMER locus_tag OGMAPBJC_00510 product putative N-acetylmannosamine-6-phosphate epimerase 547244 548119 CDS EC_number 2.7.1.60 gene nanK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NANK-MONOMER locus_tag OGMAPBJC_00511 product N-acetylmannosamine kinase 548116 548580 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7675-MONOMER locus_tag OGMAPBJC_00512 note conserved protein product hypothetical protein 549767 548640 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7674-MONOMER locus_tag OGMAPBJC_00513 note conserved protein product hypothetical protein 550668 549952 CDS gene yhcF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7673-MONOMER locus_tag OGMAPBJC_00514 product putative transcriptional regulator 551210 550665 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00515 product hypothetical protein 553588 551207 CDS gene yhcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7670-MONOMER locus_tag OGMAPBJC_00516 product putative outer membrane protein 554283 553609 CDS gene yhcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11515-MONOMER locus_tag OGMAPBJC_00517 product putative periplasmic chaperone protein 554393 554289 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00518 product hypothetical protein 555219 554455 CDS gene gltF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11514-MONOMER locus_tag OGMAPBJC_00519 product periplasmic protein 557197 555779 CDS EC_number 1.4.1.13 gene gltD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUSYNSMALL-MONOMER locus_tag OGMAPBJC_00520 product glutamate synthase, small subunit 561763 557210 CDS EC_number 1.4.1.13 gene gltB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUSYNLARGE-MONOMER locus_tag OGMAPBJC_00521 product glutamate synthase, large subunit 562345 563274 CDS gene yhcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7669-MONOMER locus_tag OGMAPBJC_00522 product putative Fe-S oxidoreductase 563370 565706 CDS EC_number 2.7.13.3 db_xref COG:COG0642 gene arcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEC3 locus_tag OGMAPBJC_00523 product Aerobic respiration control sensor protein ArcB 565936 566589 CDS gene elbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11383-MONOMER locus_tag OGMAPBJC_00524 product isoprenoid biosynthesis protein with amidotransferase-like domain protein 566586 567314 CDS gene mtgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7668-MONOMER locus_tag OGMAPBJC_00525 product biosynthetic peptidoglycan transglycosylase 567943 567311 CDS gene yrbL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7667-MONOMER locus_tag OGMAPBJC_00526 product putative protein 568429 568157 CDS gene npr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12147-MONOMER locus_tag OGMAPBJC_00527 product phosphocarrier protein HPr-like NPr, nitrogen related, exchanges phosphate with Enzyme I, Hpr 569280 568426 CDS gene yhbJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12146-MONOMER locus_tag OGMAPBJC_00528 product putative P-loop containing ATPase 569817 569326 CDS gene ptsN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11682-MONOMER locus_tag OGMAPBJC_00529 product phosphotransferase system enzyme IIA, regulation of potassium transport 570222 569935 CDS gene hpf inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11681-MONOMER locus_tag OGMAPBJC_00530 product hibernation promoting factor 571678 570245 CDS gene rpoN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPON-MONOMER locus_tag OGMAPBJC_00531 product RNA polymerase, sigma 54 (sigma N) factor 572451 571726 CDS gene lptB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHBG-MONOMER locus_tag OGMAPBJC_00532 product LptABCFG ABC transporter 573015 572458 CDS gene lptA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHBN-MONOMER locus_tag OGMAPBJC_00533 product LptABCFG ABC transporter 573559 572984 CDS gene lptC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7664-MONOMER locus_tag OGMAPBJC_00534 product LptABCFG ABC transporter 574122 573556 CDS EC_number 3.1.3.45 gene kdsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7663-MONOMER locus_tag OGMAPBJC_00535 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase monomer 575129 574143 CDS EC_number 5.3.1.13 gene kdsD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7662-MONOMER locus_tag OGMAPBJC_00536 product D-arabinose 5-phosphate isomerase 576120 575143 CDS gene yrbG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YRBG-MONOMER locus_tag OGMAPBJC_00537 product inner membrane protein YrbG 576330 577139 CDS gene mlaF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YRBF-MONOMER locus_tag OGMAPBJC_00538 product phospholipid ABC transporter 577147 577929 CDS gene mlaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YRBE-MONOMER locus_tag OGMAPBJC_00539 product phospholipid ABC transporter 577934 578485 CDS gene mlaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12799-MONOMER locus_tag OGMAPBJC_00540 product phospholipid ABC transporter 578504 579139 CDS gene mlaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7659-MONOMER locus_tag OGMAPBJC_00541 product phospholipid ABC transporter 579139 579432 CDS gene mlaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7658-MONOMER locus_tag OGMAPBJC_00542 product phospholipid ABC transporter 579577 579846 CDS gene ibaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7657-MONOMER locus_tag OGMAPBJC_00543 product putative DNA-binding transcriptional regulator 579901 581160 CDS EC_number 2.5.1.7 gene murA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPNACETYLGLUCOSAMENOLPYRTRANS-MONOMER locus_tag OGMAPBJC_00544 product UDP-N-acetylglucosamine enolpyruvoyl transferase 581486 581208 CDS gene sfsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10656-MONOMER locus_tag OGMAPBJC_00545 product Nlp transcriptional regulator 582685 581714 CDS gene ispB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OPPSYN-MONOMER locus_tag OGMAPBJC_00546 product octaprenyl diphosphate synthase 582944 583255 CDS gene rplU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG50001-MONOMER locus_tag OGMAPBJC_00547 product 50S ribosomal subunit protein L21 583276 583533 CDS gene rpmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG50002-MONOMER locus_tag OGMAPBJC_00548 product 50S ribosomal subunit protein L27 583660 584625 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11499-MONOMER locus_tag OGMAPBJC_00549 note conserved inner membrane protein product hypothetical protein 584641 585813 CDS gene obgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7656-MONOMER locus_tag OGMAPBJC_00550 product GTPase involved in chromosome partitioning and ribosome assembly 587432 585999 CDS EC_number 3.4.16.4 gene dacB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10202-MONOMER locus_tag OGMAPBJC_00551 product D-alanyl-D-alanine endopeptidase 587680 588156 CDS gene greA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10415-MONOMER locus_tag OGMAPBJC_00552 product transcription elongation factor GreA 588605 588312 CDS gene yhbY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12794-MONOMER locus_tag OGMAPBJC_00553 product putative RNA-binding protein 588731 589360 CDS gene rlmE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11507-MONOMER locus_tag OGMAPBJC_00554 product 23S rRNA 2'-O-ribose methyltransferase 589451 591394 CDS gene ftsH_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11506-MONOMER locus_tag OGMAPBJC_00555 product ATP-dependent zinc metalloprotease FtsH 591484 592332 CDS EC_number 2.5.1.15 gene folP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:H2PTEROATESYNTH-MONOMER locus_tag OGMAPBJC_00556 product dihydropteroate synthase 592325 593662 CDS EC_number 5.4.2.10 gene glmM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSGLUCOSAMINEMUT-MONOMER locus_tag OGMAPBJC_00557 product phosphoglucosamine mutase 593890 594222 CDS gene secG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECG locus_tag OGMAPBJC_00558 product Sec Translocation Complex 594237 594323 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00559 product tRNA-Leu(gag) 594890 596407 CDS gene yhbX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7655-MONOMER locus_tag OGMAPBJC_00560 product putative hydrolase, inner membrane 597758 596415 CDS EC_number 6.3.4.5 gene argG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGSUCCINSYN-MONOMER locus_tag OGMAPBJC_00561 product argininosuccinate synthase 598106 598182 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00562 product tRNA-Met(cat) 598389 598841 CDS gene rimP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11179-MONOMER locus_tag OGMAPBJC_00563 product ribosome maturation protein 598869 600356 CDS gene nusA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10665-MONOMER locus_tag OGMAPBJC_00564 product transcription termination/antitermination L factor 600381 603053 CDS gene infB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10505-MONOMER locus_tag OGMAPBJC_00565 product protein chain initiation factor IF2 603217 603618 CDS gene rbfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11178-MONOMER locus_tag OGMAPBJC_00566 product 30S ribosome binding factor 603618 604562 CDS gene truB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11177-MONOMER locus_tag OGMAPBJC_00567 product tRNA pseudouridine 55 synthase 604711 604980 CDS gene rpsO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10914-MONOMER locus_tag OGMAPBJC_00568 product 30S ribosomal subunit protein S15 605226 607361 CDS EC_number 2.7.7.8 gene pnp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10743-MONOMER locus_tag OGMAPBJC_00569 product polynucleotide phosphorylase monomer 607471 608355 CDS gene nlpI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12371-MONOMER locus_tag OGMAPBJC_00570 product lipoprotein involved in cell division 608535 610424 CDS gene deaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10215-MONOMER locus_tag OGMAPBJC_00571 product DeaD, DEAD-box RNA helicase 610578 611822 CDS gene mtr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MTR-MONOMER locus_tag OGMAPBJC_00572 product tryptohan / indole:H+ symporter Mtr 612947 611940 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7654-MONOMER locus_tag OGMAPBJC_00573 note conserved protein product hypothetical protein 613906 613028 CDS gene yhbV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7653-MONOMER locus_tag OGMAPBJC_00574 product putative protease 614910 613915 CDS gene yhbU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7652-MONOMER locus_tag OGMAPBJC_00575 product putative peptidase (collagenase-like) 615119 615643 CDS gene yhbT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7651-MONOMER locus_tag OGMAPBJC_00576 product putative lipid carrier protein 615637 616140 CDS gene yhbS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7650-MONOMER locus_tag OGMAPBJC_00577 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 616429 616127 CDS gene yhbQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7649-MONOMER locus_tag OGMAPBJC_00578 product putative endonuclease 616480 616923 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7648-MONOMER locus_tag OGMAPBJC_00579 note conserved protein product hypothetical protein 617421 616903 CDS gene yhbO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7647-MONOMER locus_tag OGMAPBJC_00580 product protein involved in stress response 617549 618184 CDS gene yraR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7646-MONOMER locus_tag OGMAPBJC_00581 product putative nucleoside-diphosphate-sugar epimerase 618257 619297 CDS gene yraQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7645-MONOMER locus_tag OGMAPBJC_00582 product putative permease 619986 619411 CDS gene yraP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7644-MONOMER locus_tag OGMAPBJC_00583 product lipoprotein 620586 619996 CDS gene diaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YRAO-MONOMER locus_tag OGMAPBJC_00584 product DnaA initiator-associating factor for replication initiation 621001 620606 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7643-MONOMER locus_tag OGMAPBJC_00585 note conserved protein product hypothetical protein 622995 620959 CDS gene lpoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7642-MONOMER locus_tag OGMAPBJC_00586 product outer membrane lipoprotein - activator of PBP1A activity 623060 623920 CDS gene rsmI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7641-MONOMER locus_tag OGMAPBJC_00587 product 16S rRNA 2'-O-ribose methyltransferase 625054 623963 CDS gene yraK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7640-MONOMER locus_tag OGMAPBJC_00588 product putative fimbrial protein 627581 625065 CDS gene yraJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7639-MONOMER locus_tag OGMAPBJC_00589 product putative outer membrane export usher protein 628305 627610 CDS gene yraI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7638-MONOMER locus_tag OGMAPBJC_00590 product putative pilin chaperone 628969 628385 CDS gene yraH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7637-MONOMER locus_tag OGMAPBJC_00591 product putative fimbrial-like adhesin protein 630071 629370 CDS gene agaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7636-MONOMER locus_tag OGMAPBJC_00592 product putative galactosamine-6-phosphate isomerase 630917 630126 CDS gene agaD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGAD-MONOMER locus_tag OGMAPBJC_00593 product galactosamine PTS permease - cryptic 631710 630907 CDS gene agaC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGAC-MONOMER locus_tag OGMAPBJC_00594 product galactosamine PTS permease - cryptic 632225 631749 CDS EC_number 2.7.1.69 gene agaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGAB-MONOMER locus_tag OGMAPBJC_00595 product galactosamine PTS permease - cryptic 633252 632392 CDS EC_number 4.1.2.40 gene kbaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TAGAALDOL1-MONOMER locus_tag OGMAPBJC_00596 product tagatose-1,6-bisphosphate aldolase 1 634419 633265 CDS gene agaS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7634-MONOMER locus_tag OGMAPBJC_00597 product putative tagatose-6-phosphate aldose/ketose isomerase 635903 634770 CDS EC_number 3.5.1.- db_xref COG:COG1820 gene agaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q8XAC3 locus_tag OGMAPBJC_00598 product N-acetylgalactosamine-6-phosphate deacetylase 636334 635900 CDS gene yadI_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGAX-MONOMER locus_tag OGMAPBJC_00599 product AgaX 637230 636352 CDS gene agaD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGAD-MONOMER locus_tag OGMAPBJC_00600 product galactosamine PTS permease - cryptic 637999 637220 CDS db_xref COG:COG3715 gene agaC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P42910 locus_tag OGMAPBJC_00601 product N-acetylgalactosamine permease IIC component 1 638483 638010 CDS EC_number 2.7.1.69 gene agaV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7632-MONOMER locus_tag OGMAPBJC_00602 product PTS system, cytoplasmic, N-acetylgalactosamine-specific IIB component 2 (EIIB-AGA) 639786 638506 CDS gene kbaZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7631-MONOMER locus_tag OGMAPBJC_00603 product tagatose-1,6-bisphosphate aldolase 1 640035 640844 CDS gene agaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7630-MONOMER locus_tag OGMAPBJC_00604 product AgaR DNA-binding transcriptional repressor 641363 640899 CDS gene yhaV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7629-MONOMER locus_tag OGMAPBJC_00605 product YhaV toxic endonuclease 641698 641363 CDS gene prlF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10955-MONOMER locus_tag OGMAPBJC_00606 product PrlF antitoxin 643418 641847 CDS EC_number 4.2.1.42 gene garD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GALACTARDEHYDRA-MONOMER locus_tag OGMAPBJC_00607 product galactarate dehydratase 643793 645127 CDS gene garP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHAU-MONOMER locus_tag OGMAPBJC_00608 product galactarate / glucarate / glycerate:H+ symporter GarP 645143 645913 CDS EC_number 4.1.2.20 gene garL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDGALDOL-MONOMER locus_tag OGMAPBJC_00609 product alpha-dehydro-beta-deoxy-D-glucarate aldolase 645943 646833 CDS EC_number 1.1.1.60 gene garR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TSA-REDUCT-MONOMER locus_tag OGMAPBJC_00610 product tartronate semialdehyde reductase 646930 648075 CDS EC_number 2.7.1.31 gene garK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GKI-MONOMER locus_tag OGMAPBJC_00611 product glycerate kinase I 649769 649098 CDS gene yhaC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11174-MONOMER locus_tag OGMAPBJC_00612 product putative protein 650285 650058 CDS gene yhaC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11174-MONOMER locus_tag OGMAPBJC_00613 product putative protein 650846 650307 CDS gene yhaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11173-MONOMER locus_tag OGMAPBJC_00614 product putative protein 651635 652573 CDS gene tdcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00268 locus_tag OGMAPBJC_00615 product TdcA DNA-binding transcriptional activator 652672 653661 CDS EC_number 4.3.1.19 gene tdcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THREDEHYDCAT-MONOMER locus_tag OGMAPBJC_00616 product catabolic threonine dehydratase 653683 655014 CDS gene tdcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TDCC-MONOMER locus_tag OGMAPBJC_00617 product serine / threonine:H+ symporter TdcC 655040 656248 CDS EC_number 2.7.2.15 gene tdcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROPKIN-MONOMER locus_tag OGMAPBJC_00618 product propionate kinase 656282 658576 CDS EC_number 2.3.1.54 gene pflB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PYRUVFORMLY-MONOMER locus_tag OGMAPBJC_00619 product pyruvate formate-lyase (inactive) 658590 658979 CDS gene tdcF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7626-MONOMER locus_tag OGMAPBJC_00620 product putative L-PSP (mRNA) endoribonuclease 659051 660415 CDS EC_number 4.3.1.17 gene tdcG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LSERINEDEAM3-MONOMER locus_tag OGMAPBJC_00621 product L-serine deaminase III 660690 662021 CDS gene yhaO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YHAO-MONOMER locus_tag OGMAPBJC_00622 product YhaO STP transporter 662049 663359 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7622-MONOMER locus_tag OGMAPBJC_00623 note conserved protein product hypothetical protein 663657 663493 CDS gene yhaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7621-MONOMER locus_tag OGMAPBJC_00624 product putative protein 664381 663680 CDS gene yhaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7620-MONOMER locus_tag OGMAPBJC_00625 product bicupin-related protein 664486 665382 CDS gene yhaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7619-MONOMER locus_tag OGMAPBJC_00626 product putative DNA-binding transcriptional regulator LYSR-type 665789 665433 CDS gene yhaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7618-MONOMER locus_tag OGMAPBJC_00627 product putative inner membrane protein 666396 666031 CDS gene yhaH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7617-MONOMER locus_tag OGMAPBJC_00628 product putative cytochrome 667676 666690 CDS gene yqjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7616-MONOMER locus_tag OGMAPBJC_00629 product S-glutathionyl-(chloro)hydroquinone reductase 668228 667746 CDS gene yqjF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7615-MONOMER locus_tag OGMAPBJC_00630 product putative quinol oxidase subunit 668623 668324 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7614-MONOMER locus_tag OGMAPBJC_00631 note conserved protein product hypothetical protein 669017 668613 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7613-MONOMER locus_tag OGMAPBJC_00632 note conserved inner membrane protein product hypothetical protein 669325 669020 CDS gene yqjD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7612-MONOMER locus_tag OGMAPBJC_00633 product inner membrane protein associated with the ribosome 669731 669363 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7611-MONOMER locus_tag OGMAPBJC_00634 note conserved protein product hypothetical protein 670261 669878 CDS gene mzrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7610-MONOMER locus_tag OGMAPBJC_00635 product MzrA 670927 670265 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7609-MONOMER locus_tag OGMAPBJC_00636 note conserved inner membrane protein product hypothetical protein 672048 671272 CDS gene exuR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03270 locus_tag OGMAPBJC_00637 product ExuR DNA-binding transcriptional repressor 673476 672178 CDS gene exuT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EXUT-MONOMER locus_tag OGMAPBJC_00638 product hexuronate transporter 673959 675371 CDS EC_number 5.3.1.12 gene uxaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UXAC-MONOMER locus_tag OGMAPBJC_00639 product D-glucuronate isomerase / D-galacturonate isomerase 675386 676873 CDS EC_number 4.2.1.7 gene uxaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALTRODEHYDRAT-MONOMER locus_tag OGMAPBJC_00640 product D-altronate dehydratase 676956 677507 CDS gene ygjV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7608-MONOMER locus_tag OGMAPBJC_00641 product inner membrane protein 678756 677512 CDS gene sstT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGJU-MONOMER locus_tag OGMAPBJC_00642 product serine / threonine:Na+ symporter 680120 679155 CDS gene alx inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7607-MONOMER locus_tag OGMAPBJC_00643 product putative membrane-bound redox modulator that is induced by high pH 681389 680403 CDS gene ygjR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7606-MONOMER locus_tag OGMAPBJC_00644 product putative NAD(P)-binding dehydrogenase 682160 681468 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7605-MONOMER locus_tag OGMAPBJC_00645 note conserved protein product hypothetical protein 682740 682237 CDS gene ygjP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7604-MONOMER locus_tag OGMAPBJC_00646 product putative metal-dependent hydrolase 682825 683961 CDS EC_number 2.1.1.174 gene rlmG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7603-MONOMER locus_tag OGMAPBJC_00647 product 23S rRNA methyltransferase 684245 684559 CDS gene higB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7602-MONOMER locus_tag OGMAPBJC_00648 product translation-dependent mRNA interferase, toxin of the HigB-HigA toxin-antitoxin system 684556 684972 CDS gene higA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7601-MONOMER locus_tag OGMAPBJC_00649 product antitoxin of the HigB-HigA toxin-antitoxin system 687035 685017 CDS EC_number 1.3.1.34 gene fadH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIENOYLCOAREDUCT-MONOMER locus_tag OGMAPBJC_00650 product 2,4-dienoyl-CoA reductase 689812 687461 CDS gene ygjK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7599-MONOMER locus_tag OGMAPBJC_00651 product glycoside hydrolase 690899 689829 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7598-MONOMER locus_tag OGMAPBJC_00652 note conserved protein product hypothetical protein 692466 691033 CDS gene ygjI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGJI-MONOMER locus_tag OGMAPBJC_00653 product YgjI APC transporter 692978 692529 CDS gene ebgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10253-MONOMER locus_tag OGMAPBJC_00654 product evolved beta-D-galactosidase, beta subunit; cryptic gene 696067 692975 CDS EC_number 3.2.1.23 gene ebgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10252-MONOMER locus_tag OGMAPBJC_00655 product evolved beta-D-galactosidase, alpha subunit; cryptic gene 697234 696251 CDS gene ebgR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03254 locus_tag OGMAPBJC_00656 product EbgR DNA-binding transcriptional repressor 697453 697785 CDS gene ygjH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7597-MONOMER locus_tag OGMAPBJC_00657 product putative tRNA synthetase 699317 697827 CDS EC_number 2.6.1.82 gene ygjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7596-MONOMER locus_tag OGMAPBJC_00658 product putrescine aminotransferase / diamine transaminase 699624 701144 CDS gene aer inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7595-MONOMER locus_tag OGMAPBJC_00659 product aerotaxis sensor receptor, flavoprotein 701921 701298 CDS gene yqjI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7594-MONOMER locus_tag OGMAPBJC_00660 product YqjI DNA-binding transcriptional repressor 702209 702973 CDS EC_number 1.16.1.9 gene yqjH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7593-MONOMER locus_tag OGMAPBJC_00661 product ferric reductase, NADPH-dependent 703102 703027 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00662 product tRNA-Met(cat) 703227 703733 CDS gene mug inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12717-MONOMER locus_tag OGMAPBJC_00663 product stationary phase mismatch/uracil DNA glycosylase 705653 703812 CDS gene rpoD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOD-MONOMER locus_tag OGMAPBJC_00664 product RNA polymerase, sigma 70 (sigma D) factor 707593 705848 CDS gene dnaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10239-MONOMER locus_tag OGMAPBJC_00665 product DNA primase 707919 707704 CDS gene rpsU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10920-MONOMER locus_tag OGMAPBJC_00666 product 30S ribosomal subunit protein S21 708157 709170 CDS gene tsaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11171-MONOMER locus_tag OGMAPBJC_00667 product protein involved in threonylcarbamoyladenosine biosynthesis 710676 709213 CDS gene ttdT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGJE-MONOMER locus_tag OGMAPBJC_00668 product tartrate:succinate antiporter 711329 710724 CDS EC_number 4.2.1.32 gene ttdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TTDB-MONOMER locus_tag OGMAPBJC_00669 product L-tartrate dehydratase, beta subunit 712237 711326 CDS EC_number 4.2.1.32 gene ttdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TTDA-MONOMER locus_tag OGMAPBJC_00670 product L-tartrate dehydratase, alpha subunit 712444 713376 CDS gene dmlR_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6985-MONOMER locus_tag OGMAPBJC_00671 product DmlR DNA-binding transcriptional regulator 714006 713389 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11674-MONOMER locus_tag OGMAPBJC_00672 note conserved inner membrane protein product hypothetical protein 714111 714479 CDS EC_number 4.1.2.25 gene folB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:H2NEOPTERINALDOL-MONOMER locus_tag OGMAPBJC_00673 product dihydroneopterin aldolase 714570 715391 CDS EC_number 3.6.1.27 gene bacA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11665-MONOMER locus_tag OGMAPBJC_00674 product undecaprenyl pyrophosphate phosphatase 716810 715572 CDS EC_number 2.7.7.72 gene cca inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10136-MONOMER locus_tag OGMAPBJC_00675 product fused tRNA nucleotidyltransferase / 2',3'-cyclic phosphodiesterase / 2' nucleotidase and phosphatase 717494 716874 CDS gene ygiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12434-MONOMER locus_tag OGMAPBJC_00676 product putative signal transduction protein (SH3 domain) 717736 719037 CDS gene ygiF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11603-MONOMER locus_tag OGMAPBJC_00677 product putative adenylate cyclase 719060 721900 CDS EC_number 2.7.7.42 gene glnE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLNE-MONOMER locus_tag OGMAPBJC_00678 product glutamine synthetase adenylyltransferase [multifunctional] 721948 723381 CDS gene rfaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7590-MONOMER locus_tag OGMAPBJC_00679 product fused heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase 725837 724176 CDS gene yqiK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7589-MONOMER locus_tag OGMAPBJC_00680 product putative membrane protein 726493 725864 CDS gene yqiJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7588-MONOMER locus_tag OGMAPBJC_00681 product putative oxidoreductase 726762 726962 CDS gene glgS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11381-MONOMER locus_tag OGMAPBJC_00682 product putative glycogen synthesis protein 727496 727005 CDS gene yqiI_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7587-MONOMER locus_tag OGMAPBJC_00683 product protein involved in detoxification of methylglyoxal 728070 727564 CDS gene yqiI_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7587-MONOMER locus_tag OGMAPBJC_00684 product protein involved in detoxification of methylglyoxal 728821 728072 CDS gene yqiH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7586-MONOMER locus_tag OGMAPBJC_00685 product putative membrane protein 731341 728837 CDS gene yqiG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7585-MONOMER locus_tag OGMAPBJC_00686 product putative membrane protein 731952 731401 CDS gene ygiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12363-MONOMER locus_tag OGMAPBJC_00687 product putative fimbrial-like adhesin protein 732526 732236 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7582-MONOMER locus_tag OGMAPBJC_00688 note conserved protein product hypothetical protein 732900 733553 CDS EC_number 4.1.99.12 gene ribB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIOHBUTANONEPSYN-MONOMER locus_tag OGMAPBJC_00689 product 3,4-dihydroxy-2-butanone 4-phosphate synthase 733815 733985 CDS gene yqiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPP7 locus_tag OGMAPBJC_00690 product Protein YqiD 734816 734043 CDS gene zupT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11167-MONOMER locus_tag OGMAPBJC_00691 product heavy metal divalent cation transporter ZupT 734932 735747 CDS gene ygiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11166-MONOMER locus_tag OGMAPBJC_00692 product putative dioxygenase 736945 735785 CDS gene ygiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11165-MONOMER locus_tag OGMAPBJC_00693 product putative enzyme 737622 736951 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11164-MONOMER locus_tag OGMAPBJC_00694 note conserved outer membrane protein product hypothetical protein 739251 737770 CDS gene tolC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11009-MONOMER locus_tag OGMAPBJC_00695 product TolC monomer 739456 740085 CDS EC_number 3.6.1.13 gene nudF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12633-MONOMER locus_tag OGMAPBJC_00696 product ADP- sugar pyrophosphatase 740086 740508 CDS gene yqiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7580-MONOMER locus_tag OGMAPBJC_00697 product putative dehydrogenase 740533 741363 CDS gene cpdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7579-MONOMER locus_tag OGMAPBJC_00698 product cAMP phosphodiesterase 741363 741944 CDS gene yqiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7578-MONOMER locus_tag OGMAPBJC_00699 product esterase 741973 743865 CDS gene parE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10687-MONOMER locus_tag OGMAPBJC_00700 product topoisomerase IV subunit B 744227 743913 CDS gene ygiN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12657-MONOMER locus_tag OGMAPBJC_00701 product quinol monooxygenase monomer 744839 744258 CDS gene mdaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12656-MONOMER locus_tag OGMAPBJC_00702 product NADPH quinone reductase monomer 746885 745536 CDS EC_number 2.7.13.3 gene qseC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P40719 locus_tag OGMAPBJC_00703 product Sensor protein QseC 747541 746882 CDS gene yedW_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_00704 product putative DNA-binding response regulator in two-component system with YedV 747693 748085 CDS gene ygiW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7574-MONOMER locus_tag OGMAPBJC_00705 product stress-induced protein 748138 748620 CDS gene ygiV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7573-MONOMER locus_tag OGMAPBJC_00706 product YgiV DNA-binding transcriptional repressor 748825 749121 CDS gene mqsR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7572-MONOMER locus_tag OGMAPBJC_00707 product mRNA interferase, toxin of the MqsR-YgiT toxin-antitoxin system 749123 749518 CDS gene mqsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7571-MONOMER locus_tag OGMAPBJC_00708 product MqsA antitoxin of the MqsRA toxin-antitoxin system and DNA-binding transcriptional repressor 749651 751258 CDS gene ygiS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGIS-MONOMER locus_tag OGMAPBJC_00709 product putative transporter subunit 751396 753654 CDS gene parC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10686-MONOMER locus_tag OGMAPBJC_00710 product topoisomerase IV subunit A 753888 754625 CDS EC_number 2.3.1.51 gene plsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:1-ACYLGLYCEROL-3-P-ACYLTRANSFER-MONOMER locus_tag OGMAPBJC_00711 product 1-acylglycerol-3-phosphate O-acyltransferase 754700 756112 CDS gene ftsP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11376-MONOMER locus_tag OGMAPBJC_00712 product cell division protein required during stress conditions 756223 758442 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7568-MONOMER locus_tag OGMAPBJC_00713 note conserved protein product hypothetical protein 758742 758485 CDS gene yqhH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7567-MONOMER locus_tag OGMAPBJC_00714 product putative outer membrane lipoprotein 759719 758793 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7566-MONOMER locus_tag OGMAPBJC_00715 note conserved protein product hypothetical protein 760746 759919 CDS EC_number 1.1.1.274 gene dkgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-148 locus_tag OGMAPBJC_00716 product methylglyoxal reductase [multifunctional] 762014 760851 CDS gene yqhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7564-MONOMER locus_tag OGMAPBJC_00717 product NADP-dependent dehydrogenase 762151 763107 CDS gene yqhC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7563-MONOMER locus_tag OGMAPBJC_00718 product YqhC DNA-binding transcriptional activator 763806 763147 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11824-MONOMER locus_tag OGMAPBJC_00719 note conserved inner membrane protein product hypothetical protein 765133 763946 CDS EC_number 4.4.1.8 gene metC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSTATHIONINE-BETA-LYASE-MONOMER locus_tag OGMAPBJC_00720 product L-cysteine desulfhydrase / cystathionine-beta-lyase 765385 766119 CDS gene exbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10271-MONOMER locus_tag OGMAPBJC_00721 product TonB energy transducing system - ExbB subunit 766126 766551 CDS gene exbD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10272-MONOMER locus_tag OGMAPBJC_00722 product tonB energy transducing system - ExbD subunit 767707 766823 CDS gene yghA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11292-MONOMER locus_tag OGMAPBJC_00723 product putative glutathionylspermidine synthase, with NAD(P)-binding Rossmann-fold domain 767898 768392 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7559-MONOMER locus_tag OGMAPBJC_00724 note conserved inner membrane protein product hypothetical protein 769472 768432 CDS gene yghZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7558-MONOMER locus_tag OGMAPBJC_00725 product L-glyceraldehyde 3-phosphate reductase 769629 769772 CDS gene yqhI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPP6 locus_tag OGMAPBJC_00726 product Protein YqhI 769750 770103 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00727 product hypothetical protein 770103 770513 CDS EC_number 3.1.1.45 gene ysgA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7804-MONOMER locus_tag OGMAPBJC_00728 product putative hydrolase 770632 770919 CDS gene yghW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7555-MONOMER locus_tag OGMAPBJC_00729 product putative protein 771108 772226 CDS EC_number 1.12.99.6 gene hybO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-145 locus_tag OGMAPBJC_00730 product hydrogenase 2, small subunit 772229 773215 CDS gene hybA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYBA-MONOMER locus_tag OGMAPBJC_00731 product hydrogenase 2 4Fe-4S ferredoxin-type component 773205 774383 CDS gene hybB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11800-MONOMER locus_tag OGMAPBJC_00732 product putative hydrogenase 2 cytochrome b type component 774380 776083 CDS EC_number 1.12.99.6 gene hybC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYBC-MONOMER locus_tag OGMAPBJC_00733 product hydrogenase 2, large subunit 776083 776577 CDS gene hybD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11802-MONOMER locus_tag OGMAPBJC_00734 product putative maturation peptidase for hydrogenase 2 776570 777058 CDS gene hybE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11803-MONOMER locus_tag OGMAPBJC_00735 product hydrogenase 2-specific chaperone 777051 777392 CDS gene hybF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11804-MONOMER locus_tag OGMAPBJC_00736 product protein involved with the maturation of hydrogenases 1 and 2 777405 777653 CDS gene hybG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11805-MONOMER locus_tag OGMAPBJC_00737 product hydrogenase 2 accessory protein 778642 777776 CDS gene yghU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7553-MONOMER locus_tag OGMAPBJC_00738 product disulfide reductase / organic hydroperoxide reductase 778847 780706 CDS EC_number 6.3.1.8 gene gss inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GSP-MONOMER locus_tag OGMAPBJC_00739 product fused glutathionylspermidine amidase / glutathionylspermidine synthetase 780998 782497 CDS gene pitB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PITB-MONOMER locus_tag OGMAPBJC_00740 product phosphate transporter 783238 782546 CDS gene yghT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7552-MONOMER locus_tag OGMAPBJC_00741 product putative protein with nucleoside triphosphate hydrolase domain protein 783427 784125 CDS gene yghS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7551-MONOMER locus_tag OGMAPBJC_00742 product putative protein with nucleoside triphosphate hydrolase domain protein 784157 784915 CDS gene yghR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7550-MONOMER locus_tag OGMAPBJC_00743 product putative protein with nucleoside triphosphate hydrolase domain protein 784961 786310 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00744 product hypothetical protein 786310 787134 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00745 product hypothetical protein 787146 787706 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7871-MONOMER locus_tag OGMAPBJC_00746 note conserved protein product hypothetical protein 787737 788807 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00747 product hypothetical protein 788804 789883 CDS gene lptG_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7889-MONOMER locus_tag OGMAPBJC_00748 product LptABCFG ABC transporter 791090 789918 CDS EC_number 2.3.1.29 gene kbl_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AKBLIG-MONOMER locus_tag OGMAPBJC_00749 product 2-amino-3-ketobutyrate CoA ligase 791338 791090 CDS gene acpP_1 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01217 locus_tag OGMAPBJC_00750 product Acyl carrier protein 792284 791370 CDS gene ybjS_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6453-MONOMER locus_tag OGMAPBJC_00751 product putative NAD(P)H-binding oxidoreductase with NAD(P)-binding Rossmann-fold domain protein 793969 792281 CDS EC_number 6.2.1.3 gene fadD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACYLCOASYN-MONOMER locus_tag OGMAPBJC_00752 product fatty acyl-CoA synthetase 794379 795521 CDS gene yghO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7547-MONOMER locus_tag OGMAPBJC_00753 product putative DNA-binding transcriptional regulator 796292 795528 CDS gene glcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7546-MONOMER locus_tag OGMAPBJC_00754 product GlcC transcriptional dual regulator 796543 798042 CDS gene glcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7545-MONOMER locus_tag OGMAPBJC_00755 product glycolate oxidase, predicted FAD-linked subunit 798042 799094 CDS gene glcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7544-MONOMER locus_tag OGMAPBJC_00756 product glycolate oxidase, predicted FAD-binding subunit 799105 800328 CDS gene glcF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-561 locus_tag OGMAPBJC_00757 product glycolate oxidase, predicted iron-sulfur subunit 800333 800737 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7543-MONOMER locus_tag OGMAPBJC_00758 note conserved protein product hypothetical protein 800759 802930 CDS EC_number 2.3.3.9 gene glcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALSYNG-MONOMER locus_tag OGMAPBJC_00759 product malate synthase G 803285 804967 CDS gene glcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2975-MONOMER locus_tag OGMAPBJC_00760 product glycolate / lactate:H+ symporter 805452 810020 CDS gene yghJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7541-MONOMER locus_tag OGMAPBJC_00761 product putative lipoprotein 810218 811027 CDS gene pppA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7539-MONOMER locus_tag OGMAPBJC_00762 product prepilin peptidase 811093 811503 CDS gene yghG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7538-MONOMER locus_tag OGMAPBJC_00763 product putative lipoprotein 811662 812480 CDS gene yghF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7537-MONOMER locus_tag OGMAPBJC_00764 product putative secretion pathway protein, C-type protein 812510 813826 CDS gene gspD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7703-MONOMER locus_tag OGMAPBJC_00765 product putative protein secretion protein for export 813919 814455 CDS gene yghD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7535-MONOMER locus_tag OGMAPBJC_00766 product putative secretion pathway protein, M-type protein, membrane anchored 814679 814604 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00767 product tRNA-Phe(gaa) 815492 814785 CDS gene yqgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7534-MONOMER locus_tag OGMAPBJC_00768 product putative transport protein 815890 818025 CDS EC_number 4.1.1.17 gene speC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ORNDECARBOX-BIO-MONOMER locus_tag OGMAPBJC_00769 product ornithine decarboxylase, biosynthetic 819331 818075 CDS gene nupG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUPG-MONOMER locus_tag OGMAPBJC_00770 product nucleoside:H+ symporter NupG 820612 819533 CDS EC_number 4.2.2 gene mltC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7533-MONOMER locus_tag OGMAPBJC_00771 product membrane-bound lytic murein transglycosylase C 820952 820677 CDS gene yggX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7532-MONOMER locus_tag OGMAPBJC_00772 product protein that protects iron-sulfur proteins against oxidative damage 822032 820980 CDS gene mutY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10627-MONOMER locus_tag OGMAPBJC_00773 product adenine glycosylase; G.C --> T.A transversions 822193 822912 CDS EC_number 2.1.1.33 gene trmI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11779-MONOMER locus_tag OGMAPBJC_00774 product tRNA (m7G46) methyltransferase 822912 823238 CDS gene yggL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12443-MONOMER locus_tag OGMAPBJC_00775 product putative protein 823422 824141 CDS gene yggN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12705-MONOMER locus_tag OGMAPBJC_00776 product putative protein 824317 825363 CDS EC_number 3.5.1.1 gene ansB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANSB-MONOMER locus_tag OGMAPBJC_00777 product asparaginase II 825480 826487 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12704-MONOMER locus_tag OGMAPBJC_00778 note conserved protein product hypothetical protein 827778 826642 CDS gene yggW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7531-MONOMER locus_tag OGMAPBJC_00779 product putative oxidoreductase 828364 827771 CDS EC_number 3.6.1.19 gene rdgB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7530-MONOMER locus_tag OGMAPBJC_00780 product dITP/XTP pyrophosphatase 828662 828372 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7529-MONOMER locus_tag OGMAPBJC_00781 note conserved protein product hypothetical protein 829225 828659 CDS gene yggT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7528-MONOMER locus_tag OGMAPBJC_00782 product putative inner membrane protein 829947 829243 CDS gene yggS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7527-MONOMER locus_tag OGMAPBJC_00783 product putative enzyme 829965 830945 CDS gene yggR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7526-MONOMER locus_tag OGMAPBJC_00784 product putative transporter 831545 831129 CDS gene yqgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7525-MONOMER locus_tag OGMAPBJC_00785 product putative transcription antitermination factor 832180 831545 CDS gene yqgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7524-MONOMER locus_tag OGMAPBJC_00786 product putative protein 833167 832217 CDS EC_number 6.3.2.3 gene gshB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTATHIONE-SYN-MONOMER locus_tag OGMAPBJC_00787 product glutathione synthetase monomer 833911 833180 CDS gene rsmE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12366-MONOMER locus_tag OGMAPBJC_00788 product 16S rRNA methyltransferase monomer 834698 833991 CDS EC_number 3.1.21.1 gene endA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11336-MONOMER locus_tag OGMAPBJC_00789 product DNA-specific endonuclease I 835248 834793 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12122-MONOMER locus_tag OGMAPBJC_00790 note conserved protein product hypothetical protein 836761 835367 CDS gene galP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GALP-MONOMER locus_tag OGMAPBJC_00791 product galactose:H+ symporter 838339 837185 CDS EC_number 2.5.1.6 gene metK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:S-ADENMETSYN-MONOMER locus_tag OGMAPBJC_00792 product methionine adenosyltransferase 838395 838646 CDS gene yqgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7523-MONOMER locus_tag OGMAPBJC_00793 product hypothetical protein 839134 841110 CDS EC_number 4.1.1.19 gene speA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGDECARBOXBIO-MONOMER locus_tag OGMAPBJC_00794 product arginine decarboxylase, biosynthetic 841248 842168 CDS EC_number 3.5.3.11 gene speB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGMATIN-MONOMER locus_tag OGMAPBJC_00795 product agmatinase 843132 842374 CDS gene loiP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11291-MONOMER locus_tag OGMAPBJC_00796 product outer membrane metallopeptidase 843410 845401 CDS EC_number 2.2.1.1 gene tktA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRANSKETOI-MONOMER locus_tag OGMAPBJC_00797 product transketolase I 845715 846158 CDS gene cmtB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CMTB-MONOMER locus_tag OGMAPBJC_00798 product mannitol PTS permease (cryptic) - CmtB subunit 846186 847574 CDS EC_number 2.7.1.69 gene cmtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CMTA-MONOMER locus_tag OGMAPBJC_00799 product mannitol PTS permease (cryptic) - CmtA subunit 847589 848866 CDS gene yggP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7520-MONOMER locus_tag OGMAPBJC_00800 product putative dehydrogenase 848863 849828 CDS EC_number 3.1.3.11 gene yggF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11245-MONOMER locus_tag OGMAPBJC_00801 product fructose-1,6-bisphosphatase 849850 850359 CDS gene yggD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11162-MONOMER locus_tag OGMAPBJC_00802 product putative DNA-binding transcriptional regulator 850356 851069 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11161-MONOMER locus_tag OGMAPBJC_00803 note conserved protein with nucleoside triphosphate hydrolase domain product hypothetical protein 851354 852373 CDS EC_number 1.2.1.72 gene epd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ERYTH4PDEHYDROG-MONOMER locus_tag OGMAPBJC_00804 product erythrose 4-phosphate dehydrogenase 852423 853586 CDS EC_number 2.7.2.3 gene pgk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGK locus_tag OGMAPBJC_00805 product phosphoglycerate kinase 853801 854880 CDS EC_number 4.1.2.13 gene fbaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRUCTBISALD-CLASSII-MONOMER locus_tag OGMAPBJC_00806 product fructose bisphosphate aldolase monomer 855237 856097 CDS gene mscS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11160-MONOMER locus_tag OGMAPBJC_00807 product mechanosensitive channel MscS monomer 856236 856871 CDS gene argO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGGA-MONOMER locus_tag OGMAPBJC_00808 product arginine export protein 856964 857704 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11244-MONOMER locus_tag OGMAPBJC_00809 note conserved protein product hypothetical protein 857871 858767 CDS gene ygfI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7518-MONOMER locus_tag OGMAPBJC_00810 product putative DNA-binding transcriptional regulator LYSR-type 860242 858764 CDS gene scpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7517-MONOMER locus_tag OGMAPBJC_00811 product propionyl-CoA:succinate CoA transferase 861051 860266 CDS EC_number 4.1.1.41 gene scpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7516-MONOMER locus_tag OGMAPBJC_00812 product methylmalonyl-CoA decarboxylase 861832 861062 CDS gene argK_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11445-MONOMER locus_tag OGMAPBJC_00813 product GTPase that interacts with methylmalonyl-CoA mutase 862056 861823 CDS gene argK_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11445-MONOMER locus_tag OGMAPBJC_00814 product GTPase that interacts with methylmalonyl-CoA mutase 864193 862049 CDS EC_number 5.4.99.2 gene scpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:METHYLMALONYL-COA-MUT-MONOMER locus_tag OGMAPBJC_00815 product methylmalonyl-CoA mutase 865290 864397 CDS gene argP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10490-MONOMER locus_tag OGMAPBJC_00816 product ArgP transcriptional activator 865432 865662 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7515-MONOMER locus_tag OGMAPBJC_00817 note conserved protein product hypothetical protein 865718 866377 CDS EC_number 5.3.1.6 gene rpiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIB5PISOMA-MONOMER locus_tag OGMAPBJC_00818 product ribose-5-phosphate isomerase A 866633 867865 CDS EC_number 1.1.1.95 gene serA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGLYCDEHYDROG-MONOMER locus_tag OGMAPBJC_00819 product alpha-ketoglutarate reductase / D-3-phosphoglycerate dehydrogenase 868802 868254 CDS gene fau inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11158-MONOMER locus_tag OGMAPBJC_00820 product 5-formyltetrahydrofolate cyclo-ligase 869431 869102 CDS gene zapA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12878-MONOMER locus_tag OGMAPBJC_00821 product cell division factor ZapA, localizes to the cytokinetic ring 869599 870177 CDS gene ygfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11323-MONOMER locus_tag OGMAPBJC_00822 product putative protein 870203 871528 CDS gene pepP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10697-MONOMER locus_tag OGMAPBJC_00823 product proline aminopeptidase P II 871525 872703 CDS gene ubiH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OCTAPRENYL-METHOXYPHENOL-OH-MONOMER locus_tag OGMAPBJC_00824 product 2-octaprenyl-6-methoxyphenol hydroxylase 872726 873928 CDS gene visC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11333-MONOMER locus_tag OGMAPBJC_00825 product putative oxidoreductase, FAD/NAD(P)-binding domain 874375 875469 CDS EC_number 2.1.2.10 gene gcvT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GCVT-MONOMER locus_tag OGMAPBJC_00826 product aminomethyltransferase 875493 875882 CDS db_xref COG:COG0509 gene gcvH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0A6T9 locus_tag OGMAPBJC_00827 product Glycine cleavage system H protein 876001 878874 CDS EC_number 1.4.4.2 gene gcvP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GCVP-MONOMER locus_tag OGMAPBJC_00828 product glycine decarboxylase 880473 879040 CDS EC_number 3.2.1.86 gene bglA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G495-MONOMER locus_tag OGMAPBJC_00829 product 6-phospho-beta-glucosidase A 880518 880829 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7513-MONOMER locus_tag OGMAPBJC_00830 note conserved protein product hypothetical protein 880963 881652 CDS gene yqfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7512-MONOMER locus_tag OGMAPBJC_00831 product putative oxidoreductase, inner membrane subunit 882828 881848 CDS gene ygfZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7511-MONOMER locus_tag OGMAPBJC_00832 product folate-binding protein 883071 883337 CDS gene cptB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7510-MONOMER locus_tag OGMAPBJC_00833 product antitoxin of the CptA-CptB toxin-antitoxin system 883318 883725 CDS gene cptA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7509-MONOMER locus_tag OGMAPBJC_00834 product toxin of the CptA-CptB toxin-antitoxin system 884286 883765 CDS db_xref COG:COG0716 gene fldB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0ABY4 locus_tag OGMAPBJC_00835 product Flavodoxin 2 884398 885294 CDS gene xerD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11071-MONOMER locus_tag OGMAPBJC_00836 product site-specific recombinase 885319 886029 CDS db_xref COG:COG1651 gene dsbC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEG6 locus_tag OGMAPBJC_00837 product Thiol:disulfide interchange protein DsbC 886035 887768 CDS gene recJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10830-MONOMER locus_tag OGMAPBJC_00838 product RecJ 888076 888957 CDS gene prfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10762-MONOMER locus_tag OGMAPBJC_00839 product peptide chain release factor RF2 888967 890484 CDS EC_number 6.1.1.6 gene lysS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LYSS-MONOMER locus_tag OGMAPBJC_00840 product lysyl tRNA synthetase (LysRSs), constitutive 891075 890527 CDS EC_number 5.3.3.2 gene idi inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:IPPISOM-MONOMER locus_tag OGMAPBJC_00841 product isopentenyl diphosphate isomerase 891323 891198 CDS gene yqfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2883 locus_tag OGMAPBJC_00842 product small predicted membrane protein 892773 891325 CDS gene uacT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGFU-MONOMER locus_tag OGMAPBJC_00843 product urate:H+ symporter 893209 895128 CDS gene ygfT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7506-MONOMER locus_tag OGMAPBJC_00844 product fused predicted oxidoreductase, Fe-S subunit and nucleotide-binding subunit 895128 895616 CDS gene ygfS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7505-MONOMER locus_tag OGMAPBJC_00845 product putative oxidoreductase, 4Fe-4S ferredoxin-type subunit 897019 895652 CDS gene ygfQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7504-MONOMER locus_tag OGMAPBJC_00846 product putative transporter 898371 897055 CDS EC_number 3.5.4.3 gene guaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7502-MONOMER locus_tag OGMAPBJC_00847 product guanine deaminase 899789 898389 CDS gene xanQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YGFO-MONOMER locus_tag OGMAPBJC_00848 product xanthine:H+ symporter XanQ 902824 899954 CDS gene xdhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7500-MONOMER locus_tag OGMAPBJC_00849 product fused predicted xanthine/hypoxanthine oxidase: molybdopterin-binding subunit and Fe-S binding subunit 903600 902821 CDS gene ygfM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7499-MONOMER locus_tag OGMAPBJC_00850 product putative oxidoreductase 904979 903651 CDS gene ssnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7498-MONOMER locus_tag OGMAPBJC_00851 product putative chlorohydrolase/aminohydrolase 908080 904982 CDS gene ygfK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7497-MONOMER locus_tag OGMAPBJC_00852 product putative oxidoreductase, Fe-S subunit 908980 908402 CDS gene mocA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7496-MONOMER locus_tag OGMAPBJC_00853 product CTP:molybdopterin cytidylyltransferase 909083 909853 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7495-MONOMER locus_tag OGMAPBJC_00854 note conserved protein product hypothetical protein 909901 911526 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7494-MONOMER locus_tag OGMAPBJC_00855 note conserved protein with NAD(P)-binding Rossman fold product hypothetical protein 912679 911747 CDS gene yqeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7493-MONOMER locus_tag OGMAPBJC_00856 product putative amino acid kinase 914112 912727 CDS gene hyuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7492-MONOMER locus_tag OGMAPBJC_00857 product phenylhydantoinase monomer 915376 914165 CDS gene ygeY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7491-MONOMER locus_tag OGMAPBJC_00858 product putative peptidase 916630 915434 CDS EC_number 4.3.1.15 gene ygeX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7490-MONOMER locus_tag OGMAPBJC_00859 product 2,3-diaminopropionate ammonia-lyase 917875 916688 CDS gene ygeW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7489-MONOMER locus_tag OGMAPBJC_00860 product putative carbamoyltransferase 918354 920132 CDS gene ygeV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7488-MONOMER locus_tag OGMAPBJC_00861 product putative transcriptional regulator 920651 920172 CDS gene xdhC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7487-MONOMER locus_tag OGMAPBJC_00862 product xanthine dehydrogenase, Fe-S subunit 921526 920648 CDS EC_number 1.17.1.4 gene xdhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7486-MONOMER locus_tag OGMAPBJC_00863 product xanthine dehydrogenase subunit, FAD-binding domain 923834 921537 CDS EC_number 1.17.1.4 gene xdhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7485-MONOMER locus_tag OGMAPBJC_00864 product xanthine dehydrogenase subunit 924249 925004 CDS gene ygeR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7484-MONOMER locus_tag OGMAPBJC_00865 product putative lipoprotein; predicted DNA-binding transcriptional regulator 925083 925156 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00866 product tRNA-Gly(ccc) 925246 927177 CDS gene xerD_2 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01807 locus_tag OGMAPBJC_00867 product Tyrosine recombinase XerD 927630 927295 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00868 product hypothetical protein 928043 927693 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00869 product hypothetical protein 929041 928211 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_00870 note IS150 conserved protein InsB product hypothetical protein 929331 929068 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_00871 product IS3 family transposase IS1222 929595 930476 CDS gene prgH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P41783 locus_tag OGMAPBJC_00872 product Protein PrgH 930490 930729 CDS gene prgI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P41784 locus_tag OGMAPBJC_00873 product Protein PrgI 930749 931081 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00874 product hypothetical protein 931078 931812 CDS db_xref COG:COG4669 gene prgK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P41786 locus_tag OGMAPBJC_00875 product Lipoprotein PrgK 931828 932367 CDS gene orgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0CL44 locus_tag OGMAPBJC_00876 product Oxygen-regulated invasion protein OrgA 932370 933059 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00877 product hypothetical protein 933281 933436 CDS gene ygeL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7476-MONOMER locus_tag OGMAPBJC_00878 product putative protein 933470 933913 CDS gene ygeK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7475-MONOMER locus_tag OGMAPBJC_00879 product putative DNA-binding transcriptional regulator 934332 933958 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00880 product hypothetical protein 934735 934517 CDS gene ygeI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7473-MONOMER locus_tag OGMAPBJC_00881 product putative protein 936279 934903 CDS gene ygeH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7472-MONOMER locus_tag OGMAPBJC_00882 product putative transcriptional regulator 937105 936614 CDS gene ygeG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7471-MONOMER locus_tag OGMAPBJC_00883 product putative chaperone 937819 937373 CDS gene ygeF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7470-MONOMER locus_tag OGMAPBJC_00884 product putative protein 938013 938438 CDS gene yqeK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7469-MONOMER locus_tag OGMAPBJC_00885 product putative protein 938414 938554 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00886 product hypothetical protein 939069 938587 CDS gene yqeJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7468-MONOMER locus_tag OGMAPBJC_00887 product putative protein 939871 939062 CDS gene yqeI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7467-MONOMER locus_tag OGMAPBJC_00888 product putative transcriptional regulator 939992 940123 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00889 product hypothetical protein 940837 940205 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7466-MONOMER locus_tag OGMAPBJC_00890 note conserved protein with bipartite regulator domain product hypothetical protein 942526 941297 CDS gene yqeG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2845-MONOMER locus_tag OGMAPBJC_00891 product YqeG STP transporter 942781 943962 CDS EC_number 2.3.1.9 gene yqeF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7464-MONOMER locus_tag OGMAPBJC_00892 product putative acyltransferase 944249 945085 CDS EC_number 5.3.1.17 gene kduI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7463-MONOMER locus_tag OGMAPBJC_00893 product putative 5-keto 4-deoxyuronate isomerase monomer 945115 945876 CDS EC_number 1.1.1.127 gene kduD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDUD-MONOMER locus_tag OGMAPBJC_00894 product 2-deoxy-D-gluconate 3-dehydrogenase 946191 947609 CDS gene araE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARAE-MONOMER locus_tag OGMAPBJC_00895 product arabinose:H+ symporter 947738 948430 CDS gene ygeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11157-MONOMER locus_tag OGMAPBJC_00896 product putative racemase 949352 948417 CDS gene lysR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00360 locus_tag OGMAPBJC_00897 product LysR DNA-binding transcriptional dual regulator 949474 950736 CDS EC_number 4.1.1.20 gene lysA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIAMINOPIMDECARB-MONOMER locus_tag OGMAPBJC_00898 product diaminopimelate decarboxylase 951774 950743 CDS gene galR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03028 locus_tag OGMAPBJC_00899 product GalR DNA-binding transcriptional dual regulator 952359 954518 CDS EC_number 6.2.1.20 gene aas inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AAS-MONOMER locus_tag OGMAPBJC_00900 product 2-acylglycerophosphoethanolamine acyltransferase / acyl-ACP synthetase 954511 955704 CDS gene lplT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12455-MONOMER locus_tag OGMAPBJC_00901 product lysophospholipid transporter 956776 955736 CDS gene tas inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7462-MONOMER locus_tag OGMAPBJC_00902 product putative NAD(P)-linked reductase that acts in starvation-associated mutation 957102 956884 CDS gene ygdR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7461-MONOMER locus_tag OGMAPBJC_00903 product putative protein 957953 957240 CDS gene ygdQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7460-MONOMER locus_tag OGMAPBJC_00904 product putative transport protein 958711 958022 CDS gene mutH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10624-MONOMER locus_tag OGMAPBJC_00905 product MutHLS complex, methyl-directed mismatch repair 958897 959043 CDS gene ygdT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2825 locus_tag OGMAPBJC_00906 product hypothetical protein 959396 959926 CDS gene rppH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7459-MONOMER locus_tag OGMAPBJC_00907 product RNA pyrophosphohydrolase 959939 962185 CDS EC_number 2.7.3.9 gene ptsP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12188-MONOMER locus_tag OGMAPBJC_00908 product PTS system, enzyme I, transcriptional regulator (with NPR and NTR proteins) 962336 963211 CDS gene lgt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12128-MONOMER locus_tag OGMAPBJC_00909 product phosphatidylglycerol-prolipoprotein diacylglyceryl transferase 963218 964012 CDS EC_number 2.1.1.45 gene thyA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THYMIDYLATESYN-MONOMER locus_tag OGMAPBJC_00910 product thymidylate synthase 964196 964666 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12081-MONOMER locus_tag OGMAPBJC_00911 note conserved protein product hypothetical protein 964657 965220 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11156-MONOMER locus_tag OGMAPBJC_00912 note conserved protein product hypothetical protein 965217 965624 CDS gene ygdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11155-MONOMER locus_tag OGMAPBJC_00913 product putative protein 965609 965932 CDS gene ppdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11154-MONOMER locus_tag OGMAPBJC_00914 product putative protein 965945 969313 CDS EC_number 3.1.11.5 gene recC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10825-MONOMER locus_tag OGMAPBJC_00915 product RecBCD 969489 972377 CDS gene ptrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10786-MONOMER locus_tag OGMAPBJC_00916 product protease III 972370 975912 CDS EC_number 3.1.11.5 gene recB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10824-MONOMER locus_tag OGMAPBJC_00917 product RecBCD 975912 977738 CDS EC_number 3.1.11.5 gene recD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10826-MONOMER locus_tag OGMAPBJC_00918 product RecBCD 979131 977800 CDS EC_number 2.3.1.1 gene argA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:N-ACETYLTRANSFER-MONOMER locus_tag OGMAPBJC_00919 product N-acetylglutamate synthase 979363 980616 CDS EC_number 3.5.1.28 gene amiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7458-MONOMER locus_tag OGMAPBJC_00920 product N-acetylmuramyl-L-alanine amidase 980766 980690 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00921 product tRNA-Met(cat) 980876 980800 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00922 product tRNA-Met(cat) 980986 980910 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_00923 product tRNA-Met(cat) 981195 982292 CDS EC_number 4.2.2 gene mltA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7457-MONOMER locus_tag OGMAPBJC_00924 product membrane-bound lytic murein transglycosylase A 982531 983337 CDS gene csdL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7456-MONOMER locus_tag OGMAPBJC_00925 product CSD sulfur transfer protein 983831 983388 CDS gene csdE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7455-MONOMER locus_tag OGMAPBJC_00926 product CSD sulfur transfer protein 985036 983831 CDS gene csdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7454-MONOMER locus_tag OGMAPBJC_00927 product cysteine sulfinate desulfinase 985228 985455 CDS gene ygdI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7453-MONOMER locus_tag OGMAPBJC_00928 product putative lipoprotein 985798 986715 CDS gene gcvA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00339 locus_tag OGMAPBJC_00929 product GcvA DNA-binding transcriptional dual regulator 986734 987129 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11793-MONOMER locus_tag OGMAPBJC_00930 note conserved inner membrane protein product hypothetical protein 987122 988222 CDS gene rlmM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11794-MONOMER locus_tag OGMAPBJC_00931 product 23S rRNA 2'-O-ribose methyltransferase 988997 988266 CDS gene fucR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00444 locus_tag OGMAPBJC_00932 product FucR transcriptional activator 989477 989055 CDS EC_number 5.1.3 gene fucU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10355-MONOMER locus_tag OGMAPBJC_00933 product L-fucose mutarotase 990897 989479 CDS EC_number 2.7.1.51 gene fucK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUCULOKIN-MONOMER locus_tag OGMAPBJC_00934 product L-fuculokinase 992781 991006 CDS EC_number 5.3.1.25 gene fucI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUCISOM-MONOMER locus_tag OGMAPBJC_00935 product L-fucose isomerase 994130 992814 CDS gene fucP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUCP-MONOMER locus_tag OGMAPBJC_00936 product fucose:H+ symporter 994677 995324 CDS EC_number 4.1.2.17 gene fucA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUCPALDOL-MONOMER locus_tag OGMAPBJC_00937 product L-fuculose-phosphate aldolase 995352 996500 CDS EC_number 1.1.1.77 gene fucO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LACTALDREDUCT-MONOMER locus_tag OGMAPBJC_00938 product L-1,2-propanediol oxidoreductase monomer 997400 996555 CDS gene ygdG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12372-MONOMER locus_tag OGMAPBJC_00939 product YgdG 998789 997422 CDS EC_number 4.3.1.17 gene sdaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LSERINEDEAM2-MONOMER locus_tag OGMAPBJC_00940 product L-serine deaminase II 1000136 998847 CDS gene sdaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SDAC-MONOMER locus_tag OGMAPBJC_00941 product serine:H+ symporter SdaC 1002057 1000693 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12373-MONOMER locus_tag OGMAPBJC_00942 note conserved protein product hypothetical protein 1003017 1002169 CDS EC_number 1.7.1.13 gene queF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7452-MONOMER locus_tag OGMAPBJC_00943 product 7-cyano-7-deazaguanine reductase 1003085 1003630 CDS gene syd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7451-MONOMER locus_tag OGMAPBJC_00944 product SecY-interacting protein 1004252 1004581 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7450-MONOMER locus_tag OGMAPBJC_00945 note conserved protein product hypothetical protein 1004581 1005363 CDS gene truC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7449-MONOMER locus_tag OGMAPBJC_00946 product tRNA pseudouridine 65 synthase 1005381 1005830 CDS gene yqcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7448-MONOMER locus_tag OGMAPBJC_00947 product putative flavoprotein 1006265 1007617 CDS gene gudP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2789-MONOMER locus_tag OGMAPBJC_00948 product galactarate / glucarate / glycerate:H+ symporter GudP 1007619 1008959 CDS gene gudX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7446-MONOMER locus_tag OGMAPBJC_00949 product glucarate dehydratase-related protein 1008980 1010320 CDS EC_number 4.2.1.40 gene gudD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUCARDEHYDRA-MONOMER locus_tag OGMAPBJC_00950 product D-glucarate dehydratase 1013309 1010553 CDS EC_number 2.7.13.3 db_xref COG:COG0784 gene barA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEC5 locus_tag OGMAPBJC_00951 product Signal transduction histidine-protein kinase BarA 1013366 1014667 CDS gene rlmD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11247-MONOMER locus_tag OGMAPBJC_00952 product 23S rRNA methyltransferase 1014715 1016949 CDS EC_number 2.7.6.5 gene relA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RELA-MONOMER locus_tag OGMAPBJC_00953 product GDP pyrophosphokinase / GTP pyrophosphokinase 1017027 1017275 CDS gene mazE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10571-MONOMER locus_tag OGMAPBJC_00954 product MazE antitoxin of the MazF-MazE toxin-antitoxin system 1017275 1017610 CDS gene mazF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11249-MONOMER locus_tag OGMAPBJC_00955 product MazF toxin of the MazF-MazE toxin-antitoxin system that exhibits ribonuclease activity 1017681 1018472 CDS EC_number 3.6.1.8 gene mazG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10572-MONOMER locus_tag OGMAPBJC_00956 product nucleoside triphosphate pyrophosphohydrolase 1018700 1020337 CDS EC_number 6.3.4.2 gene pyrG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CTPSYN-MONOMER locus_tag OGMAPBJC_00957 product CTP synthetase 1020425 1021723 CDS EC_number 4.2.1.11 gene eno inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ENOLASE-MONOMER locus_tag OGMAPBJC_00958 product degradosome 1022655 1021783 CDS gene ygcG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7444-MONOMER locus_tag OGMAPBJC_00959 product putative protein 1022809 1022669 CDS gene yqcG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2882 locus_tag OGMAPBJC_00960 product small protein involved in the cell envelope stress response 1022948 1023619 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7443-MONOMER locus_tag OGMAPBJC_00961 note conserved protein product hypothetical protein 1023959 1024352 repeat_region note CRISPR with 7 repeat units rpt_family CRISPR rpt_type direct rpt_unit_seq GTGTTCCCCGCGCCAGCGGGGATAAACC 1026470 1024992 CDS gene ygcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7442-MONOMER locus_tag OGMAPBJC_00962 product putative kinase 1027774 1026497 CDS gene yqcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2775-MONOMER locus_tag OGMAPBJC_00963 product YqcE MFS transporter 1028093 1028878 CDS gene ygcW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7440-MONOMER locus_tag OGMAPBJC_00964 product putative deoxygluconate dehydrogenase 1028948 1030402 CDS gene ygcU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7439-MONOMER locus_tag OGMAPBJC_00965 product putative FAD-containing dehydrogenase 1030424 1031833 CDS gene ygcS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2771-MONOMER locus_tag OGMAPBJC_00966 product YgcS MFS transporter 1031811 1032590 CDS gene ygcR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7436-MONOMER locus_tag OGMAPBJC_00967 product putative flavoprotein 1032587 1033447 CDS gene ygcQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7435-MONOMER locus_tag OGMAPBJC_00968 product putative flavoprotein 1034170 1033595 CDS gene ygcP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7434-MONOMER locus_tag OGMAPBJC_00969 product putative anti-terminator regulatory protein 1034447 1034187 CDS gene ygcO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7433-MONOMER locus_tag OGMAPBJC_00970 product putative 4Fe-4S cluster-containing protein 1035709 1034438 CDS gene ygcN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7432-MONOMER locus_tag OGMAPBJC_00971 product putative oxidoreductase with FAD/NAD(P)-binding domain protein 1036152 1035787 CDS gene queD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7431-MONOMER locus_tag OGMAPBJC_00972 product 6-carboxy-5,6,7,8-tetrahydropterin synthase 1036468 1038267 CDS EC_number 1.8.1.2 gene cysJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALPHACOMP-MONOMER locus_tag OGMAPBJC_00973 product sulfite reductase, flavoprotein subunit 1038267 1039979 CDS EC_number 1.8.1.2 gene cysI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BETACOMP-MONOMER locus_tag OGMAPBJC_00974 product sulfite reductase, hemoprotein subunit 1040053 1040787 CDS EC_number 1.8.4.8 gene cysH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PAPSSULFOTRANS-MONOMER locus_tag OGMAPBJC_00975 product 3'-phospho-adenylylsulfate reductase 1041052 1041204 CDS gene hokE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1581 locus_tag OGMAPBJC_00976 product HokE 1041374 1041234 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_00977 product hypothetical protein 1042509 1041397 CDS gene insL-3_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7255-MONOMER locus_tag OGMAPBJC_00978 product putative IS186/IS421 transposase 1042587 1042920 repeat_region note CRISPR with 6 repeat units rpt_family CRISPR rpt_type direct rpt_unit_seq GTGTTCCCCGCGCCAGCGGGGATAAACCG 1044040 1043003 CDS gene iap inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10488-MONOMER locus_tag OGMAPBJC_00979 product alkaline phosphatase isozyme conversion protein 1044292 1045200 CDS EC_number 2.7.7.4 gene cysD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSD-MONOMER locus_tag OGMAPBJC_00980 product sulfate adenylyltransferase 1045202 1046629 CDS EC_number 2.7.7.4 gene cysN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSN-MONOMER locus_tag OGMAPBJC_00981 product sulfate adenylyltransferase 1046629 1047234 CDS EC_number 2.7.1.25 gene cysC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADENYLYLSULFKIN-MONOMER locus_tag OGMAPBJC_00982 product adenylylsulfate kinase 1047284 1047607 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12707-MONOMER locus_tag OGMAPBJC_00983 note conserved inner membrane protein product hypothetical protein 1047801 1048112 CDS gene ftsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7424-MONOMER locus_tag OGMAPBJC_00984 product essential cell division protein FtsB 1048131 1048841 CDS EC_number 2.7.7.60 gene ispD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7423-MONOMER locus_tag OGMAPBJC_00985 product 4-diphosphocytidyl-2C-methyl-D-erythritol synthetase monomer 1048841 1049320 CDS EC_number 4.6.1.12 gene ispF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11816-MONOMER locus_tag OGMAPBJC_00986 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase monomer 1049317 1050366 CDS gene truD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7422-MONOMER locus_tag OGMAPBJC_00987 product tRNA pseudouridine 13 synthase 1050347 1051108 CDS EC_number 3.1.3.6 gene surE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11817-MONOMER locus_tag OGMAPBJC_00988 product broad specificity 5'(3')-nucleotidase and polyphosphatase 1051102 1051728 CDS EC_number 2.1.1.77 gene pcm inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10689-MONOMER locus_tag OGMAPBJC_00989 product L-isoaspartate protein carboxylmethyltransferase type II 1051868 1053007 CDS gene nlpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12111-MONOMER locus_tag OGMAPBJC_00990 product NlpD putative outer membrane lipoprotein 1053070 1054050 CDS gene rpoS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOS-MONOMER locus_tag OGMAPBJC_00991 product RNA polymerase, sigma S (sigma 38) factor 1055509 1054145 CDS gene ygbN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2740-MONOMER locus_tag OGMAPBJC_00992 product YgbN Gnt transporter 1056374 1055598 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7420-MONOMER locus_tag OGMAPBJC_00993 note conserved protein product hypothetical protein 1057017 1056379 CDS gene ygbL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7419-MONOMER locus_tag OGMAPBJC_00994 product putative class II aldolase 1058276 1057014 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7418-MONOMER locus_tag OGMAPBJC_00995 note conserved protein product hypothetical protein 1059181 1058273 CDS gene ygbJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7417-MONOMER locus_tag OGMAPBJC_00996 product putative dehydrogenase, with NAD(P)-binding Rossmann-fold domain 1059377 1060144 CDS gene ygbI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7416-MONOMER locus_tag OGMAPBJC_00997 product putative DNA-binding transcriptional regulator, DEOR-type 1060851 1060195 CDS EC_number 3.1.3.16 gene pphB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7415-MONOMER locus_tag OGMAPBJC_00998 product protein-tyrosine-phosphatase / phosphoprotein phosphatase 1063518 1060957 CDS gene mutS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10625-MONOMER locus_tag OGMAPBJC_00999 product MutHLS complex, methyl-directed mismatch repair 1063594 1063773 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01000 product hypothetical protein 1063805 1064158 CDS gene ygbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11287-MONOMER locus_tag OGMAPBJC_01001 product putative protein 1066273 1064195 CDS gene fhlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD02936 locus_tag OGMAPBJC_01002 product FhlA transcriptional activator 1067357 1066347 CDS EC_number 4.2.1.- db_xref COG:COG0309 gene hypE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P24193 locus_tag OGMAPBJC_01003 product Carbamoyl dehydratase HypE 1068475 1067354 CDS gene hypD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10486-MONOMER locus_tag OGMAPBJC_01004 product protein involved in maturation of hydrogenase isoenzymes 1068747 1068475 CDS gene hypC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10485-MONOMER locus_tag OGMAPBJC_01005 product protein involved in hydrogenase 3 maturation 1069610 1068738 CDS gene hypB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10484-MONOMER locus_tag OGMAPBJC_01006 product accessory protein for nickel incorporation into hydrogenase isoenzymes 1069964 1069614 CDS gene hypA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10483-MONOMER locus_tag OGMAPBJC_01007 product accessory protein for nickel incorporation into hydrogenase 3 1070176 1070637 CDS gene hycA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10474-MONOMER locus_tag OGMAPBJC_01008 product regulator of the transcriptional regulator FhlA 1070762 1071373 CDS gene hycB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYCBSMALL-MONOMER locus_tag OGMAPBJC_01009 product hydrogenase 3, Fe-S subunit 1071370 1073196 CDS gene hycC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYCC-MONOMER locus_tag OGMAPBJC_01010 product hydrogenase 3, membrane subunit 1073199 1074122 CDS gene hycD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYCD-MONOMER locus_tag OGMAPBJC_01011 product hydrogenase 3, membrane subunit 1074140 1075849 CDS gene hycE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYCELARGE-MONOMER locus_tag OGMAPBJC_01012 product hydrogenase 3, large subunit 1075859 1076401 CDS gene hycF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYCF-MONOMER locus_tag OGMAPBJC_01013 product formate hydrogenlyase complex iron-sulfur protein 1076401 1077168 CDS gene hycG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYCG-MONOMER locus_tag OGMAPBJC_01014 product hydrogenase 3 and formate hydrogenlyase complex, HycG subunit 1077165 1077575 CDS gene hycH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10481-MONOMER locus_tag OGMAPBJC_01015 product protein required for maturation of hydrogenase 3 1077568 1078038 CDS gene hycI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7414-MONOMER locus_tag OGMAPBJC_01016 product hydrogenase 3 maturation protease 1079621 1078197 CDS EC_number 3.2.1.86 gene ascB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10085-MONOMER locus_tag OGMAPBJC_01017 product 6-phospho-beta-glucosidase; cryptic 1081087 1079630 CDS EC_number 2.7.1.69 gene ascF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASCF-MONOMER locus_tag OGMAPBJC_01018 product beta-glucoside PTS permease AscF - cryptic 1081344 1082357 CDS gene ascG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10087-MONOMER locus_tag OGMAPBJC_01019 product AscG DNA-binding transcriptional repressor 1082506 1083033 CDS gene hydN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11552-MONOMER locus_tag OGMAPBJC_01020 product putative electron transport protein HydN 1083186 1085438 CDS gene hypF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11551-MONOMER locus_tag OGMAPBJC_01021 product hydrogenase maturation protein, carbamoyltransferase 1086699 1085566 CDS gene norW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12450-MONOMER locus_tag OGMAPBJC_01022 product flavorubredoxin reductase 1088135 1086696 CDS gene norV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7413-MONOMER locus_tag OGMAPBJC_01023 product flavorubredoxin 1088322 1089836 CDS gene norR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12108-MONOMER locus_tag OGMAPBJC_01024 product NorR DNA-binding transcriptional dual regulator 1090798 1089833 CDS EC_number 5.3.1.13 gene gutQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10973-MONOMER locus_tag OGMAPBJC_01025 product D-arabinose 5-phosphate isomerase 1091564 1090791 CDS gene srlR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00283 locus_tag OGMAPBJC_01026 product GutR DNA-binding transcriptional repressor 1091990 1091631 CDS gene gutM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00345 locus_tag OGMAPBJC_01027 product GutM DNA-binding transcriptional activator 1092874 1092095 CDS EC_number 1.1.1.140 gene srlD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SORB6PDEHYDROG-MONOMER locus_tag OGMAPBJC_01028 product sorbitol-6-phosphate dehydrogenase 1093249 1092878 CDS gene srlB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GUTB-MONOMER locus_tag OGMAPBJC_01029 product glucitol/sorbitol PTS permease - SrlB subunit 1094219 1093260 CDS EC_number 2.7.1.69 gene srlE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GUTA-MONOMER locus_tag OGMAPBJC_01030 product glucitol/sorbitol PTS permease - SrlE subunit 1094779 1094216 CDS gene srlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G8210-MONOMER locus_tag OGMAPBJC_01031 product glucitol/sorbitol PTS permease - SrlA subunit 1094930 1096120 CDS EC_number 4.2.2 gene mltB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7410-MONOMER locus_tag OGMAPBJC_01032 product membrane-bound lytic murein transglycosylase B 1096265 1096762 CDS gene pncC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7409-MONOMER locus_tag OGMAPBJC_01033 product NMN aminohydrolase 1096842 1097903 CDS gene recA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10823-MONOMER locus_tag OGMAPBJC_01034 product DNA strand exchange and recombination protein with protease and nuclease activity 1097972 1098472 CDS gene recX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12080-MONOMER locus_tag OGMAPBJC_01035 product inhibitor of RecA 1098600 1101230 CDS EC_number 6.1.1.7 gene alaS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALAS-MONOMER locus_tag OGMAPBJC_01036 product alanyl-tRNA synthetase 1101453 1101716 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01037 product IS3 family transposase IS1222 1101743 1102573 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01038 note IS150 conserved protein InsB product hypothetical protein 1102690 1102875 CDS gene csrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11447-MONOMER locus_tag OGMAPBJC_01039 product carbon storage regulator; pleiotropic regulatory protein for carbon source metabolism 1103191 1103283 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01040 product tRNA-Ser(gct) 1103287 1103363 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01041 product tRNA-Arg(acg) 1103378 1103307 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01042 product tRNA-Arg(tcg) 1103562 1103638 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01043 product tRNA-Arg(acg) 1103701 1103777 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01044 product tRNA-Arg(acg) 1103975 1104051 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01045 product tRNA-Arg(acg) 1104250 1104326 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01046 product tRNA-Arg(acg) 1104607 1105173 CDS gene yqaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7408-MONOMER locus_tag OGMAPBJC_01047 product fructose-1-phosphatase 1105170 1105598 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7407-MONOMER locus_tag OGMAPBJC_01048 note conserved inner membrane protein product hypothetical protein 1105671 1107227 CDS EC_number 6.3.2.2 gene gshA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTCYSLIG-MONOMER locus_tag OGMAPBJC_01049 product gamma-glutamate-cysteine ligase 1107377 1107892 CDS EC_number 4.4.1.21 gene luxS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12712-MONOMER locus_tag OGMAPBJC_01050 product S-ribosylhomocysteine lyase 1109494 1107956 CDS gene emrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EMRB-MONOMER locus_tag OGMAPBJC_01051 product EmrAB-TolC multidrug efflux transport system - membrane subunit 1110683 1109511 CDS gene emrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11354-MONOMER locus_tag OGMAPBJC_01052 product EmrAB-TolC multidrug efflux transport system - membrane fusion protein 1111340 1110810 CDS gene mprA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10603-MONOMER locus_tag OGMAPBJC_01053 product MprA-CCCP 1111766 1111431 CDS gene ygaH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7406-MONOMER locus_tag OGMAPBJC_01054 product L-valine efflux transporter - YgaH subunit 1112493 1111756 CDS gene ygaZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7405-MONOMER locus_tag OGMAPBJC_01055 product L-valine efflux transporter - YgaZ subunit 1113801 1112617 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q9ADP8 locus_tag OGMAPBJC_01056 product putative transporter 1114985 1113993 CDS gene proX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROX-MONOMER locus_tag OGMAPBJC_01057 product glycine betaine / proline ABC transporter - periplasmic binding protein 1116107 1115043 CDS gene proW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROW-MONOMER locus_tag OGMAPBJC_01058 product glycine betaine / proline ABC transporter - membrane subunit 1117302 1116100 CDS gene proV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROV-MONOMER locus_tag OGMAPBJC_01059 product glycine betaine / proline ABC transporter - ATP binding subunit 1118615 1117656 CDS EC_number 1.17.4.1 gene nrdF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NRDF-MONOMER locus_tag OGMAPBJC_01060 product ribonucleoside-diphosphate reductase 2 1120769 1118625 CDS EC_number 1.17.4.1 gene nrdE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NRDE-MONOMER locus_tag OGMAPBJC_01061 product ribonucleoside-diphosphate reductase 2 1121152 1120742 CDS gene nrdI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7402-MONOMER locus_tag OGMAPBJC_01062 product flavodoxin involved in dimanganese-tyrosyl radical cofactor maintenance for ribonucleotide reductase 1121394 1121149 CDS gene nrdH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7401-MONOMER locus_tag OGMAPBJC_01063 product glutaredoxin-like protein 1121971 1121642 CDS gene ygaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0899-MONOMER locus_tag OGMAPBJC_01064 product putative protein 1122123 1122467 CDS gene ygaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12201-MONOMER locus_tag OGMAPBJC_01065 product putative protein 1122953 1122504 CDS gene alaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7399-MONOMER locus_tag OGMAPBJC_01066 product L-alanine exporter 1123622 1124026 CDS gene stpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11554-MONOMER locus_tag OGMAPBJC_01067 product H-NS-like DNA-binding protein with RNA chaperone activity 1124597 1124073 CDS gene ygaP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7398-MONOMER locus_tag OGMAPBJC_01068 product putative inner membrane protein with hydrolase activity 1124906 1124607 CDS gene ygaV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7397-MONOMER locus_tag OGMAPBJC_01069 product putative DNA-binding transcriptional regulator 1125089 1125247 CDS gene yqaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7396-MONOMER locus_tag OGMAPBJC_01070 product putative membrane protein 1125331 1125780 CDS gene ygaU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7395-MONOMER locus_tag OGMAPBJC_01071 product putative protein 1126443 1125781 CDS gene csiR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12386-MONOMER locus_tag OGMAPBJC_01072 product CsiR DNA-binding transcriptional repressor 1127864 1126464 CDS gene gabP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GABP-MONOMER locus_tag OGMAPBJC_01073 product 4-aminobutyrate:H+ symporter 1129382 1128102 CDS EC_number 2.6.1.19 gene gabT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GABATRANSAM-MONOMER locus_tag OGMAPBJC_01074 product 4-aminobutyrate aminotransferase monomer 1130844 1129396 CDS gene gabD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCSEMIALDDEHYDROG-MONOMER locus_tag OGMAPBJC_01075 product succinate-semialdehyde dehydrogenase (NADP+) 1132135 1130867 CDS EC_number 1.1.3.15 gene lhgO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12387-MONOMER locus_tag OGMAPBJC_01076 product L-2-hydroxyglutarate oxidase 1133132 1132155 CDS gene csiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7394-MONOMER locus_tag OGMAPBJC_01077 product putative protein 1134670 1133879 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01078 product hypothetical protein 1135369 1134683 CDS gene ygaQ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7390-MONOMER locus_tag OGMAPBJC_01079 product hypothetical protein 1135720 1135388 CDS gene ygaQ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7389-MONOMER locus_tag OGMAPBJC_01080 product hypothetical protein 1136280 1136355 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01081 product tRNA-Met(cat) 1137106 1137588 CDS gene ypjC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7385-MONOMER locus_tag OGMAPBJC_01082 product putative protein 1137688 1138479 CDS gene ypjB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7384-MONOMER locus_tag OGMAPBJC_01083 product putative protein 1139391 1143971 CDS gene ypjA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7382-MONOMER locus_tag OGMAPBJC_01084 product adhesin-like autotransporter 1146003 1144651 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01085 product hypothetical protein 1147884 1146892 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01086 product hypothetical protein 1148953 1148123 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01087 note IS150 conserved protein InsB product hypothetical protein 1149243 1148980 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01088 product IS3 family transposase IS1222 1149752 1149312 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01089 product hypothetical protein 1150208 1149768 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01090 product hypothetical protein 1151551 1150565 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01091 product hypothetical protein 1152071 1152313 CDS gene insA-1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6086-MONOMER locus_tag OGMAPBJC_01092 product IS1 protein InsA 1152358 1152735 CDS gene insAB-1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2755 locus_tag OGMAPBJC_01093 product InsAB' transposase 1156020 1152781 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01094 product hypothetical protein 1156980 1156150 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01095 note IS150 conserved protein InsB product hypothetical protein 1157270 1157007 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01096 product IS3 family transposase IS1222 1157615 1157304 CDS gene intA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11783-MONOMER locus_tag OGMAPBJC_01097 product CP4-57 prophage; integrase 1158144 1157782 tmRNA gene ssrA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01098 product transfer-messenger RNA, SsrA 1158183 1158058 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01099 product hypothetical protein 1158841 1158359 CDS gene smpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11782-MONOMER locus_tag OGMAPBJC_01100 product small protein B 1158973 1159449 CDS gene ratA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7358-MONOMER locus_tag OGMAPBJC_01101 product 50S ribosomal subunit-binding toxin of a predicted toxin-antitoxin pair 1159439 1159729 CDS gene ratB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7357-MONOMER locus_tag OGMAPBJC_01102 product putative protein 1160132 1159791 CDS gene bamE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10952-MONOMER locus_tag OGMAPBJC_01103 product Outer Membrane Protein Assembly Complex - BamE subunit 1161942 1160281 CDS gene recN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10831-MONOMER locus_tag OGMAPBJC_01104 product protein used in recombination and DNA repair 1162906 1162028 CDS EC_number 2.7.1.23 gene nadK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-541 locus_tag OGMAPBJC_01105 product NAD kinase monomer 1163029 1163622 CDS gene grpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10416-MONOMER locus_tag OGMAPBJC_01106 product phage lambda replication; host DNA synthesis; heat shock protein; protein repair 1164918 1163677 CDS gene yfjD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7356-MONOMER locus_tag OGMAPBJC_01107 product putative inner membrane protein 1165850 1164984 CDS gene ypjD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7355-MONOMER locus_tag OGMAPBJC_01108 product putative inner membrane protein 1165942 1167303 CDS gene ffh inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10300-MONOMER locus_tag OGMAPBJC_01109 product protein component of the signal recognition particle (SRP) 1167552 1167800 CDS gene rpsP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10915-MONOMER locus_tag OGMAPBJC_01110 product 30S ribosomal subunit protein S16 1167819 1168367 CDS gene rimM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11153-MONOMER locus_tag OGMAPBJC_01111 product ribosome maturation protein 1168398 1169165 CDS EC_number 2.1.1.228 gene trmD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11023-MONOMER locus_tag OGMAPBJC_01112 product tRNA m1G37 methyltransferase 1169207 1169554 CDS gene rplS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10880-MONOMER locus_tag OGMAPBJC_01113 product 50S ribosomal subunit protein L19 1170013 1169630 CDS gene yfiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11152-MONOMER locus_tag OGMAPBJC_01114 product putative outer membrane lipoprotein 1171288 1170128 CDS EC_number 2.7.7.65 gene yfiN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12880-MONOMER locus_tag OGMAPBJC_01115 product putative diguanylate cyclase 1171863 1171345 CDS gene yfiR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7354-MONOMER locus_tag OGMAPBJC_01116 product putative periplasmic protein involved in swarming motility 1172375 1172013 CDS gene yfiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12446-MONOMER locus_tag OGMAPBJC_01117 product putative lipoprotein 1172588 1173658 CDS EC_number 2.5.1.54 gene aroF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROF-MONOMER locus_tag OGMAPBJC_01118 product 2-dehydro-3-deoxyphosphoheptonate aldolase 1173669 1174790 CDS EC_number 5.4.99.5 gene tyrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHORISMUTPREPHENDEHYDROG-MONOMER locus_tag OGMAPBJC_01119 product chorismate mutase / prephenate dehydrogenase 1175993 1174833 CDS EC_number 5.4.99.5 gene pheA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHORISMUTPREPHENDEHYDRAT-MONOMER locus_tag OGMAPBJC_01120 product chorismate mutase / prephenate dehydratase 1176584 1176243 CDS gene raiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11151-MONOMER locus_tag OGMAPBJC_01121 product stationary phase translation inhibitor and ribosome stability factor 1177592 1176855 CDS gene bamD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7352-MONOMER locus_tag OGMAPBJC_01122 product Outer Membrane Protein Assembly Complex - BamD subunit 1177727 1178707 CDS gene rluD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12098-MONOMER locus_tag OGMAPBJC_01123 product 23S rRNA pseudouridine synthase 1178704 1179435 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12097-MONOMER locus_tag OGMAPBJC_01124 note conserved protein product hypothetical protein 1179565 1182138 CDS gene clpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10157-MONOMER locus_tag OGMAPBJC_01125 product ClpB chaperone 1182584 1184121 rRNA locus_tag OGMAPBJC_01126 product 16S ribosomal RNA score 0 1184294 1184369 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01127 product tRNA-Glu(ttc) 1184556 1187455 rRNA locus_tag OGMAPBJC_01128 product 23S ribosomal RNA score 0 1187554 1187664 rRNA locus_tag OGMAPBJC_01129 product 5S ribosomal RNA score 1.9e-11 1187992 1189290 CDS gene kgtP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KGTP-MONOMER locus_tag OGMAPBJC_01130 product alpha-ketoglutarate:H+ symporter 1189559 1189287 CDS gene yfiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12857-MONOMER locus_tag OGMAPBJC_01131 product putative protein 1191011 1189656 CDS EC_number 2.7.8.8 gene pssA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSPHASERSYN-MONOMER locus_tag OGMAPBJC_01132 product phosphatidylserine synthase 1193785 1191125 CDS gene pka inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7350-MONOMER locus_tag OGMAPBJC_01133 product peptidyl-lysine acetyltransferase 1194515 1193817 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7349-MONOMER locus_tag OGMAPBJC_01134 note conserved protein product hypothetical protein 1195003 1194584 CDS EC_number 1.8.1.8 db_xref COG:COG0526 gene trxC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AGG4 locus_tag OGMAPBJC_01135 product Thioredoxin 2 1195210 1196247 CDS gene yfiF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11786-MONOMER locus_tag OGMAPBJC_01136 product putative methyltransferase 1196984 1196295 CDS gene ung inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11058-MONOMER locus_tag OGMAPBJC_01137 product uracil-DNA glycosylase 1197289 1197672 CDS gene grcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11784-MONOMER locus_tag OGMAPBJC_01138 product stress-induced alternate pyruvate formate-lyase subunit 1198315 1197728 CDS gene eamB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12445-MONOMER locus_tag OGMAPBJC_01139 product O-Acetylserine/Cysteine Efflux Permease 1198418 1199299 CDS gene yfiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11785-MONOMER locus_tag OGMAPBJC_01140 product putative DNA-binding transcriptional regulator LYSR-type 1200842 1199508 CDS gene srmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10975-MONOMER locus_tag OGMAPBJC_01141 product SrmB, DEAD-box RNA helicase 1200974 1201711 CDS EC_number 2.1.1.55 gene yfiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11538-MONOMER locus_tag OGMAPBJC_01142 product tRNA m6A37 methyltransferase 1203318 1201696 CDS EC_number 1.4.3.16 gene nadB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:L-ASPARTATE-OXID-MONOMER locus_tag OGMAPBJC_01143 product L-aspartate oxidase 1203726 1204301 CDS gene rpoE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOE-MONOMER locus_tag OGMAPBJC_01144 product RNA polymerase, sigma 24 (sigma E) factor 1204334 1204984 CDS gene rseA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12341-MONOMER locus_tag OGMAPBJC_01145 product anti-sigma factor 1204984 1205940 CDS gene rseB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7348-MONOMER locus_tag OGMAPBJC_01146 product anti-sigma factor 1205937 1206416 CDS gene rseC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7347-MONOMER locus_tag OGMAPBJC_01147 product SoxR and Sigma-E factor regulatory protein RseC 1206614 1208413 CDS gene lepA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10529-MONOMER locus_tag OGMAPBJC_01148 product elongation factor 4 1208429 1209403 CDS gene lepB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10530-MONOMER locus_tag OGMAPBJC_01149 product leader peptidase (signal peptidase I) 1209675 1210355 CDS EC_number 3.1.26.3 gene rnc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10857-MONOMER locus_tag OGMAPBJC_01150 product RNase III 1210352 1211257 CDS gene era inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10270-MONOMER locus_tag OGMAPBJC_01151 product GTP-binding protein 1211269 1211997 CDS gene recO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10832-MONOMER locus_tag OGMAPBJC_01152 product protein interacts with RecR and possibly RecF proteins 1212009 1212740 CDS EC_number 2.6.99.2 gene pdxJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PDXJ-MONOMER locus_tag OGMAPBJC_01153 product pyridoxine 5'-phosphate synthase 1212740 1213120 CDS EC_number 2.7.8.7 gene acpS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HOLO-ACP-SYNTH-MONOMER locus_tag OGMAPBJC_01154 product holo-[acyl-carrier-protein] synthase 1213417 1213680 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01155 product IS3 family transposase IS1222 1213707 1214537 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01156 note IS150 conserved protein InsB product hypothetical protein 1215300 1215040 CDS gene yfhL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7346-MONOMER locus_tag OGMAPBJC_01157 product putative 4Fe-4S cluster-containing protein 1216204 1215356 CDS gene yfhH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12308-MONOMER locus_tag OGMAPBJC_01158 product putative DNA-binding transcriptional regulator 1216413 1217048 CDS gene pgpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11371-MONOMER locus_tag OGMAPBJC_01159 product phosphatidylglycerophosphatase C 1217106 1217609 CDS gene tadA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11372-MONOMER locus_tag OGMAPBJC_01160 product tRNA-specific adenosine deaminase monomer 1219162 1217606 CDS EC_number 4.2.2 gene mltF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11373-MONOMER locus_tag OGMAPBJC_01161 product membrane-bound lytic murein transglycosylase F 1219420 1223307 CDS EC_number 6.3.5.3 gene purL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FGAMSYN-MONOMER locus_tag OGMAPBJC_01162 product phosphoribosylformylglycinamide synthetase 1223910 1225292 CDS EC_number 2.7.13.3 gene glrK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P52101 locus_tag OGMAPBJC_01163 product Sensor histidine kinase GlrK 1225457 1226170 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12139-MONOMER locus_tag OGMAPBJC_01164 note conserved protein product hypothetical protein 1226160 1227494 CDS db_xref COG:COG2204 gene qseF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AFU5 locus_tag OGMAPBJC_01165 product Transcriptional regulatory protein QseF 1227555 1227893 CDS db_xref COG:COG0347 gene glnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0A9Z1 locus_tag OGMAPBJC_01166 product Nitrogen regulatory protein P-II 1 1229128 1227938 CDS EC_number 1.14.12.17 gene hmp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10456-MONOMER locus_tag OGMAPBJC_01167 product nitric oxide dioxygenase 1229456 1230709 CDS EC_number 2.1.2.1 gene glyA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYOHMETRANS-MONOMER locus_tag OGMAPBJC_01168 product serine hydroxymethyltransferase 1232100 1230907 CDS gene yphH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7344-MONOMER locus_tag OGMAPBJC_01169 product putative DNA-binding transcriptional regulator, NAGC-like 1232218 1235499 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7343-MONOMER locus_tag OGMAPBJC_01170 note conserved protein product hypothetical protein 1235596 1236579 CDS gene yphF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7342-MONOMER locus_tag OGMAPBJC_01171 product YphD/YphE/YphF ABC transporter 1236602 1238113 CDS gene yphE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YPHE-MONOMER locus_tag OGMAPBJC_01172 product YphD/YphE/YphF ABC transporter 1238138 1239136 CDS gene yphD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YPHD-MONOMER locus_tag OGMAPBJC_01173 product YphD/YphE/YphF ABC transporter 1239202 1240263 CDS gene yphC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YPHC-MONOMER locus_tag OGMAPBJC_01174 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 1240275 1241147 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7338-MONOMER locus_tag OGMAPBJC_01175 note conserved protein product hypothetical protein 1241617 1241195 CDS gene yphA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7337-MONOMER locus_tag OGMAPBJC_01176 product putative inner membrane protein 1242916 1241714 CDS EC_number 1.18.1.3 gene hcaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HCAD-MONOMER locus_tag OGMAPBJC_01177 product 3-phenylpropionate dioxygenase, predicted ferredoxin reductase subunit 1243738 1242926 CDS gene hcaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHENPRODIOLDEHYDROG-MONOMER locus_tag OGMAPBJC_01178 product 2,3-dihydroxy-2,3-dihydrophenylpropionate dehydrogenase 1244055 1243735 CDS gene hcaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HCAC-MONOMER locus_tag OGMAPBJC_01179 product 3-phenylpropionate dioxygenase, predicted ferredoxin subunit 1244573 1244055 CDS EC_number 1.14.12.19 gene hcaF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HCAA2-MONOMER locus_tag OGMAPBJC_01180 product 3-phenylpropionate dioxygenase, beta subunit 1245931 1244570 CDS EC_number 1.14.12.19 gene hcaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHENYLPRODIOXY-MONOMER locus_tag OGMAPBJC_01181 product 3-phenylpropionate dioxygenase, alpha subunit 1246067 1246957 CDS gene hcaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7331-MONOMER locus_tag OGMAPBJC_01182 product HcaR transcriptional dual regulator 1247117 1248256 CDS gene hcaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HCAT-MONOMER locus_tag OGMAPBJC_01183 product HcaT MFS transporter 1249528 1248248 CDS gene csiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7329-MONOMER locus_tag OGMAPBJC_01184 product stationary phase inducible protein 1250573 1249719 CDS gene yfhR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7328-MONOMER locus_tag OGMAPBJC_01185 product putative peptidase 1251521 1250718 CDS EC_number 3.1.3.25 gene suhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10983-MONOMER locus_tag OGMAPBJC_01186 product inositol monophosphatase 1251640 1252380 CDS gene trmJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7327-MONOMER locus_tag OGMAPBJC_01187 product tRNA Cm32/Um32 methyltransferase 1252832 1253320 CDS gene iscR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7326-MONOMER locus_tag OGMAPBJC_01188 product IscR DNA-binding transcriptional dual regulator 1253432 1254646 CDS EC_number 2.8.1.7 gene iscS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7325-MONOMER locus_tag OGMAPBJC_01189 product cysteine desulfurase monomer 1254674 1255060 CDS gene iscU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7324-MONOMER locus_tag OGMAPBJC_01190 product scaffold protein for iron-sulfur cluster assembly 1255077 1255400 CDS gene iscA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12132-MONOMER locus_tag OGMAPBJC_01191 product iron-sulfur cluster assembly protein 1255496 1256011 CDS gene hscB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12131-MONOMER locus_tag OGMAPBJC_01192 product Hsc20 co-chaperone that acts with Hsc66 in IscU iron-sulfur cluster assembly 1256028 1257878 CDS gene hscA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12130-MONOMER locus_tag OGMAPBJC_01193 product chaperone, member of Hsp70 protein family 1257880 1258215 CDS db_xref COG:COG0633 gene fdx inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0A9R4 locus_tag OGMAPBJC_01194 product 2Fe-2S ferredoxin 1258227 1258427 CDS gene iscX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12311-MONOMER locus_tag OGMAPBJC_01195 product protein with possible role in iron-sulfur cluster biogenesis 1258605 1259888 CDS gene pepB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12310-MONOMER locus_tag OGMAPBJC_01196 product aminopeptidase B 1260030 1260806 CDS gene sseB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11601-MONOMER locus_tag OGMAPBJC_01197 product overproduction causes enhanced serine sensitivity 1262469 1261624 CDS EC_number 2.8.1.2 gene sseA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11600-MONOMER locus_tag OGMAPBJC_01198 product hydrogen sulfide synthesis [multifunctional] 1262676 1267637 CDS gene yfhM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7323-MONOMER locus_tag OGMAPBJC_01199 product alpha-macroglobulin 1267677 1269950 CDS gene pbpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7322-MONOMER locus_tag OGMAPBJC_01200 product peptidoglycan glycosyltransferase 1270099 1270530 CDS EC_number 2.7.4.6 gene ndk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUCLEOSIDE-DIP-KIN-MONOMER locus_tag OGMAPBJC_01201 product nucleoside diphosphate kinase 1270680 1271834 CDS EC_number 2.1.1.192 gene rlmN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12401-MONOMER locus_tag OGMAPBJC_01202 product 23S rRNA methyltransferase and tRNA m2A37 methyltransferase 1272119 1273132 CDS gene rodZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10015-MONOMER locus_tag OGMAPBJC_01203 product transmembrane component of cytoskeleton 1273159 1274277 CDS EC_number 1.17.7.1 gene ispG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10370-MONOMER locus_tag OGMAPBJC_01204 product 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase 1274388 1275662 CDS EC_number 6.1.1.21 gene hisS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISS-MONOMER locus_tag OGMAPBJC_01205 product histidyl-tRNA synthetase 1275680 1276300 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7321-MONOMER locus_tag OGMAPBJC_01206 note conserved protein product hypothetical protein 1276311 1277489 CDS gene bamB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7320-MONOMER locus_tag OGMAPBJC_01207 product Outer Membrane Protein Assembly Complex - BamB subunit 1277607 1279079 CDS gene der inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7319-MONOMER locus_tag OGMAPBJC_01208 product 50S ribosomal subunit stability factor 1279149 1279364 CDS gene yfgJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7318-MONOMER locus_tag OGMAPBJC_01209 product putative protein 1280731 1279361 CDS EC_number 3.1.11.6 gene xseA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11072-MONOMER locus_tag OGMAPBJC_01210 product exonuclease VII, large subunit 1280893 1282359 CDS EC_number 1.1.1.205 gene guaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:IMP-DEHYDROG-MONOMER locus_tag OGMAPBJC_01211 product IMP dehydrogenase 1282428 1284005 CDS EC_number 6.3.5.2 gene guaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GMP-SYN-MONOMER locus_tag OGMAPBJC_01212 product GMP synthetase 1284637 1284098 CDS gene yfgI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7317-MONOMER locus_tag OGMAPBJC_01213 product putative membrane protein 1285168 1284653 CDS gene yfgH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7316-MONOMER locus_tag OGMAPBJC_01214 product putative lipoprotein 1285655 1285482 CDS gene yfgG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7315-MONOMER locus_tag OGMAPBJC_01215 product putative protein 1285691 1285843 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01216 product hypothetical protein 1286025 1288268 CDS EC_number 3.1.4.52 gene yfgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7314-MONOMER locus_tag OGMAPBJC_01217 product cyclic di-GMP phosphodiesterase 1289848 1288307 CDS EC_number 3.6.1.11 gene ppx inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PPX-MONOMER locus_tag OGMAPBJC_01218 product exopolyphosphatase monomer 1291919 1289853 CDS EC_number 2.7.4.1 gene ppk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PPK-MONOMER locus_tag OGMAPBJC_01219 product degradosome 1292729 1292091 CDS EC_number 2.1.2.2 gene purN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GART-MONOMER locus_tag OGMAPBJC_01220 product phosphoribosylglycinamide formyltransferase 1 1293766 1292729 CDS EC_number 6.3.3.1 gene purM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AIRS-MONOMER locus_tag OGMAPBJC_01221 product phosphoribosylformylglycinamide cyclo-ligase 1294091 1294717 CDS EC_number 2.4.2.9 gene upp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:URACIL-PRIBOSYLTRANS-MONOMER locus_tag OGMAPBJC_01222 product uracil phosphoribosyltransferase 1294803 1296092 CDS gene uraA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:URAA-MONOMER locus_tag OGMAPBJC_01223 product uracil:H+ symporter 1296142 1296888 CDS gene hda inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7313-MONOMER locus_tag OGMAPBJC_01224 product regulator of DnaA that prevents premature reinitiation of DNA replication 1297385 1297026 CDS gene yfgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7312-MONOMER locus_tag OGMAPBJC_01225 product putative oxidoreductase 1298869 1297406 CDS gene yfgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7311-MONOMER locus_tag OGMAPBJC_01226 product periplasmic protein YfgC 1299082 1300143 CDS gene yfgO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7310-MONOMER locus_tag OGMAPBJC_01227 product putative inner membrane protein 1301029 1300181 CDS gene focB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FOCB-MONOMER locus_tag OGMAPBJC_01228 product FocB formate FNT transporter 1303063 1301051 CDS gene hyfR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7308-MONOMER locus_tag OGMAPBJC_01229 product HyfR DNA-binding transcriptional activator 1303506 1303093 CDS gene hyfJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7307-MONOMER locus_tag OGMAPBJC_01230 product hydrogenase 4 component J, putative protein processing element 1304257 1303499 CDS gene hyfI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-151 locus_tag OGMAPBJC_01231 product hydrogenase 4, small subunit 1304799 1304254 CDS gene hyfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-144 locus_tag OGMAPBJC_01232 product hydrogenase 4, component H 1306476 1304809 CDS gene hyfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-150 locus_tag OGMAPBJC_01233 product hydrogenase 4, large subunit 1308046 1306466 CDS gene hyfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-143 locus_tag OGMAPBJC_01234 product hydrogenase 4, component F 1308701 1308051 CDS gene hyfE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-142 locus_tag OGMAPBJC_01235 product hydrogenase 4, component E 1310152 1308713 CDS gene hyfD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-141 locus_tag OGMAPBJC_01236 product hydrogenase 4, component D 1311116 1310169 CDS gene hyfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-154 locus_tag OGMAPBJC_01237 product hydrogenase 4, component C 1312476 1311127 CDS gene hyfB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-153 locus_tag OGMAPBJC_01238 product hydrogenase 4, component B 1313144 1312473 CDS gene hyfB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-153 locus_tag OGMAPBJC_01239 product hydrogenase 4, component B 1313761 1313144 CDS gene hyfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-152 locus_tag OGMAPBJC_01240 product hydrogenase 4, component A 1314484 1314014 CDS gene bcp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10108-MONOMER locus_tag OGMAPBJC_01241 product thiol peroxidase 1315056 1314484 CDS gene gcvR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11149-MONOMER locus_tag OGMAPBJC_01242 product GcvR predicted transcriptional regulator 1315202 1316080 CDS EC_number 4.2.1.52 gene dapA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIHYDRODIPICSYN-MONOMER locus_tag OGMAPBJC_01243 product 4-hydroxy-tetrahydrodipicolinate synthase 1316097 1317131 CDS gene bamC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10658-MONOMER locus_tag OGMAPBJC_01244 product Outer Membrane Protein Assembly Complex - BamC subunit 1317272 1317042 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01245 product hypothetical protein 1317344 1318057 CDS EC_number 6.3.2.6 gene purC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SAICARSYN-MONOMER locus_tag OGMAPBJC_01246 product phosphoribosylaminoimidazole-succinocarboxamide synthase 1318225 1319088 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7298-MONOMER locus_tag OGMAPBJC_01247 note conserved protein product hypothetical protein 1319103 1321118 CDS gene tmcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7297-MONOMER locus_tag OGMAPBJC_01248 product tRNAMet cytidine acetyltransferase 1321192 1321890 CDS gene ypfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7296-MONOMER locus_tag OGMAPBJC_01249 product esterase 1322200 1322000 CDS gene ypfN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2685 locus_tag OGMAPBJC_01250 product putative protein 1323355 1322228 CDS EC_number 3.5.1.18 gene dapE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1981 locus_tag OGMAPBJC_01251 product N-succinyl-L-diaminopimelate desuccinylase subunit 1323715 1323359 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11147-MONOMER locus_tag OGMAPBJC_01252 note conserved protein product hypothetical protein 1327367 1324254 CDS gene acrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACRD-MONOMER locus_tag OGMAPBJC_01253 product AcrAD-TolC multidrug efflux transport system - permease subunit 1329231 1327531 CDS EC_number 2.7.13.3 gene narQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P27896 locus_tag OGMAPBJC_01254 product Nitrate/nitrite sensor protein NarQ 1329437 1331416 CDS gene aegA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12409-MONOMER locus_tag OGMAPBJC_01255 product putative oxidoreductase, Fe-S subunit 1331484 1332059 CDS gene nudK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12410-MONOMER locus_tag OGMAPBJC_01256 product GDP-mannose hydrolase 1332185 1333228 CDS gene ypfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7295-MONOMER locus_tag OGMAPBJC_01257 product putative protein 1335312 1333303 CDS EC_number 2.2.1.1 gene tktB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRANSKETOII-MONOMER locus_tag OGMAPBJC_01258 product transketolase II 1336282 1335332 CDS EC_number 2.2.1.2 gene talA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRANSALDOLA-MONOMER locus_tag OGMAPBJC_01259 product transaldolase A 1336571 1338850 CDS EC_number 1.1.1.40 gene maeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALIC-NADP-MONOMER locus_tag OGMAPBJC_01260 product malate dehydrogenase 1339143 1339478 CDS gene eutS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7292-MONOMER locus_tag OGMAPBJC_01261 product putative structural protein, ethanolamine utilization microcompartment 1339491 1339970 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7291-MONOMER locus_tag OGMAPBJC_01262 note conserved protein with nucleoside triphosphate hydrolase domain product hypothetical protein 1339945 1340646 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7290-MONOMER locus_tag OGMAPBJC_01263 note conserved protein product hypothetical protein 1340643 1341446 CDS EC_number 2.5.1.17 gene eutT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7289-MONOMER locus_tag OGMAPBJC_01264 product putative cobalamine adenosyltransferase in ethanolamine utilization 1341443 1342459 CDS gene eutD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7288-MONOMER locus_tag OGMAPBJC_01265 product phosphate acetyltransferase monomer 1342498 1342791 CDS gene eutM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7287-MONOMER locus_tag OGMAPBJC_01266 product putative structural protein, ethanolamine utilization microcompartment 1342898 1343185 CDS gene eutN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7286-MONOMER locus_tag OGMAPBJC_01267 product putative carboxysome structural protein 1343197 1344600 CDS gene eutE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7285-MONOMER locus_tag OGMAPBJC_01268 product putative aldehyde dehydrogenase, ethanolamine utilization protein 1344611 1345447 CDS gene eutJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7284-MONOMER locus_tag OGMAPBJC_01269 product putative chaperonin, ethanolamine utilization protein 1345437 1346624 CDS gene eutG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7283-MONOMER locus_tag OGMAPBJC_01270 product putative alcohol dehydrogenase in ethanolamine utilization 1346841 1348067 CDS gene eutH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7282-MONOMER locus_tag OGMAPBJC_01271 product putative inner membrane protein 1348064 1349467 CDS gene eutA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7281-MONOMER locus_tag OGMAPBJC_01272 product reactivating factor for ethanolamine ammonia-lyase EutBC 1349479 1350840 CDS EC_number 4.3.1.7 gene eutB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EUTB-MONOMER locus_tag OGMAPBJC_01273 product ethanolamine ammonia-lyase, alpha subunit 1350861 1351748 CDS EC_number 4.3.1.7 gene eutC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EUTC-MONOMER locus_tag OGMAPBJC_01274 product ethanolamine ammonia-lyase, beta subunit 1351758 1352417 CDS gene eutL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7271-MONOMER locus_tag OGMAPBJC_01275 product putative structural protein, ethanolamine utilization microcompartment 1352430 1352930 CDS gene eutK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7270-MONOMER locus_tag OGMAPBJC_01276 product putative structural protein, ethanolamine utilization microcompartment 1352976 1354028 CDS gene eutR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12190-MONOMER locus_tag OGMAPBJC_01277 product putative ARAC-type regulatory protein 1354933 1354034 CDS EC_number 1.3.3.3 gene hemF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:COPROGENOXI-MONOMER locus_tag OGMAPBJC_01278 product coproporphyrinogen III oxidase 1355806 1354937 CDS EC_number 3.5.1.28 gene amiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NACMURLALAAMI1-MONOMER locus_tag OGMAPBJC_01279 product N-acetylmuramoyl-L-alanine amidase 1 1356020 1356445 CDS gene ypeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7269-MONOMER locus_tag OGMAPBJC_01280 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 1356432 1356881 CDS gene yfeZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7268-MONOMER locus_tag OGMAPBJC_01281 product putative inner membrane protein 1356942 1357517 CDS gene yfeY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7267-MONOMER locus_tag OGMAPBJC_01282 product putative outer membrane lipoprotein 1357613 1358512 CDS gene yfeX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7266-MONOMER locus_tag OGMAPBJC_01283 product porphyrinogen peroxidase 1360056 1358752 CDS gene yfeW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7265-MONOMER locus_tag OGMAPBJC_01284 product penicillin binding protein 4B 1361485 1360061 CDS EC_number 2.7.1.69 gene murP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-5 locus_tag OGMAPBJC_01285 product N-acetylmuramic acid PTS permease - MurP subunit 1362385 1361489 CDS gene murQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7263-MONOMER locus_tag OGMAPBJC_01286 product N-acetylmuramic acid 6-phosphate etherase 1362549 1363406 CDS gene murR_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7262-MONOMER locus_tag OGMAPBJC_01287 product MurR-MurNAc-6-P 1363535 1364326 CDS gene ucpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12133-MONOMER locus_tag OGMAPBJC_01288 product putative oxidoreductase 1364630 1365646 CDS gene cysP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSP-MONOMER locus_tag OGMAPBJC_01289 product sulfate / thiosulfate ABC transporter - periplasmic binding protein CysP 1365646 1366479 CDS gene cysU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYST-MONOMER locus_tag OGMAPBJC_01290 product sulfate / thiosulfate ABC transporter - membrane subunit 1366479 1367354 CDS gene cysW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSW-MONOMER locus_tag OGMAPBJC_01291 product sulfate / thiosulfate ABC transporter - membrane subunit 1367344 1368441 CDS EC_number 3.6.3.25 gene cysA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSA-MONOMER locus_tag OGMAPBJC_01292 product sulfate / thiosulfate ABC transporter - ATP binding subunit 1368575 1369486 CDS EC_number 2.5.1.47 gene cysM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACSERLYB-MONOMER locus_tag OGMAPBJC_01293 product cysteine synthase B 1370409 1369675 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7261-MONOMER locus_tag OGMAPBJC_01294 note conserved protein product hypothetical protein 1370816 1370442 CDS gene yfeK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7260-MONOMER locus_tag OGMAPBJC_01295 product putative protein 1370921 1371772 CDS EC_number 2.7.1.35 gene pdxK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PDXK-MONOMER locus_tag OGMAPBJC_01296 product pyridoxamine kinase / hydroxymethylpyrimidine kinase / pyridoxal kinase 1372324 1371815 CDS gene crr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CRR-MONOMER locus_tag OGMAPBJC_01297 product glucose PTS permease 1374092 1372365 CDS EC_number 2.7.3.9 gene ptsI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PTSI-MONOMER locus_tag OGMAPBJC_01298 product PTS enzyme I 1374394 1374137 CDS gene fruB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRUB-MONOMER locus_tag OGMAPBJC_01299 product fructose PTS permease - FruB subunit 1375749 1374778 CDS EC_number 2.5.1.47 gene cysK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACSERLYA-MONOMER locus_tag OGMAPBJC_01300 product bifunctional CysEK cysteine biosynthesis complex 1376695 1375934 CDS gene cysZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10003-MONOMER locus_tag OGMAPBJC_01301 product putative inner membrane protein 1376925 1377911 CDS gene zipA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7258-MONOMER locus_tag OGMAPBJC_01302 product essential cell division protein ZipA 1377982 1379997 CDS EC_number 6.5.1.2 gene ligA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10534-MONOMER locus_tag OGMAPBJC_01303 product DNA ligase 1379999 1380217 CDS gene ypeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2684 locus_tag OGMAPBJC_01304 product putative protein 1381212 1380214 CDS gene yfeH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12376-MONOMER locus_tag OGMAPBJC_01305 product putative cytochrome oxidase 1381302 1382228 CDS gene yfeR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7257-MONOMER locus_tag OGMAPBJC_01306 product putative DNA-binding transcriptional regulator, LYSR-type 1383031 1382267 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7256-MONOMER locus_tag OGMAPBJC_01307 note conserved outer membrane protein product hypothetical protein 1383280 1384113 CDS gene xapA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XANTHOSINEPHOSPHORY-MONOMER locus_tag OGMAPBJC_01308 product xanthosine phosphorylase 1384173 1385429 CDS gene xapB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XAPB-MONOMER locus_tag OGMAPBJC_01309 product xanthosine:H+ symporter XapB 1385681 1386565 CDS gene xapR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11146-MONOMER locus_tag OGMAPBJC_01310 product XapR transcriptional activator 1386905 1386830 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01311 product tRNA-Lys(ttt) 1386985 1386910 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01312 product tRNA-Val(tac) 1387107 1387032 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01313 product tRNA-Val(tac) 1387227 1387152 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01314 product tRNA-Val(tac) 1387486 1388901 CDS EC_number 6.1.1.17 gene gltX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLURS-MONOMER locus_tag OGMAPBJC_01315 product glutamyl-tRNA synthetase 1389324 1388953 CDS gene yfeD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11432-MONOMER locus_tag OGMAPBJC_01316 product putative DNA-binding transcriptional regulator 1389706 1389347 CDS gene yfeC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11431-MONOMER locus_tag OGMAPBJC_01317 product putative DNA-binding transcriptional regulator 1389927 1390002 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01318 product tRNA-Ala(ggc) 1390042 1390117 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01319 product tRNA-Ala(ggc) 1390326 1392515 CDS gene yfeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11145-MONOMER locus_tag OGMAPBJC_01320 product putative diguanylate cyclase 1392599 1393711 CDS gene insL-3_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7255-MONOMER locus_tag OGMAPBJC_01321 product putative IS186/IS421 transposase 1393734 1393874 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01322 product hypothetical protein 1395116 1393914 CDS gene nupC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUPC-MONOMER locus_tag OGMAPBJC_01323 product nucleoside:H+ symporter NupC 1395452 1396690 CDS gene mntH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YFEP-MONOMER locus_tag OGMAPBJC_01324 product Mn(2+) / Fe(2+): H+ symporter MntH 1397157 1396831 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7252-MONOMER locus_tag OGMAPBJC_01325 note conserved protein product hypothetical protein 1398528 1397272 CDS gene yfeO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7251-MONOMER locus_tag OGMAPBJC_01326 product putative ion channel protein 1398732 1399697 CDS EC_number 2.7.1.2 gene glk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUCOKIN-MONOMER locus_tag OGMAPBJC_01327 product glucokinase 1399916 1400242 CDS EC_number 2.7.1.69 gene fryB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7250-MONOMER locus_tag OGMAPBJC_01328 product putative enzyme IIB component of PTS 1400264 1401511 CDS gene fryC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-6 locus_tag OGMAPBJC_01329 product putative enzyme IIC component of PTS 1401526 1402611 CDS gene ypdF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7248-MONOMER locus_tag OGMAPBJC_01330 product aminopeptidase 1402611 1403648 CDS gene ypdE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7247-MONOMER locus_tag OGMAPBJC_01331 product broad-specificity examinopeptidase 1403673 1406168 CDS EC_number 2.7.3.9 gene fryA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7246-MONOMER locus_tag OGMAPBJC_01332 product fused predicted PTS system enzymes: Hpr component, enzyme I component, enzyme IIA component 1407028 1406171 CDS gene ypdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7245-MONOMER locus_tag OGMAPBJC_01333 product putative ARAC-type regulatory protein 1407775 1407041 CDS gene ypdB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7244-MONOMER locus_tag OGMAPBJC_01334 product putative response regulator in two-component system with YpdA 1409487 1407790 CDS gene ypdA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7243-MONOMER locus_tag OGMAPBJC_01335 product putative sensory kinase in two-component system with YpdB 1409863 1411101 CDS EC_number 2.6.1.2 gene alaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7242-MONOMER locus_tag OGMAPBJC_01336 product glutamate-pyruvate aminotransferase 1412513 1411593 CDS gene lpxP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PALMITOTRANS-MONOMER locus_tag OGMAPBJC_01337 product palmitoleoyl acyltransferase 1412866 1413108 CDS gene yfdY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7240-MONOMER locus_tag OGMAPBJC_01338 product putative inner membrane protein 1413460 1413185 CDS gene ypdI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7239-MONOMER locus_tag OGMAPBJC_01339 product YpdI colanic acid synthesis lipoprotein 1413756 1414391 CDS gene yfdX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7238-MONOMER locus_tag OGMAPBJC_01340 product putative protein 1414904 1416154 CDS EC_number 2.8.3.16 gene frc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7237-MONOMER locus_tag OGMAPBJC_01341 product formyl-CoA transferase monomer 1416208 1417902 CDS EC_number 4.1.1.8 gene oxc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7236-MONOMER locus_tag OGMAPBJC_01342 product oxalyl-CoA decarboxylase 1417972 1418916 CDS gene yfdV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2372-MONOMER locus_tag OGMAPBJC_01343 product YfdV AEC Transporter 1418990 1420135 CDS gene yfdE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7234-MONOMER locus_tag OGMAPBJC_01344 product putative CoA transferase, NAD(P)-binding 1423733 1420191 CDS EC_number 2.7.13.3 db_xref COG:COG0784 gene evgS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P30855 locus_tag OGMAPBJC_01345 product Sensor protein EvgS 1424403 1423789 CDS gene fimZ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_01346 product FimZ transcriptional regulator 1424819 1425982 CDS gene emrK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7233-MONOMER locus_tag OGMAPBJC_01347 product EmrKY-TolC multidrug efflux transport system - membrane fusion protein 1425982 1427520 CDS gene emrY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EMRY-MONOMER locus_tag OGMAPBJC_01348 product EmrKY putative multidrug efflux transporter - membrane subunit 1428956 1427628 CDS EC_number 4.3.1.18 gene dsdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DSERDEAM-MONOMER locus_tag OGMAPBJC_01349 product D-serine ammonia-lyase 1430311 1428974 CDS gene dsdX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DSDX-MONOMER locus_tag OGMAPBJC_01350 product D-serine transporter 1430529 1431464 CDS gene dsdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00297 locus_tag OGMAPBJC_01351 product DsdC DNA-binding transcriptional dual regulator 1431634 1431560 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01352 product tRNA-Arg(cct) 1432642 1431710 CDS gene yfdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7217-MONOMER locus_tag OGMAPBJC_01353 product putative inner membrane protein 1432936 1433691 CDS gene mlaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7216-MONOMER locus_tag OGMAPBJC_01354 product MlaA 1434931 1433873 CDS gene yfdF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7215-MONOMER locus_tag OGMAPBJC_01355 product putative protein 1436637 1435297 CDS gene fadL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10280-MONOMER locus_tag OGMAPBJC_01356 product long-chain fatty acid outer membrane porin; bacteriophage T2 binding protein 1437009 1437293 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7214-MONOMER locus_tag OGMAPBJC_01357 note conserved protein product hypothetical protein 1437474 1438784 CDS EC_number 2.3.1.16 gene fadI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7213-MONOMER locus_tag OGMAPBJC_01358 product FadI monomer 1438784 1440928 CDS EC_number 5.1.2.3 gene fadJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7212-MONOMER locus_tag OGMAPBJC_01359 product FadJ monomer 1441131 1441616 CDS gene sixA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7211-MONOMER locus_tag OGMAPBJC_01360 product phosphohistidine phosphatase 1442297 1442860 CDS gene yfcV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7210-MONOMER locus_tag OGMAPBJC_01361 product putative fimbrial-like adhesin protein 1442942 1445587 CDS db_xref COG:COG3188 gene papC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P07110 locus_tag OGMAPBJC_01362 product Outer membrane usher protein PapC 1445607 1446359 CDS gene yfcS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7207-MONOMER locus_tag OGMAPBJC_01363 product putative periplasmic pilus chaperone 1446359 1446871 CDS gene yfcR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7206-MONOMER locus_tag OGMAPBJC_01364 product putative fimbrial-like adhesin protein 1446868 1447356 CDS gene yfcQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7205-MONOMER locus_tag OGMAPBJC_01365 product putative fimbrial-like adhesin protein 1447353 1447892 CDS gene yfcP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7204-MONOMER locus_tag OGMAPBJC_01366 product putative fimbrial-like adhesin protein 1447894 1448715 CDS gene yfcO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7203-MONOMER locus_tag OGMAPBJC_01367 product putative protein 1449337 1448786 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7202-MONOMER locus_tag OGMAPBJC_01368 note conserved protein, predicted endonuclease product hypothetical protein 1449503 1450435 CDS gene prmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12449-MONOMER locus_tag OGMAPBJC_01369 product protein-glutamine N-methyltransferase 1450470 1451555 CDS EC_number 4.2.3.5 gene aroC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROC-MONOMER locus_tag OGMAPBJC_01370 product chorismate synthase 1451559 1452383 CDS gene mepA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10580-MONOMER locus_tag OGMAPBJC_01371 product murein DD-endopeptidase, penicillin-insensitive 1452383 1453141 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11144-MONOMER locus_tag OGMAPBJC_01372 note conserved inner membrane structural protein product hypothetical protein 1453192 1453740 CDS gene epmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7201-MONOMER locus_tag OGMAPBJC_01373 product EF-P-Lys34 hydroxylase 1453774 1454052 CDS gene yfcL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7200-MONOMER locus_tag OGMAPBJC_01374 product putative protein 1456179 1454173 CDS EC_number 2.1.1.61 gene mnmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7199-MONOMER locus_tag OGMAPBJC_01375 product fused 5-methylaminomethyl-2-thiouridine-forming methyltransferase and FAD-dependent demodification enzyme 1456338 1457558 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FABB-MONOMER locus_tag OGMAPBJC_01376 note KASI product hypothetical protein 1457823 1459001 CDS gene yfcJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2322-MONOMER locus_tag OGMAPBJC_01377 product putative transport protein YfcJ 1459993 1458998 CDS gene flk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10229-MONOMER locus_tag OGMAPBJC_01378 product putative flagella assembly protein 1460092 1461228 CDS EC_number 1.1.1.290 gene pdxB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ERYTHRON4PDEHYDROG-MONOMER locus_tag OGMAPBJC_01379 product erythronate-4-phosphate dehydrogenase 1461294 1462307 CDS gene usg inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11059-MONOMER locus_tag OGMAPBJC_01380 product putative semialdehyde dehydrogenase 1462307 1463119 CDS EC_number 5.4.99.12 gene truA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10454-MONOMER locus_tag OGMAPBJC_01381 product tRNA pseudouridine synthase I 1463202 1463861 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10216-MONOMER locus_tag OGMAPBJC_01382 note conserved inner membrane protein product hypothetical protein 1464017 1464931 CDS EC_number 6.4.1.2 gene accD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARBOXYL-TRANSFERASE-BETA-MONOMER locus_tag OGMAPBJC_01383 product acetyl-CoA carboxyltransferase, beta subunit 1465001 1466269 CDS EC_number 6.3.2.17 gene folC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FOLC-MONOMER locus_tag OGMAPBJC_01384 product bifunctional folylpolyglutamate synthetase / dihydrofolate synthetase 1466259 1466921 CDS gene dedD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10218-MONOMER locus_tag OGMAPBJC_01385 product cell division protein DedD 1467180 1467668 CDS gene cvpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10169-MONOMER locus_tag OGMAPBJC_01386 product membrane protein required for colicin V production 1467705 1469222 CDS EC_number 2.4.2.14 gene purF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PRPPAMIDOTRANS-MONOMER locus_tag OGMAPBJC_01387 product amidophosphoribosyl transferase 1469317 1469886 CDS gene ubiX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UBIX-MONOMER locus_tag OGMAPBJC_01388 product 3-octaprenyl-4-hydroxybenzoate decarboxylase together with UbiG 1470152 1470934 CDS gene argT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGT-MONOMER locus_tag OGMAPBJC_01389 product lysine / arginine / ornithine ABC transporter - periplasmic binding protein 1471155 1471937 CDS gene hisJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISJ-MONOMER locus_tag OGMAPBJC_01390 product histidine ABC transporter - periplasmic binding protein 1472027 1472713 CDS gene hisQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISQ-MONOMER locus_tag OGMAPBJC_01391 product lysine / arginine / ornithine ABC transporter / histidine ABC transporter - membrane subunit 1472710 1473426 CDS gene hisM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISM-MONOMER locus_tag OGMAPBJC_01392 product lysine/arginine/ornithine ABC transporter / histidine ABC transporter - membrane subunit 1473434 1474207 CDS gene hisP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISP-MONOMER locus_tag OGMAPBJC_01393 product lysine / arginine / ornithine ABC transporter / histidine ABC transporter - ATP binding subunit 1474404 1475294 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7197-MONOMER locus_tag OGMAPBJC_01394 note conserved protein product hypothetical protein 1476235 1475342 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7196-MONOMER locus_tag OGMAPBJC_01395 note conserved protein with NAD(P)-binding Rossmann-fold domain product hypothetical protein 1476618 1476256 CDS gene folX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:H2NTPEPIM-MONOMER locus_tag OGMAPBJC_01396 product dihydroneopterin triphosphate 2'-epimerase monomer 1477322 1476675 CDS gene yfcG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7194-MONOMER locus_tag OGMAPBJC_01397 product disulfide bond reductase 1477458 1478102 CDS gene yfcF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7193-MONOMER locus_tag OGMAPBJC_01398 product glutathione S-transferase 1478158 1478709 CDS gene yfcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7192-MONOMER locus_tag OGMAPBJC_01399 product phosphodiesterase 1478767 1479309 CDS gene yfcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7191-MONOMER locus_tag OGMAPBJC_01400 product putative Nudix hydrolase 1480820 1479342 CDS gene yfcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7190-MONOMER locus_tag OGMAPBJC_01401 product putative inner membrane protein; putative S-transferase 1483196 1481052 CDS EC_number 2.3.1.8 gene pta inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSACETYLTRANS-MONOMER locus_tag OGMAPBJC_01402 product phosphate acetyltransferase / phosphate propionyltransferase 1484473 1483271 CDS EC_number 2.7.2.1 gene ackA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETATEKINA-MONOMER locus_tag OGMAPBJC_01403 product acetate kinase 1484811 1485266 CDS gene yfbV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7189-MONOMER locus_tag OGMAPBJC_01404 product protein involved in regulation of chromosome structure 1485349 1485843 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7188-MONOMER locus_tag OGMAPBJC_01405 note conserved protein product hypothetical protein 1485854 1486504 CDS EC_number 3.1.3.23 gene yfbT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7187-MONOMER locus_tag OGMAPBJC_01406 product sugar phosphatase 1486591 1488423 CDS gene yfbS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7186-MONOMER locus_tag OGMAPBJC_01407 product putative transport protein 1489081 1488482 CDS EC_number 3.1.3.5 gene yfbR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7185-MONOMER locus_tag OGMAPBJC_01408 product dCMP phosphohydrolase 1490382 1489165 CDS EC_number 2.6.1.2 gene alaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7184-MONOMER locus_tag OGMAPBJC_01409 product glutamate-pyruvate aminotransferase 1491302 1492240 CDS gene lrhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12123-MONOMER locus_tag OGMAPBJC_01410 product LrhA DNA-binding transcriptional dual regulator 1492608 1492444 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01411 product hypothetical protein 1492871 1493314 CDS gene nuoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOA-MONOMER locus_tag OGMAPBJC_01412 product NADH:ubiquinone oxidoreductase, membrane subunit A 1493330 1493992 CDS gene nuoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOB-MONOMER locus_tag OGMAPBJC_01413 product NADH:ubiquinone oxidoreductase, chain B 1494086 1495888 CDS gene nuoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOC-MONOMER locus_tag OGMAPBJC_01414 product NADH:ubiquinone oxidoreductase, chain CD 1495891 1496391 CDS EC_number 1.6.99.5 gene nuoE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOE-MONOMER locus_tag OGMAPBJC_01415 product NADH:ubiquinone oxidoreductase, chain E 1496388 1497725 CDS EC_number 1.6.99.5 gene nuoF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOF-MONOMER locus_tag OGMAPBJC_01416 product NADH:ubiquinone oxidoreductase, chain F 1497778 1500504 CDS EC_number 1.6.99.5 gene nuoG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOG-MONOMER locus_tag OGMAPBJC_01417 product NADH:ubiquinone oxidoreductase, chain G 1500501 1501478 CDS EC_number 1.6.99.5 gene nuoH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOH-MONOMER locus_tag OGMAPBJC_01418 product NADH:ubiquinone oxidoreductase, membrane subunit H 1501493 1502035 CDS EC_number 1.6.99.5 gene nuoI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOI-MONOMER locus_tag OGMAPBJC_01419 product NADH:ubiquinone oxidoreductase, chain I 1502047 1502601 CDS gene nuoJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOJ-MONOMER locus_tag OGMAPBJC_01420 product NADH:ubiquinone oxidoreductase, membrane subunit J 1502598 1502900 CDS gene nuoK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOK-MONOMER locus_tag OGMAPBJC_01421 product NADH:ubiquinone oxidoreductase, membrane subunit K 1502897 1504738 CDS EC_number 1.6.99.5 gene nuoL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOL-MONOMER locus_tag OGMAPBJC_01422 product NADH:ubiquinone oxidoreductase, membrane subunit L 1504902 1506431 CDS EC_number 1.6.99.5 gene nuoM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUOM-MONOMER locus_tag OGMAPBJC_01423 product NADH:ubiquinone oxidoreductase, membrane subunit M 1506438 1507895 CDS gene nuoN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NUON-MONOMER locus_tag OGMAPBJC_01424 product NADH:ubiquinone oxidoreductase, membrane subunit N 1508827 1507979 CDS gene yfbP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7182-MONOMER locus_tag OGMAPBJC_01425 product putative protein 1509308 1508886 CDS gene yfbO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7181-MONOMER locus_tag OGMAPBJC_01426 product putative protein 1509517 1510233 CDS gene yfbN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7180-MONOMER locus_tag OGMAPBJC_01427 product putative protein 1511009 1510506 CDS gene yfbM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7179-MONOMER locus_tag OGMAPBJC_01428 product putative protein 1512083 1511112 CDS gene yfbL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7178-MONOMER locus_tag OGMAPBJC_01429 product putative peptidase 1512221 1513948 CDS gene yfbK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7177-MONOMER locus_tag OGMAPBJC_01430 product putative lipoprotein 1515227 1514019 CDS gene elaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7176-MONOMER locus_tag OGMAPBJC_01431 product deubiquitinase 1516353 1515418 CDS gene rbn inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7175-MONOMER locus_tag OGMAPBJC_01432 product RNase BN 1516400 1516861 CDS gene elaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7174-MONOMER locus_tag OGMAPBJC_01433 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 1516916 1517221 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7173-MONOMER locus_tag OGMAPBJC_01434 note conserved protein product hypothetical protein 1517300 1518595 CDS EC_number 5.4.4.2 gene menF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MENF-MONOMER locus_tag OGMAPBJC_01435 product isochorismate synthase 2 1518684 1520354 CDS EC_number 2.2.1.9 gene menD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MEND-MONOMER locus_tag OGMAPBJC_01436 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase 1520351 1521109 CDS EC_number 4.2.99.20 gene menH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12438-MONOMER locus_tag OGMAPBJC_01437 product (1R,6R)-2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase 1521124 1521981 CDS EC_number 4.1.3.36 gene menB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPHTHOATE-SYN-MONOMER locus_tag OGMAPBJC_01438 product 1,4-dihydroxy-2-naphthoyl-CoA synthase 1521981 1522943 CDS gene menC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:O-SUCCINYLBENZOATE-COA-SYN-MONOMER locus_tag OGMAPBJC_01439 product o-succinylbenzoate synthase 1522940 1524295 CDS EC_number 6.2.1.26 gene menE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:O-SUCCINYLBENZOATE-COA-LIG-MONOMER locus_tag OGMAPBJC_01440 product o-succinylbenzoate-CoA ligase 1524405 1524671 CDS gene pmrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7172-MONOMER locus_tag OGMAPBJC_01441 product polymyxin B resistance protein 1525051 1524665 CDS gene arnF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7171-MONOMER locus_tag OGMAPBJC_01442 product undecaprenyl-phosphate-alpha-L-Ara4N flippase - ArnF subunit 1525386 1525051 CDS gene arnE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2682 locus_tag OGMAPBJC_01443 product undecaprenyl-phosphate-alpha-L-Ara4N flippase - ArnE subunit 1527035 1525383 CDS gene arnT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7170-MONOMER locus_tag OGMAPBJC_01444 product 4-amino-4-deoxy-L-arabinose (L-Ara4N) transferase 1527925 1527035 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7169-MONOMER locus_tag OGMAPBJC_01445 note conserved protein product hypothetical protein 1529904 1527922 CDS gene arnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7168-MONOMER locus_tag OGMAPBJC_01446 product fused UDP-L-Ara4N formyltransferase and UDP-GlcA C-4''-decarboxylase 1530872 1529904 CDS gene arnC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7167-MONOMER locus_tag OGMAPBJC_01447 product undecaprenyl phosphate-L-Ara4FN transferase 1532033 1530876 CDS gene arnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7166-MONOMER locus_tag OGMAPBJC_01448 product UDP-L-Ara4O C-4" transaminase 1532323 1532925 CDS gene ais inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7165-MONOMER locus_tag OGMAPBJC_01449 product protein induced by aluminum 1533389 1532964 CDS gene nudI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7164-MONOMER locus_tag OGMAPBJC_01450 product pyrimidine deoxynucleoside triphosphate pyrophosphohydrolase 1533668 1534210 CDS gene yfaZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7163-MONOMER locus_tag OGMAPBJC_01451 product outer membrane protein 1534310 1535512 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7162-MONOMER locus_tag OGMAPBJC_01452 note conserved protein product hypothetical protein 1535732 1536514 CDS gene yfaX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7161-MONOMER locus_tag OGMAPBJC_01453 product putative DNA-binding transcriptional regulator 1536529 1537734 CDS EC_number 4.2.1.90 gene yfaW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7160-MONOMER locus_tag OGMAPBJC_01454 product L-rhamnonate dehydratase 1537791 1539080 CDS gene yfaV_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2246-MONOMER locus_tag OGMAPBJC_01455 product putative transporter 1539098 1539901 CDS EC_number 4.1.2 gene yfaU_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7158-MONOMER locus_tag OGMAPBJC_01456 product 2-keto-3-deoxy-L-rhamnonate aldolase 1540127 1539942 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12323-MONOMER locus_tag OGMAPBJC_01457 note conserved protein product hypothetical protein 1541039 1540140 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12323-MONOMER locus_tag OGMAPBJC_01458 note conserved protein product hypothetical protein 1542422 1541232 CDS gene glpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANGLYC3PDEHYDROGSUBUNITC-MONOMER locus_tag OGMAPBJC_01459 product glycerol-3-phosphate dehydrogenase (anaerobic), small subunit 1543678 1542419 CDS EC_number 1.1.5.3 gene glpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANGLYC3PDEHYDROGSUBUNITB-MONOMER locus_tag OGMAPBJC_01460 product glycerol-3-phosphate dehydrogenase (anaerobic), membrane anchor subunit 1545296 1543668 CDS EC_number 1.1.5.3 gene glpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANGLYC3PDEHYDROGSUBUNITA-MONOMER locus_tag OGMAPBJC_01461 product glycerol-3-phosphate dehydrogenase (anaerobic), large subunit 1545569 1546927 CDS gene glpT_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLPT-MONOMER locus_tag OGMAPBJC_01462 product glycerol-3-phosphate:phosphate antiporter 1546932 1548008 CDS EC_number 3.1.4.46 gene glpQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCPDIESTER-PERI-MONOMER locus_tag OGMAPBJC_01463 product glycerophosphoryl diester phosphodiesterase, periplasmic 1548256 1548050 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12881-MONOMER locus_tag OGMAPBJC_01464 note conserved protein product hypothetical protein 1548471 1549121 CDS gene inaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11422-MONOMER locus_tag OGMAPBJC_01465 product pH-inducible protein involved in stress response 1549429 1549175 CDS gene yfaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12360-MONOMER locus_tag OGMAPBJC_01466 product 2Fe-2S cluster-containing protein involved in diferric-tyrosyl radical cofactor maintenance 1550559 1549429 CDS EC_number 1.17.4.1 gene nrdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NRDB-MONOMER locus_tag OGMAPBJC_01467 product ribonucleoside diphosphate reductase 1, beta subunit, ferritin-like 1553078 1550793 CDS EC_number 1.17.4.1 gene nrdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NRDA-MONOMER locus_tag OGMAPBJC_01468 product ribonucleoside diphosphate reductase 1, alpha subunit 1553774 1557526 CDS gene yfaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12850-MONOMER locus_tag OGMAPBJC_01469 product adhesin 1558376 1557654 CDS EC_number 2.1.1.64 gene ubiG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DHHB-METHYLTRANSFER-MONOMER locus_tag OGMAPBJC_01470 product bifunctional 3-demethylubiquinone-8 3-O-methyltransferase and 2-octaprenyl-6-hydroxyphenol methylase 1558523 1561150 CDS EC_number 5.99.1.3 gene gyrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10423-MONOMER locus_tag OGMAPBJC_01471 product DNA gyrase, subunit A 1561299 1562987 CDS gene yfaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11142-MONOMER locus_tag OGMAPBJC_01472 product putative protein 1562984 1563607 CDS gene yfaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7156-MONOMER locus_tag OGMAPBJC_01473 product putative protein 1563751 1568145 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01474 product hypothetical protein 1568146 1569795 CDS gene yfaQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7153-MONOMER locus_tag OGMAPBJC_01475 product putative protein 1569800 1570576 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7152-MONOMER locus_tag OGMAPBJC_01476 note conserved protein product hypothetical protein 1571834 1570650 CDS EC_number 2.3.1.9 gene atoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETYL-COA-ACETYLTRANSFER-MONOMER locus_tag OGMAPBJC_01477 product acetyl-CoA acetyltransferase 1573187 1571865 CDS gene atoE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11671-MONOMER locus_tag OGMAPBJC_01478 product putative short chain fatty acid transporter 1573834 1573184 CDS EC_number 2.8.3.8 gene atoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATOA-MONOMER locus_tag OGMAPBJC_01479 product acetyl-CoA:acetoacetyl-CoA transferase, beta subunit 1574496 1573834 CDS EC_number 2.8.3.8 gene atoD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATOD-MONOMER locus_tag OGMAPBJC_01480 product acetyl-CoA:acetoacetyl-CoA transferase, alpha subunit 1575389 1574559 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01481 note IS150 conserved protein InsB product hypothetical protein 1575679 1575416 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01482 product IS3 family transposase IS1222 1577302 1575917 CDS db_xref COG:COG2204 gene atoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q06065 locus_tag OGMAPBJC_01483 product Regulatory protein AtoC 1579125 1577299 CDS EC_number 2.7.13.3 db_xref COG:COG0642 gene atoS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q06067 locus_tag OGMAPBJC_01484 product Signal transduction histidine-protein kinase AtoS 1579292 1582141 CDS EC_number 2.7.13.3 gene rcsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DMC5 locus_tag OGMAPBJC_01485 product Sensor histidine kinase RcsC 1582991 1582341 CDS gene fimZ_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_01486 product FimZ transcriptional regulator 1585680 1583008 CDS EC_number 2.7.2.- db_xref COG:COG2198 gene rcsD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P39838 locus_tag OGMAPBJC_01487 product Phosphotransferase RcsD 1586419 1587549 CDS gene ompC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10670-MONOMER locus_tag OGMAPBJC_01488 product outer membrane porin C 1587661 1588716 CDS gene apbE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12073-MONOMER locus_tag OGMAPBJC_01489 product putative thiamine biosynthesis lipoprotein 1588790 1589854 CDS EC_number 2.1.1.63 gene ada inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00230 locus_tag OGMAPBJC_01490 product Ada DNA-binding transcriptional dual regulator 1589854 1590504 CDS gene alkB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10037-MONOMER locus_tag OGMAPBJC_01491 product AlkB repair system for alkylated DNA and RNA 1590580 1592223 CDS gene yojI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YOJI-MONOMER locus_tag OGMAPBJC_01492 product fused predicted multidrug transport subunits of ABC superfamily: membrane component / ATP-binding component 1592441 1594087 CDS EC_number 1.1.5.4 gene mqo inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12069-MONOMER locus_tag OGMAPBJC_01493 product malate:quinone oxidoreductase 1595413 1594925 CDS gene eco inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10255-MONOMER locus_tag OGMAPBJC_01494 product ecotin monomer; serine protease inhibitor 1595712 1595548 CDS gene yojO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2823 locus_tag OGMAPBJC_01495 product hypothetical protein 1595821 1596315 CDS gene napF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPF-MONOMER locus_tag OGMAPBJC_01496 product ferredoxin-type protein 1596305 1596568 CDS gene napD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPD-MONOMER locus_tag OGMAPBJC_01497 product signal peptide-binding chaperone for NapA 1596565 1599051 CDS EC_number 1.7.99.4 gene napA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPA-MONOMER locus_tag OGMAPBJC_01498 product large subunit of periplasmic nitrate reductase, molybdoprotein 1599058 1599753 CDS gene napG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPG-MONOMER locus_tag OGMAPBJC_01499 product ferredoxin-type protein 1599740 1600603 CDS gene napH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPH-MONOMER locus_tag OGMAPBJC_01500 product ferredoxin-type protein 1600600 1601049 CDS gene napB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPB-MONOMER locus_tag OGMAPBJC_01501 product subunit of periplasmic nitrate reductase, cytochrome c550 protein 1601059 1601661 CDS gene napC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAPC-MONOMER locus_tag OGMAPBJC_01502 product cytochrome c protein 1601680 1602297 CDS EC_number 3.6.3.41 gene ccmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CCMA-MONOMER locus_tag OGMAPBJC_01503 product protoheme IX ABC transporter - ATP binding subunit 1602294 1602956 CDS gene ccmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CCMB-MONOMER locus_tag OGMAPBJC_01504 product protoheme IX ABC transporter - membrane subunit CcmB 1602998 1603735 CDS gene ccmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CCMC-MONOMER locus_tag OGMAPBJC_01505 product protoheme IX ABC transporter - membrane subunit CcmC 1603732 1603941 CDS gene ccmD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12169-MONOMER locus_tag OGMAPBJC_01506 product protoheme IX ABC transporter - membrane subunit CcmD 1603938 1604417 CDS gene ccmE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CCME-MONOMER locus_tag OGMAPBJC_01507 product membrane anchored periplasmic heme chaperone CcmE 1604414 1606357 CDS gene ccmF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12054-MONOMER locus_tag OGMAPBJC_01508 product cytochrome c-type biogenesis protein 1606354 1606911 CDS gene ccmG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12053-MONOMER locus_tag OGMAPBJC_01509 product CcmEFGH holocytochrome c synthetase 1606908 1607960 CDS gene ccmH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12052-MONOMER locus_tag OGMAPBJC_01510 product CcmEFGH holocytochrome c synthetase 1608818 1608171 CDS gene fimZ_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_01511 product FimZ transcriptional regulator 1609138 1611729 CDS gene yejO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12051-MONOMER locus_tag OGMAPBJC_01512 product putative autotransporter outer membrane protein 1611908 1611832 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01513 product tRNA-Pro(ggg) 1613743 1611983 CDS gene yejM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12049-MONOMER locus_tag OGMAPBJC_01514 product putative hydrolase, inner membrane 1613990 1613763 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12043-MONOMER locus_tag OGMAPBJC_01515 note conserved protein product hypothetical protein 1614172 1615179 CDS gene yejK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12048-MONOMER locus_tag OGMAPBJC_01516 product DNA-associated protein 1615602 1615318 CDS gene rplY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10885-MONOMER locus_tag OGMAPBJC_01517 product 50S ribosomal subunit protein L25 1617487 1615727 CDS gene yejH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12045-MONOMER locus_tag OGMAPBJC_01518 product putative ATP-dependent helicase 1617636 1618331 CDS gene rsuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12044-MONOMER locus_tag OGMAPBJC_01519 product 16S rRNA pseudouridine 516 synthase 1618359 1619549 CDS gene bcr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BCR-MONOMER locus_tag OGMAPBJC_01520 product multidrug efflux transporter Bcr 1619882 1620226 CDS gene yejG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12042-MONOMER locus_tag OGMAPBJC_01521 product putative protein 1621819 1620230 CDS gene yejF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEJF-MONOMER locus_tag OGMAPBJC_01522 product peptide ABC transporter - ATP binding subunit 1622846 1621821 CDS gene yejE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEJE-MONOMER locus_tag OGMAPBJC_01523 product peptide ABC transporter - membrane subunit 1623940 1622846 CDS gene yejB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEJB-MONOMER locus_tag OGMAPBJC_01524 product peptide ABC transporter - membrane subunit 1625755 1623941 CDS gene yejA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEJA-MONOMER locus_tag OGMAPBJC_01525 product peptide ABC transporter - periplasmic binding protein 1627393 1625837 CDS gene rtn inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7148-MONOMER locus_tag OGMAPBJC_01526 product putative lipoprotein 1628140 1627574 CDS gene spr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7147-MONOMER locus_tag OGMAPBJC_01527 product putative peptidase, outer membrane lipoprotein 1629265 1628552 CDS gene lpxT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7146-MONOMER locus_tag OGMAPBJC_01528 product protein with low undecaprenyl pyrophosphate phosphatase activity 1630290 1629304 CDS gene yeiR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12104-MONOMER locus_tag OGMAPBJC_01529 product zinc-binding GTPase 1631874 1630408 CDS gene yeiQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12036-MONOMER locus_tag OGMAPBJC_01530 product putative dehydrogenase, NAD-dependent 1632669 1632097 CDS gene yeiP_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12035-MONOMER locus_tag OGMAPBJC_01531 product putative dehydrogenase, NAD-dependent 1632824 1633078 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2726 locus_tag OGMAPBJC_01532 note conserved protein product hypothetical protein 1634256 1633075 CDS gene setB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2170-MONOMER locus_tag OGMAPBJC_01533 product sugar / lactose efflux transporter SetB 1634624 1635754 CDS gene fruB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRUB-MONOMER locus_tag OGMAPBJC_01534 product fructose PTS permease - FruB subunit 1635754 1636692 CDS EC_number 2.7.1.56 gene fruK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:1-PFK-MONOMER locus_tag OGMAPBJC_01535 product 1-phosphofructokinase monomer 1636709 1638400 CDS EC_number 2.7.1.69 gene fruA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRUA-MONOMER locus_tag OGMAPBJC_01536 product fructose PTS permease - FruA subunit 1638823 1639764 CDS EC_number 2.7.1.83 gene psuK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11646-MONOMER locus_tag OGMAPBJC_01537 product putative pseudouridine kinase 1639752 1640690 CDS gene psuG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12033-MONOMER locus_tag OGMAPBJC_01538 product putative pseudouridine 5'-phosphate glycosidase 1640784 1642034 CDS gene yeiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEIM-MONOMER locus_tag OGMAPBJC_01539 product YeiM NUP transporter 1642803 1642105 CDS gene yeiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12031-MONOMER locus_tag OGMAPBJC_01540 product YeiL DNA-binding transcriptional activator 1642933 1643874 CDS gene rihB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12030-MONOMER locus_tag OGMAPBJC_01541 product ribonucleoside hydrolase 2 (pyrimidine-specific) 1643974 1645224 CDS gene nupX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEIJ-MONOMER locus_tag OGMAPBJC_01542 product putative pyrimidine nucleoside transporter 1646419 1645331 CDS gene yeiI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12028-MONOMER locus_tag OGMAPBJC_01543 product putative kinase 1647279 1646422 CDS EC_number 3.1.21.2 gene nfo inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10651-MONOMER locus_tag OGMAPBJC_01544 product endonuclease IV 1648402 1647353 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12027-MONOMER locus_tag OGMAPBJC_01545 note conserved inner membrane protein product hypothetical protein 1648501 1649382 CDS gene yeiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12105-MONOMER locus_tag OGMAPBJC_01546 product LYSR-type transcriptional regulator 1649587 1651056 CDS gene lysP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LYSP-MONOMER locus_tag OGMAPBJC_01547 product lysine:H+ symporter 1651350 1653341 CDS gene cirA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10155-MONOMER locus_tag OGMAPBJC_01548 product outer membrane receptor involved in uptake of ferric dihyroxybenzoylserine 1654209 1653373 CDS EC_number 3.1.2.12 gene yeiG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12026-MONOMER locus_tag OGMAPBJC_01549 product S-lactoylglutathione hydrolase / S-formylglutathione hydrolase 1654467 1655135 CDS EC_number 3.5.4.16 gene folE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GTP-CYCLOHYDRO-I-MONOMER locus_tag OGMAPBJC_01550 product GTP cyclohydrolase I monomer 1655152 1656309 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11290-MONOMER locus_tag OGMAPBJC_01551 note conserved inner membrane protein product hypothetical protein 1656451 1657491 CDS gene galS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00261 locus_tag OGMAPBJC_01552 product GalS DNA-binding transcriptional dual regulator 1657771 1658769 CDS gene mglB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MGLB-MONOMER locus_tag OGMAPBJC_01553 product galactose ABC transporter - periplasmic binding protein 1658830 1660350 CDS EC_number 3.6.3.17 gene mglA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MGLA-MONOMER locus_tag OGMAPBJC_01554 product galactose ABC transporter - ATP binding subunit 1660366 1661376 CDS gene mglC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MGLC-MONOMER locus_tag OGMAPBJC_01555 product galactose ABC transporter - membrane subunit 1662854 1661619 CDS EC_number 1.3.1.1 gene preA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11289-MONOMER locus_tag OGMAPBJC_01556 product NADH-dependent dihydropyrimidine dehydrogenase subunit 1664086 1662848 CDS EC_number 1.3.1.1 gene preT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7145-MONOMER locus_tag OGMAPBJC_01557 product NADH-dependent dihydropyrimidine dehydrogenase subunit 1664519 1664280 CDS gene yeiS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7144-MONOMER locus_tag OGMAPBJC_01558 product putative inner membrane protein 1665241 1664522 CDS gene sanA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12025-MONOMER locus_tag OGMAPBJC_01559 product vancomycin sensitivity 1666275 1665391 CDS EC_number 3.5.4.5 gene cdd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYTIDEAM-MONOMER locus_tag OGMAPBJC_01560 product cytidine deaminase 1667100 1666405 CDS gene yohK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12024-MONOMER locus_tag OGMAPBJC_01561 product putative seritonin transporter 1667495 1667097 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12023-MONOMER locus_tag OGMAPBJC_01562 note conserved inner membrane protein product hypothetical protein 1667734 1668681 CDS gene dusC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12022-MONOMER locus_tag OGMAPBJC_01563 product tRNA-dihydrouridine synthase C 1669361 1670797 CDS gene ttgI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q93PU3 locus_tag OGMAPBJC_01564 product Toluene efflux pump outer membrane protein TtgI 1670850 1671611 CDS gene yohF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12019-MONOMER locus_tag OGMAPBJC_01565 product putative oxidoreductase with NAD(P)-binding Rossmann-fold domain protein 1672319 1671741 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12017-MONOMER locus_tag OGMAPBJC_01566 note conserved inner membrane protein product hypothetical protein 1672489 1673076 CDS gene yohC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12016-MONOMER locus_tag OGMAPBJC_01567 product putative inner membrane protein 1673250 1674182 CDS gene pbpG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12015-MONOMER locus_tag OGMAPBJC_01568 product penicillin-binding protein 7 1675935 1674220 CDS EC_number 1.1.1.28 gene dld inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DLACTDEHYDROGFAD-MONOMER locus_tag OGMAPBJC_01569 product D-lactate dehydrogenase 1676161 1678428 CDS EC_number 3.2.1.21 gene bglX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12013-MONOMER locus_tag OGMAPBJC_01570 product beta-D-glucoside glucohydrolase, periplasmic 1678639 1679556 CDS gene osmF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEHZ-MONOMER locus_tag OGMAPBJC_01571 product YehW/YehX/YehY/YehZ ABC transporter 1679563 1680720 CDS gene yehY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEHY-MONOMER locus_tag OGMAPBJC_01572 product YehW/YehX/YehY/YehZ ABC transporter 1680713 1681639 CDS gene yehX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEHX-MONOMER locus_tag OGMAPBJC_01573 product YehW/YehX/YehY/YehZ ABC transporter 1681644 1682375 CDS gene yehW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEHW-MONOMER locus_tag OGMAPBJC_01574 product YehW/YehX/YehY/YehZ ABC transporter 1682463 1682356 CDS gene yohO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2681 locus_tag OGMAPBJC_01575 product small predicted membrane protein 1683254 1682523 CDS gene mlrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12008-MONOMER locus_tag OGMAPBJC_01576 product MlrA DNA binding transcriptional activator 1683476 1685161 CDS gene ypdA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7243-MONOMER locus_tag OGMAPBJC_01577 product putative sensory kinase in two-component system with YpdB 1685158 1685877 CDS gene ypdB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7244-MONOMER locus_tag OGMAPBJC_01578 product putative response regulator in two-component system with YpdA 1685924 1686394 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12005-MONOMER locus_tag OGMAPBJC_01579 note conserved protein product hypothetical protein 1686896 1686435 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12004-MONOMER locus_tag OGMAPBJC_01580 note conserved protein product hypothetical protein 1689021 1687021 CDS gene yehQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12003-MONOMER locus_tag OGMAPBJC_01581 product putative protein 1690154 1689018 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12002-MONOMER locus_tag OGMAPBJC_01582 note conserved protein product hypothetical protein 1692426 1690147 CDS gene yehM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11999-MONOMER locus_tag OGMAPBJC_01583 product putative protein 1693525 1692437 CDS gene yehL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11998-MONOMER locus_tag OGMAPBJC_01584 product putative transporter subunit: ATP-binding component of ABC superfamily protein 1694149 1693832 CDS gene yehK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2680 locus_tag OGMAPBJC_01585 product putative protein 1697842 1694210 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11995-MONOMER locus_tag OGMAPBJC_01586 note conserved protein product hypothetical protein 1700710 1697852 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11995-MONOMER locus_tag OGMAPBJC_01587 note conserved protein product hypothetical protein 1701646 1700822 CDS gene yehF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P33345 locus_tag OGMAPBJC_01588 product Protein YehF 1703820 1701787 CDS EC_number 6.1.1.10 gene metG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:METG-MONOMER locus_tag OGMAPBJC_01589 product methionyl-tRNA synthetase 1703952 1705061 CDS gene mrp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10611-MONOMER locus_tag OGMAPBJC_01590 product putative ATPase 1705324 1705605 CDS gene yehE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11991-MONOMER locus_tag OGMAPBJC_01591 product putative protein 1705898 1706440 CDS gene yehD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11990-MONOMER locus_tag OGMAPBJC_01592 product putative fimbrial-like adhesin protein 1706520 1707194 CDS gene yehC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11989-MONOMER locus_tag OGMAPBJC_01593 product putative fimbrial chaperone 1707210 1709690 CDS gene yehB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11988-MONOMER locus_tag OGMAPBJC_01594 product putative outer membrane usher protein 1709706 1710740 CDS gene yehA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11987-MONOMER locus_tag OGMAPBJC_01595 product putative type-1 fimbrial protein 1711160 1710822 CDS gene rcnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7139-MONOMER locus_tag OGMAPBJC_01596 product periplasmic protein involved in nickel/cobalt efflux 1712203 1711379 CDS gene rcnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7138-MONOMER locus_tag OGMAPBJC_01597 product membrane protein conferring nickel and cobalt resistance 1712324 1712596 CDS gene rcnR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7137-MONOMER locus_tag OGMAPBJC_01598 product RcnR DNA-binding transcriptional repressor 1712819 1713607 CDS EC_number 2.7.1.50 gene thiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THZ-KIN-MONOMER locus_tag OGMAPBJC_01599 product hydroxyethylthiazole kinase 1713604 1714404 CDS EC_number 2.7.4.7 gene thiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HMP-P-KIN-MONOMER locus_tag OGMAPBJC_01600 product hydroxymethylpyrimidine kinase / phosphohydroxymethylpyrimidine kinase 1714469 1715287 CDS gene yegX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7134-MONOMER locus_tag OGMAPBJC_01601 product putative hydrolase 1715339 1716085 CDS gene yegW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7133-MONOMER locus_tag OGMAPBJC_01602 product putative DNA-binding transcriptional regulator 1717024 1716059 CDS gene yegV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7132-MONOMER locus_tag OGMAPBJC_01603 product putative kinase 1718025 1717021 CDS gene yegU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7131-MONOMER locus_tag OGMAPBJC_01604 product putative hydrolase 1719299 1718022 CDS gene yegT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2098-MONOMER locus_tag OGMAPBJC_01605 product YegT MFS transporter 1719556 1720608 CDS EC_number 4.1.2.13 gene fbaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRUCBISALD-CLASSI-MONOMER locus_tag OGMAPBJC_01606 product fructose bisphosphate aldolase monomer 1721939 1720665 CDS db_xref COG:COG0477 gene csbX_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:O05390 locus_tag OGMAPBJC_01607 product Alpha-ketoglutarate permease 1723645 1722041 CDS EC_number 2.7.1.16 gene araB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBULOKIN-MONOMER locus_tag OGMAPBJC_01608 product L-ribulokinase monomer 1724405 1723656 CDS EC_number 1.1.1.298 gene ydfG_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12345-MONOMER locus_tag OGMAPBJC_01609 product 3-hydroxy acid dehydrogenase monomer 1724567 1725598 CDS gene malI_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00361 locus_tag OGMAPBJC_01610 product MalI DNA-binding transcriptional repressor 1726542 1725601 CDS gene lsrR_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6799-MONOMER locus_tag OGMAPBJC_01611 product LsrR DNA-binding transcriptional repressor 1726755 1728122 CDS EC_number 1.1.1.57 gene uxuB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANNONOXIDOREDUCT-MONOMER locus_tag OGMAPBJC_01612 product D-mannonate oxidoreductase 1728136 1729599 CDS EC_number 2.7.1.17 gene xylB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLULOKIN-MONOMER locus_tag OGMAPBJC_01613 product xylulokinase 1729668 1730945 CDS db_xref COG:COG0477 gene csbX_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:O05390 locus_tag OGMAPBJC_01614 product Alpha-ketoglutarate permease 1730990 1731643 CDS EC_number 3.1.3.68 gene yniC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6932-MONOMER locus_tag OGMAPBJC_01615 product 2-deoxyglucose-6-phosphatase 1732616 1731717 CDS gene yegS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7123-MONOMER locus_tag OGMAPBJC_01616 product lipid kinase 1733022 1733339 CDS gene yegR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7122-MONOMER locus_tag OGMAPBJC_01617 product putative protein 1735031 1733670 CDS gene yegQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7118-MONOMER locus_tag OGMAPBJC_01618 product putative peptidase 1735510 1735178 CDS gene yegP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7117-MONOMER locus_tag OGMAPBJC_01619 product putative protein 1736423 1735701 CDS gene torR_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TORR-MONOMER locus_tag OGMAPBJC_01620 product TorR transcriptional dual regulator 1737823 1736420 CDS EC_number 2.7.13.3 db_xref COG:COG0642 gene baeS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P30847 locus_tag OGMAPBJC_01621 product Signal transduction histidine-protein kinase BaeS 1739235 1737820 CDS gene mdtD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2077-MONOMER locus_tag OGMAPBJC_01622 product putative transport protein MdtD 1745436 1739236 CDS gene mdtB inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01423 locus_tag OGMAPBJC_01623 product Multidrug resistance protein MdtB 1746683 1745436 CDS gene mdtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MDTA locus_tag OGMAPBJC_01624 product MdtABC-TolC multidrug efflux transport system - putative membrane fusion protein 1747571 1748230 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7112-MONOMER locus_tag OGMAPBJC_01625 note conserved protein product hypothetical protein 1748308 1748988 CDS gene yegK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7111-MONOMER locus_tag OGMAPBJC_01626 product putative protein 1749514 1749053 CDS gene yegJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7110-MONOMER locus_tag OGMAPBJC_01627 product putative protein 1749714 1751660 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7109-MONOMER locus_tag OGMAPBJC_01628 note conserved protein product hypothetical protein 1753025 1751673 CDS gene yegD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12200-MONOMER locus_tag OGMAPBJC_01629 product actin family protein 1753159 1754007 CDS EC_number 3.2.2.21 gene alkA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11222-MONOMER locus_tag OGMAPBJC_01630 product 3-methyl-adenine DNA glycosylase II, inducible 1757442 1754125 CDS EC_number 2.7.7.65 gene yegE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12396-MONOMER locus_tag OGMAPBJC_01631 product putative diguanylate cyclase 1757760 1758401 CDS EC_number 2.7.1.48 gene udk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDK-MONOMER locus_tag OGMAPBJC_01632 product uridine kinase / cytidine kinase 1758493 1759074 CDS EC_number 3.5.4.13 gene dcd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DCTP-DEAM-MONOMER locus_tag OGMAPBJC_01633 product dCTP deaminase 1759096 1760949 CDS gene asmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11361-MONOMER locus_tag OGMAPBJC_01634 product putative assembly protein AsmA 1762806 1761223 CDS gene yegH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7108-MONOMER locus_tag OGMAPBJC_01635 product putative transport protein 1763465 1764604 CDS gene wza inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7107-MONOMER locus_tag OGMAPBJC_01636 product lipoprotein required for capsular polysaccharide translocation through the outer membrane 1764610 1765053 CDS EC_number 3.1.3.48 gene wzb inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7106-MONOMER locus_tag OGMAPBJC_01637 product tyrosine phosphatase 1765056 1767218 CDS gene wzc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7105-MONOMER locus_tag OGMAPBJC_01638 product tyrosine kinase involved in colanic acid biosynthesis 1767396 1768235 CDS gene wcaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7104-MONOMER locus_tag OGMAPBJC_01639 product putative colanic acid biosynthesis glycosyl transferase 1768238 1768726 CDS gene wcaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7103-MONOMER locus_tag OGMAPBJC_01640 product putative colanic acid biosynthesis acyl transferase 1768723 1769940 CDS gene wcaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7102-MONOMER locus_tag OGMAPBJC_01641 product putative colanic acid biosynthesis glycosyl transferase 1769915 1771132 CDS gene wcaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7101-MONOMER locus_tag OGMAPBJC_01642 product putative colanic acid polymerase 1771143 1771889 CDS gene wcaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7100-MONOMER locus_tag OGMAPBJC_01643 product putative colanic acid biosynthesis glycosyl transferase 1771905 1772453 CDS gene wcaF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7099-MONOMER locus_tag OGMAPBJC_01644 product putative acyl transferase 1772479 1773600 CDS EC_number 4.2.1.47 gene gmd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GDPMANDEHYDRA-MONOMER locus_tag OGMAPBJC_01645 product GDP-mannose 4,6-dehydratase 1773603 1774568 CDS EC_number 1.1.1.271 gene fcl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FCL-MONOMER locus_tag OGMAPBJC_01646 product GDP-fucose synthase 1774568 1775050 CDS gene gmm inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GDPMANMANHYDRO-MONOMER locus_tag OGMAPBJC_01647 product GDP-mannose mannosyl hydrolase 1775047 1776270 CDS gene wcaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11790-MONOMER locus_tag OGMAPBJC_01648 product putative colanic biosynthesis glycosyl transferase 1776273 1777709 CDS EC_number 2.7.7.13 gene cpsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANNPGUANYLTRANGDP-MONOMER locus_tag OGMAPBJC_01649 product mannose-1-phosphate guanylyltransferase 1777902 1779272 CDS EC_number 5.4.2.8 gene cpsG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSMANMUT-MONOMER locus_tag OGMAPBJC_01650 product phosphomannomutase 1779327 1780721 CDS gene wcaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7098-MONOMER locus_tag OGMAPBJC_01651 product putative colanic acid biosynthsis UDP-glucose lipid carrier transferase 1780723 1782201 CDS gene wzxC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7097-MONOMER locus_tag OGMAPBJC_01652 product WzxC 1782477 1783757 CDS gene wcaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7096-MONOMER locus_tag OGMAPBJC_01653 product putative colanic acid biosynthesis pyruvyl transferase 1783754 1784974 CDS gene wcaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7095-MONOMER locus_tag OGMAPBJC_01654 product putative colanic biosynthesis glycosyl transferase 1784985 1786379 CDS gene wcaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7094-MONOMER locus_tag OGMAPBJC_01655 product putative colanic acid biosynthesis protein 1786554 1787447 CDS EC_number 2.7.7.9 gene galF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7093-MONOMER locus_tag OGMAPBJC_01656 product putative uridylyltransferase subunit with GalU 1787820 1788905 CDS EC_number 4.2.1.46 gene rfbB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPGLUCDEHYDRAT-MONOMER locus_tag OGMAPBJC_01657 product RmlB 1788905 1789804 CDS EC_number 1.1.1.133 gene rfbD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPDEHYRHAMREDUCT-MONOMER locus_tag OGMAPBJC_01658 product dTDP-4-dehydrorhamnose reductase 1789862 1790737 CDS EC_number 2.7.7.24 gene rfbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPGLUCOSEPP-MONOMER locus_tag OGMAPBJC_01659 product dTDP-glucose pyrophosphorylase 1790745 1791287 CDS EC_number 5.1.3.13 gene rfbC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPDEHYDRHAMEPIM-MONOMER locus_tag OGMAPBJC_01660 product dTDP-4-dehydrorhamnose 3,5-epimerase 1791290 1792576 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01661 product hypothetical protein 1792587 1793423 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01662 product hypothetical protein 1793431 1794495 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01663 product hypothetical protein 1794501 1795277 CDS gene yibD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11266-MONOMER locus_tag OGMAPBJC_01664 product putative glycosyl transferase 1795270 1796151 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01665 product hypothetical protein 1796148 1797260 CDS EC_number 2.4.1.290 gene pglA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q0P9C9 locus_tag OGMAPBJC_01666 product N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase 1797384 1798790 CDS EC_number 1.1.1.44 gene gnd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:6PGLUCONDEHYDROG-MONOMER locus_tag OGMAPBJC_01667 product 6-phosphogluconate dehydrogenase (decarboxylating) 1799039 1800211 CDS EC_number 1.1.1.22 gene ugd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UGD-MONOMER locus_tag OGMAPBJC_01668 product UDP-glucose 6-dehydrogenase 1800261 1800524 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01669 product IS3 family transposase IS1222 1800551 1801381 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01670 note IS150 conserved protein InsB product hypothetical protein 1802178 1801408 CDS EC_number 4.2.1.46 gene rfbB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPGLUCDEHYDRAT-MONOMER locus_tag OGMAPBJC_01671 product RmlB 1802587 1802967 CDS gene wzzB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7090-MONOMER locus_tag OGMAPBJC_01672 product regulator of length of O-antigen component of lipopolysaccharide chains 1802995 1803294 CDS gene insE-1_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6534-MONOMER locus_tag OGMAPBJC_01673 product IS3 element protein InsE 1803291 1804157 CDS gene insEF-1_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2748 locus_tag OGMAPBJC_01674 product IS3 element transposase 1804175 1804825 CDS gene wzzB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7090-MONOMER locus_tag OGMAPBJC_01675 product regulator of length of O-antigen component of lipopolysaccharide chains 1805533 1804922 CDS EC_number 3.5.4.19 gene hisI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISTCYCLOPRATPPHOS locus_tag OGMAPBJC_01676 product phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphatase 1806303 1805527 CDS gene hisF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYCLASE-MONOMER locus_tag OGMAPBJC_01677 product imidazole glycerol phosphate synthase, HisF subunit 1807022 1806285 CDS EC_number 5.3.1.16 gene hisA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PRIBFAICARPISOM-MONOMER locus_tag OGMAPBJC_01678 product N-(5'-phospho-L-ribosyl-formimino)-5-amino-1-(5'-phosphoribosyl)-4-imidazolecarboxamide isomerase 1807612 1807022 CDS gene hisH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTAMIDOTRANS-MONOMER locus_tag OGMAPBJC_01679 product imidazole glycerol phosphate synthase, HisH subunit 1808679 1807612 CDS EC_number 4.2.1.19 gene hisB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:IMIDPHOSPHADEHYDHISTIDPHOSPHA-MONOMER locus_tag OGMAPBJC_01680 product imidazoleglycerol-phosphate dehydratase / histidinol-phosphatase 1809749 1808679 CDS EC_number 2.6.1.9 gene hisC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISTPHOSTRANS-MONOMER locus_tag OGMAPBJC_01681 product histidinol-phosphate aminotransferase 1811050 1809746 CDS EC_number 1.1.1.23 gene hisD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HISTDEHYD-MONOMER locus_tag OGMAPBJC_01682 product histidinal dehydrogenase / histidinol dehydrogenase 1811955 1811056 CDS EC_number 2.4.2.17 gene hisG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPPHOSRIBOSTRANS-MONOMER locus_tag OGMAPBJC_01683 product ATP phosphoribosyltransferase 1812434 1812685 CDS gene yefM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12844-MONOMER locus_tag OGMAPBJC_01684 product YefM antitoxin of the YoeB-YefM toxin-antitoxin pair and DNA binding transcriptional repressor 1812682 1812936 CDS gene yoeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1041 locus_tag OGMAPBJC_01685 product toxin of the YoeB-YefM toxin-antitoxin pair 1813019 1813843 CDS gene yeeZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7089-MONOMER locus_tag OGMAPBJC_01686 product putative epimerase, with NAD(P)-binding Rossmann-fold domain 1813868 1814818 CDS gene yeeY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7088-MONOMER locus_tag OGMAPBJC_01687 product putative DNA-binding transcriptional regulator 1815085 1816443 CDS gene plaP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEEF-MONOMER locus_tag OGMAPBJC_01688 product putrescine:H+ symporter PlaP 1816676 1817680 CDS gene yeeE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11895-MONOMER locus_tag OGMAPBJC_01689 product putative transport system permease protein 1817694 1817921 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11894-MONOMER locus_tag OGMAPBJC_01690 note conserved protein product hypothetical protein 1819391 1817964 CDS EC_number 3.1.11.1 gene sbcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10926-MONOMER locus_tag OGMAPBJC_01691 product exonuclease I, 3' --> 5' specific; deoxyribophosphodiesterase 1819600 1820766 CDS EC_number 3.4.16.4 gene dacD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOA-MONOMER locus_tag OGMAPBJC_01692 product DD-carboxypeptidase, penicillin-binding protein 6b 1820885 1821358 CDS gene sbmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11892-MONOMER locus_tag OGMAPBJC_01693 product DNA gyrase inhibitor 1821556 1822614 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11891-MONOMER locus_tag OGMAPBJC_01694 note conserved inner membrane protein product hypothetical protein 1822786 1823115 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7087-MONOMER locus_tag OGMAPBJC_01695 note conserved protein product hypothetical protein 1823440 1823216 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2678 locus_tag OGMAPBJC_01696 note conserved protein product hypothetical protein 1824207 1824013 CDS gene yeeW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7086-MONOMER locus_tag OGMAPBJC_01697 product CP4-44 prophage; predicted protein 1824577 1824314 CDS gene cbtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7085-MONOMER locus_tag OGMAPBJC_01698 product CP4-44 prophage; toxin of the CbtA-CbeA toxin-antitoxin system 1825034 1824666 CDS gene cbeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7084-MONOMER locus_tag OGMAPBJC_01699 product CP4-44 prophage; antitoxin of the CbtA-CbeA toxin-antitoxin system 1825329 1825108 CDS gene yeeT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7083-MONOMER locus_tag OGMAPBJC_01700 product CP4-44 prophage; predicted protein 1825868 1825392 CDS gene yeeS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7082-MONOMER locus_tag OGMAPBJC_01701 product CP4-44 prophage; predicted DNA repair protein 1826677 1826183 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01702 product hypothetical protein 1827883 1826813 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01703 product hypothetical protein 1828015 1828872 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISEc38 locus_tag OGMAPBJC_01704 product ISL3 family transposase ISEc38 1831050 1829527 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01705 product hypothetical protein 1831881 1831642 CDS gene insO-1_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6132-MONOMER locus_tag OGMAPBJC_01706 product CP4-6 prophage; partial transposase of insertion element IS911A, interrupted by insertion of IS30 element 1832396 1832094 CDS gene insN-1_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6130-MONOMER locus_tag OGMAPBJC_01707 product CP4-6 prophage; partial regulator of insertion element IS911A 1834081 1833047 CDS gene php_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7731-MONOMER locus_tag OGMAPBJC_01708 product putative hydrolase 1834347 1834084 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01709 product hypothetical protein 1835019 1834441 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01710 product hypothetical protein 1835873 1835304 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01711 product hypothetical protein 1836612 1835887 CDS EC_number 2.7.1.15 gene RBKS_1 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01987 locus_tag OGMAPBJC_01712 product Ribokinase 1837100 1836657 CDS EC_number 2.7.1.15 gene RBKS_2 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01987 locus_tag OGMAPBJC_01713 product Ribokinase 1837412 1837296 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01714 product hypothetical protein 1839158 1839700 CDS EC_number 2.7.7.62 gene cobU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:COBU-MONOMER locus_tag OGMAPBJC_01715 product cobinamide-P guanylyltransferase / cobinamide kinase 1839697 1840440 CDS gene cobS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:COBS-MONOMER locus_tag OGMAPBJC_01716 product cobalamin 5'-phosphate synthase / cobalamin synthase 1840452 1841531 CDS EC_number 2.4.2.21 gene cobT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DMBPPRIBOSYLTRANS-MONOMER locus_tag OGMAPBJC_01717 product nicotinate-nucleotide dimethylbenzimidazole phosphoribosyltransferase 1841593 1842528 CDS gene erfK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7073-MONOMER locus_tag OGMAPBJC_01718 product L,D-transpeptidase ErfK 1842659 1842584 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01719 product tRNA-Asn(gtt) 1842986 1843903 CDS gene nac inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7072-MONOMER locus_tag OGMAPBJC_01720 product Nac DNA-binding transcriptional dual regulator 1844005 1844955 CDS gene cbl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7071-MONOMER locus_tag OGMAPBJC_01721 product Cbl DNA-binding transcriptional activator 1845068 1844993 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01722 product tRNA-Asn(gtt) 1845262 1846716 CDS gene yeeO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEEO-MONOMER locus_tag OGMAPBJC_01723 product YeeO MATE transporter 1846817 1846892 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01724 product tRNA-Asn(gtt) 1848065 1847349 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7068-MONOMER locus_tag OGMAPBJC_01725 note conserved protein product hypothetical protein 1849862 1848408 CDS EC_number 3.2.2.4 gene amn inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AMP-NUCLEOSID-MONOMER locus_tag OGMAPBJC_01726 product AMP nucleosidase 1851280 1849964 CDS gene shiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SHIA-MONOMER locus_tag OGMAPBJC_01727 product shikimate:H+ symporter 1851586 1852638 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01728 product hypothetical protein 1853530 1852700 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01729 note IS150 conserved protein InsB product hypothetical protein 1853820 1853557 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01730 product IS3 family transposase IS1222 1862133 1854124 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01731 product hypothetical protein 1862494 1862419 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01732 product tRNA-Asn(gtt) 1863392 1862595 CDS gene mtfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7063-MONOMER locus_tag OGMAPBJC_01733 product Mlc titration factor 1863486 1863575 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01734 product tRNA-Ser(cga) 1864895 1864245 CDS gene zinT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7061-MONOMER locus_tag OGMAPBJC_01735 product cadmium-induced cadmium binding protein 1865787 1865152 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7060-MONOMER locus_tag OGMAPBJC_01736 note conserved inner membrane protein product hypothetical protein 1866792 1865788 CDS gene yedY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7059-MONOMER locus_tag OGMAPBJC_01737 product reductase 1867314 1866901 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7058-MONOMER locus_tag OGMAPBJC_01738 note conserved protein product hypothetical protein 1867336 1868118 CDS gene yedW_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_01739 product putative DNA-binding response regulator in two-component system with YedV 1868118 1869476 CDS EC_number 2.7.13.3 gene yedV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7056-MONOMER locus_tag OGMAPBJC_01740 product putative sensory kinase in two-component regulatory system with YedW 1870412 1869561 CDS gene hchA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7055-MONOMER locus_tag OGMAPBJC_01741 product glyoxalase III, Hsp31 molecular chaperone 1872191 1871004 CDS gene ompN_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6700-MONOMER locus_tag OGMAPBJC_01742 product outer membrane pore protein N, non-specific 1872448 1872558 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01743 product hypothetical protein 1872819 1873121 CDS gene yedR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7051-MONOMER locus_tag OGMAPBJC_01744 product putative inner membrane protein 1873161 1873856 CDS gene yedJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12710-MONOMER locus_tag OGMAPBJC_01745 product putative phosphohydrolase 1873923 1875341 CDS EC_number 2.1.1.37 gene dcm inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10211-MONOMER locus_tag OGMAPBJC_01746 product DNA-cytosine methyltransferase 1875322 1875792 CDS gene vsr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11068-MONOMER locus_tag OGMAPBJC_01747 product DNA mismatch endonuclease of the very short patch (VSP) mismatch repair pathway 1876701 1875781 CDS gene yedA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11141-MONOMER locus_tag OGMAPBJC_01748 product putative membrane transport protein 1876874 1877791 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12709-MONOMER locus_tag OGMAPBJC_01749 note conserved inner membrane protein product hypothetical protein 1877870 1878052 CDS gene yodC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7050-MONOMER locus_tag OGMAPBJC_01750 product putative protein 1878223 1879917 CDS EC_number 2.7.7.65 gene yedQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7049-MONOMER locus_tag OGMAPBJC_01751 product putative diguanylate cyclase 1880729 1879914 CDS EC_number 3.1.3.70 gene yedP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7048-MONOMER locus_tag OGMAPBJC_01752 product putative phosphatase 1881254 1881027 CDS gene yodD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7046-MONOMER locus_tag OGMAPBJC_01753 product stress-induced protein 1881417 1881605 CDS gene dsrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7045-MONOMER locus_tag OGMAPBJC_01754 product hypothetical protein; transcription is regulated by RpoS and DsrA RNA 1882272 1881649 CDS gene rcsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD02233 locus_tag OGMAPBJC_01755 product positive DNA-binding transcriptional regulator of capsular polysaccharide synthesis, activates its own expression 1883347 1882562 CDS gene fliR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11977-MONOMER locus_tag OGMAPBJC_01756 product flagellar biosynthesis protein FliR 1883625 1883356 CDS gene fliQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11976-MONOMER locus_tag OGMAPBJC_01757 product flagellar biosynthesis protein FliQ 1884372 1883635 CDS gene fliP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11975-MONOMER locus_tag OGMAPBJC_01758 product flagellar biosynthesis protein FliP 1884737 1884372 CDS gene fliO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11224-MONOMER locus_tag OGMAPBJC_01759 product flagellar biosynthesis protein FliO 1885153 1884740 CDS gene fliN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLIN-FLAGELLAR-C-RING-SWITCH locus_tag OGMAPBJC_01760 product flagellar motor switch protein FliN 1886154 1885150 CDS gene fliM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLIM-FLAGELLAR-C-RING-SWITCH locus_tag OGMAPBJC_01761 product flagellar motor switch protein FliM 1886623 1886159 CDS gene fliL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10322-MONOMER locus_tag OGMAPBJC_01762 product flagellar biosynthesis 1887852 1886728 CDS gene fliK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G379-MONOMER locus_tag OGMAPBJC_01763 product flagellar hook-length control protein FliK 1888292 1887849 CDS gene fliJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G378-MONOMER locus_tag OGMAPBJC_01764 product flagellar biosynthesis protein FliJ 1889684 1888311 CDS gene fliI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G377-MONOMER locus_tag OGMAPBJC_01765 product flagellum-specific ATP synthase FliI 1890370 1889684 CDS gene fliH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11656-MONOMER locus_tag OGMAPBJC_01766 product flagellar biosynthesis protein FliH 1891358 1890363 CDS gene fliG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLIG-FLAGELLAR-SWITCH-PROTEIN locus_tag OGMAPBJC_01767 product flagellar motor switch protein FliG 1893009 1891351 CDS gene fliF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLIF-FLAGELLAR-MS-RING locus_tag OGMAPBJC_01768 product flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)-ring and collar protein 1893224 1893538 CDS gene fliE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11346-MONOMER locus_tag OGMAPBJC_01769 product flagellar basal-body protein FliE 1893889 1894017 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7043-MONOMER locus_tag OGMAPBJC_01770 note conserved protein product hypothetical protein 1894406 1894014 CDS gene insF-1_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7126-MONOMER locus_tag OGMAPBJC_01771 product IS3 element protein InsF 1896094 1894571 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01772 product hypothetical protein 1898341 1897190 CDS gene insI-2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6725-MONOMER locus_tag OGMAPBJC_01773 product transposase of IS30 1898654 1898298 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01774 product hypothetical protein 1898914 1899417 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01775 product hypothetical protein 1899427 1899618 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01776 product hypothetical protein 1900362 1899883 CDS gene yedL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7040-MONOMER locus_tag OGMAPBJC_01777 product putative acyltransferase 1901141 1900473 CDS gene yedK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11662-MONOMER locus_tag OGMAPBJC_01778 product putative protein 1901481 1901248 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11661-MONOMER locus_tag OGMAPBJC_01779 note conserved protein product hypothetical protein 1902683 1901478 CDS gene yedE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11660-MONOMER locus_tag OGMAPBJC_01780 product putative inner membrane protein 1902870 1903283 CDS gene yedD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11659-MONOMER locus_tag OGMAPBJC_01781 product putative protein 1904804 1903317 CDS EC_number 3.2.1.1 gene amyA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALPHA-AMYL-CYTO-MONOMER locus_tag OGMAPBJC_01782 product alpha-amylase 1905247 1904882 CDS gene fliT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11389-MONOMER locus_tag OGMAPBJC_01783 product flagellar biosynthesis protein FliT 1905657 1905247 CDS gene fliS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11388-MONOMER locus_tag OGMAPBJC_01784 product flagellar biosynthesis protein FliS 1907088 1905682 CDS gene fliD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10841-MONOMER locus_tag OGMAPBJC_01785 product flagellar cap protein FliD; filament capping protein; enables filament assembly 1907354 1909192 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01786 product hypothetical protein 1909512 1910231 CDS gene fliA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11355-MONOMER locus_tag OGMAPBJC_01787 product RNA polymerase, sigma 28 (sigma F) factor 1910277 1910828 CDS gene fliZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11356-MONOMER locus_tag OGMAPBJC_01788 product FliZ DNA-binding transcriptional regulator 1910859 1911716 CDS gene fliY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7039-MONOMER locus_tag OGMAPBJC_01789 product periplasmic cystine-binding protein; member of extracellular bacterial solute-binding protein family III 1911821 1912807 CDS EC_number 4.4.1.15 gene dcyD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DCYSDESULF-MONOMER locus_tag OGMAPBJC_01790 product D-cysteine desulfhydrase monomer 1912822 1913490 CDS gene yecS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7037-MONOMER locus_tag OGMAPBJC_01791 product putative transporter subunit: membrane component of ABC superfamily protein 1913487 1914239 CDS gene yecC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12347-MONOMER locus_tag OGMAPBJC_01792 product putative transporter subunit: ATP-binding component of ABC superfamily protein 1914469 1915191 CDS gene sdiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD02198 locus_tag OGMAPBJC_01793 product SdiA DNA-binding transcriptional dual regulator 1915482 1915258 CDS gene yecF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12861-MONOMER locus_tag OGMAPBJC_01794 product putative protein 1915941 1916597 CDS gene fimZ_5 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_01795 product FimZ transcriptional regulator 1916594 1918426 CDS gene uvrC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11063-MONOMER locus_tag OGMAPBJC_01796 product excinuclease ABC, subunit C; repair of UV damage to DNA 1918483 1919031 CDS EC_number 2.7.8.5 gene pgsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSPHAGLYPSYN-MONOMER locus_tag OGMAPBJC_01797 product phosphatidylglycerophosphate synthase 1919183 1919258 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01798 product tRNA-Gly(gcc) 1919313 1919386 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01799 product tRNA-Cys(gca) 1919399 1919485 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_01800 product tRNA-Leu(taa) 1919681 1920346 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11139-MONOMER locus_tag OGMAPBJC_01801 note conserved metal-binding protein product hypothetical protein 1921619 1920408 CDS gene tyrP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TYRP-MONOMER locus_tag OGMAPBJC_01802 product tyrosine:H+ symporter TyrP 1921810 1922049 CDS gene yecH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7036-MONOMER locus_tag OGMAPBJC_01803 product putative protein 1922584 1922087 CDS EC_number 1.16.3.1 gene ftnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10921-MONOMER locus_tag OGMAPBJC_01804 product ferritin iron storage protein 1923078 1922755 CDS gene yecR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7035-MONOMER locus_tag OGMAPBJC_01805 product putative protein 1923542 1923793 CDS gene yecJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2677 locus_tag OGMAPBJC_01806 product putative protein 1924375 1923872 CDS gene ftnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7033-MONOMER locus_tag OGMAPBJC_01807 product putative ferritin-like protein 1925172 1926161 CDS gene araF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARAF-MONOMER locus_tag OGMAPBJC_01808 product arabinose ABC transporter - periplasmic binding protein 1926231 1927745 CDS EC_number 3.6.3.17 gene araG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARAG-MONOMER locus_tag OGMAPBJC_01809 product arabinose ABC transporter - ATP binding subunit 1927760 1928746 CDS gene araH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARAH-MONOMER locus_tag OGMAPBJC_01810 product arabinose ABC transporter - membrane subunit 1928913 1929713 CDS EC_number 3.1.3.12 gene otsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TREHALOSEPHOSPHASYN-MONOMER locus_tag OGMAPBJC_01811 product trehalose-6-phosphate phosphatase 1929688 1931112 CDS EC_number 2.4.1.15 gene otsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TREHALOSE6PSYN-MONOMER locus_tag OGMAPBJC_01812 product trehalose-6-phosphate synthase 1931547 1931119 CDS gene uspC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7031-MONOMER locus_tag OGMAPBJC_01813 product universal stress protein 1932327 1932677 CDS gene flhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10320-MONOMER locus_tag OGMAPBJC_01814 product FlhDC DNA-binding transcriptional dual regulator 1932680 1933258 CDS gene flhC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2488 locus_tag OGMAPBJC_01815 product FlhDC DNA-binding transcriptional dual regulator 1933385 1934272 CDS gene motA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MOTA-FLAGELLAR-MOTOR-STATOR-PROTEIN locus_tag OGMAPBJC_01816 product MotA protein, proton conductor component of motor; no effect on switching 1934269 1935195 CDS gene motB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MOTB-FLAGELLAR-MOTOR-STATOR-PROTEIN locus_tag OGMAPBJC_01817 product MotB protein, enables flagellar motor rotation, linking torque machinery to cell wall 1935200 1937164 CDS EC_number 2.7.13.3 db_xref COG:COG0643 gene cheA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P07363 locus_tag OGMAPBJC_01818 product Chemotaxis protein CheA 1937185 1937688 CDS gene cheW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHEW-MONOMER locus_tag OGMAPBJC_01819 product chemotaxis signaling complex - aspartate sensing 1937833 1939494 CDS gene tar inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TAR-MONOMER locus_tag OGMAPBJC_01820 product methyl accepting chemotaxis protein II - aspartate sensing 1939540 1941141 CDS gene tap inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TAP-MONOMER locus_tag OGMAPBJC_01821 product methyl accepting chemotaxis protein - dipeptide sensing 1941160 1942020 CDS EC_number 2.1.1.80 gene cheR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHER-MONOMER locus_tag OGMAPBJC_01822 product chemotaxis protein methyltransferase 1942023 1943072 CDS EC_number 3.1.1.61 db_xref COG:COG2201 gene cheB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P07330 locus_tag OGMAPBJC_01823 product Protein-glutamate methylesterase/protein-glutamine glutaminase 1943087 1943476 CDS gene yedW_5 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_01824 product putative DNA-binding response regulator in two-component system with YedV 1943487 1944131 CDS gene cheZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHEZ-MONOMER locus_tag OGMAPBJC_01825 product CheZ 1944333 1945481 CDS gene flhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7028-MONOMER locus_tag OGMAPBJC_01826 product flagellar biosynthesis protein FlhB 1945474 1947552 CDS gene flhA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G370-MONOMER locus_tag OGMAPBJC_01827 product flagellar biosynthesis protein FlhA 1947549 1947944 CDS gene flhE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7027-MONOMER locus_tag OGMAPBJC_01828 product flagellar protein 1948553 1948065 CDS gene yecT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7026-MONOMER locus_tag OGMAPBJC_01829 product putative protein 1950463 1948730 CDS EC_number 6.1.1.19 gene argS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGS-MONOMER locus_tag OGMAPBJC_01830 product arginyl-tRNA synthetase 1950679 1951245 CDS gene yecM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7025-MONOMER locus_tag OGMAPBJC_01831 product putative metal-binding enzyme 1951259 1952005 CDS db_xref COG:COG3142 gene cutC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P67825 locus_tag OGMAPBJC_01832 product Copper homeostasis protein CutC 1952393 1953493 CDS gene torY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7023-MONOMER locus_tag OGMAPBJC_01833 product trimethylamine N-oxide reductase III, c-type cytochrome subunit 1953518 1955947 CDS EC_number 1.7.2.3 gene torZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7022-MONOMER locus_tag OGMAPBJC_01834 product trimethylamine N-oxide reductase III, TorZ subunit 1957083 1956112 CDS gene cmoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7021-MONOMER locus_tag OGMAPBJC_01835 product putative S-adenosyl-L-methionine-dependent methyltransferase 1957823 1957080 CDS gene cmoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7020-MONOMER locus_tag OGMAPBJC_01836 product putative methyltransferase 1958259 1957864 CDS gene yecN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7019-MONOMER locus_tag OGMAPBJC_01837 product putative inner membrane protein 1959130 1958312 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12379-MONOMER locus_tag OGMAPBJC_01838 note conserved protein product hypothetical protein 1959693 1959127 CDS gene yecD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12378-MONOMER locus_tag OGMAPBJC_01839 product putative hydrolase 1960003 1961775 CDS EC_number 6.1.1.12 gene aspS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPS-MONOMER locus_tag OGMAPBJC_01840 product aspartyl-tRNA synthetase 1961836 1962345 CDS gene nudB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:H2NEOPTERINP3PYROPHOSPHOHYDRO-MONOMER locus_tag OGMAPBJC_01841 product dihydroneopterin triphosphate pyrophosphohydrolase 1962374 1963114 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11137-MONOMER locus_tag OGMAPBJC_01842 note conserved protein product hypothetical protein 1963149 1963670 CDS EC_number 3.1.22.4 gene ruvC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10925-MONOMER locus_tag OGMAPBJC_01843 product Holliday junction nuclease; resolution of structures; repair 1964274 1963672 CDS gene yebB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11136-MONOMER locus_tag OGMAPBJC_01844 product putative protein 1964549 1965160 CDS gene ruvA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10923-MONOMER locus_tag OGMAPBJC_01845 product branch migration of Holliday structures; repair 1965169 1966179 CDS gene ruvB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10924-MONOMER locus_tag OGMAPBJC_01846 product branch migration of Holliday structures; repair helicase 1967111 1966326 CDS gene znuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ZNUB-MONOMER locus_tag OGMAPBJC_01847 product Zn2+ ABC transporter - membrane subunit 1967863 1967108 CDS gene znuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ZNUC-MONOMER locus_tag OGMAPBJC_01848 product Zn2+ ABC transporter - ATP binding subunit 1967888 1968874 CDS gene znuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ZNUA-MONOMER locus_tag OGMAPBJC_01849 product Zn2+ ABC transporter - periplasmic binding protein 1968890 1970212 CDS gene yebA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10013-MONOMER locus_tag OGMAPBJC_01850 product putative peptidase 1970332 1971303 CDS gene lpxM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MYRISTOYLACYLTRAN-MONOMER locus_tag OGMAPBJC_01851 product myristoyl-acyl carrier protein (ACP)-dependent acyltransferase 1972876 1971434 CDS EC_number 2.7.1.40 gene pykA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PKII-MONOMER locus_tag OGMAPBJC_01852 product pyruvate kinase II monomer 1973873 1973004 CDS gene yebK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12860-MONOMER locus_tag OGMAPBJC_01853 product putative DNA-binding transcriptional regulator 1973896 1974045 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01854 product hypothetical protein 1974211 1975686 CDS EC_number 1.1.1.49 gene zwf inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLU6PDEHYDROG-MONOMER locus_tag OGMAPBJC_01855 product glucose 6-phosphate-1-dehydrogenase 1975921 1977732 CDS EC_number 4.2.1.12 gene edd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGLUCONDEHYDRAT-MONOMER locus_tag OGMAPBJC_01856 product phosphogluconate dehydratase 1977769 1978410 CDS EC_number 4.1.3.16 gene eda inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDPGALDOL-4OH2OXOGLUTARALDOL-MONOMER locus_tag OGMAPBJC_01857 product multifunctional 2-keto-3-deoxygluconate 6-phosphate aldolase and 2-keto-4-hydroxyglutarate aldolase and oxaloacetate decarboxylase 1979644 1978466 CDS gene purT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GARTRANSFORMYL2-MONOMER locus_tag OGMAPBJC_01858 product phosphoribosylglycinamide formyltransferase 2 1979778 1980068 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11808-MONOMER locus_tag OGMAPBJC_01859 note conserved protein regulated by LexA product hypothetical protein 1980135 1980491 CDS gene yebF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11807-MONOMER locus_tag OGMAPBJC_01860 product putative protein 1980758 1980648 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01861 product hypothetical protein 1980818 1981477 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11806-MONOMER locus_tag OGMAPBJC_01862 note conserved inner membrane protein product hypothetical protein 1981686 1983746 CDS gene ptrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11004-MONOMER locus_tag OGMAPBJC_01863 product protease II 1984405 1983743 CDS gene exoX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7016-MONOMER locus_tag OGMAPBJC_01864 product exonuclease X 1985085 1984429 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7015-MONOMER locus_tag OGMAPBJC_01865 note conserved protein product hypothetical protein 1985417 1985187 CDS EC_number 2.7.7.7 gene holE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11505-MONOMER locus_tag OGMAPBJC_01866 product DNA polymerase III, th subunit 1985556 1985930 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7014-MONOMER locus_tag OGMAPBJC_01867 note conserved protein product hypothetical protein 1985934 1986806 CDS gene yebZ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7013-MONOMER locus_tag OGMAPBJC_01868 product putative resistance protein 1986819 1987160 CDS gene yebY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7012-MONOMER locus_tag OGMAPBJC_01869 product putative protein 1987556 1988212 CDS EC_number 3.1.3.16 gene pphA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7011-MONOMER locus_tag OGMAPBJC_01870 product protein phosphatase 1 modulates phosphoproteins, signals protein misfolding 1988488 1988213 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01871 product hypothetical protein 1988745 1988509 CDS gene yebV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7009-MONOMER locus_tag OGMAPBJC_01872 product putative protein 1990308 1988863 CDS gene rsmF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7008-MONOMER locus_tag OGMAPBJC_01873 product 16S rRNA methyltransferase 1993015 1990382 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7007-MONOMER locus_tag OGMAPBJC_01874 note conserved protein product hypothetical protein 1994267 1992984 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7006-MONOMER locus_tag OGMAPBJC_01875 note conserved inner membrane protein product hypothetical protein 1994343 1994894 CDS EC_number 1.8.4.14 gene msrC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7005-MONOMER locus_tag OGMAPBJC_01876 product free methionine-(R)-sulfoxide reductase 1994991 1995689 CDS gene proQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12866-MONOMER locus_tag OGMAPBJC_01877 product RNA chaperone, involved in posttranscriptional control of ProP levels 1995709 1997757 CDS gene prc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10760-MONOMER locus_tag OGMAPBJC_01878 product tail-specific protease 1997949 1998830 CDS gene htpX_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10462-MONOMER locus_tag OGMAPBJC_01879 product heat shock protein, integral membrane protein 2000249 1998876 CDS gene yebQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1828-MONOMER locus_tag OGMAPBJC_01880 product putative transporter 2000426 2001217 CDS gene kdgR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7003-MONOMER locus_tag OGMAPBJC_01881 product KdgR DNA-binding transcriptional repressor 2001599 2001360 CDS gene yobH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2676 locus_tag OGMAPBJC_01882 product putative protein 2001976 2002263 CDS gene yebO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7001-MONOMER locus_tag OGMAPBJC_01883 product putative protein 2003088 2003195 CDS gene cspC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12204-MONOMER locus_tag OGMAPBJC_01884 product stress protein, member of the CspA family; predicted DNA-binding transcriptional regulator 2004052 2003222 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_01885 note IS150 conserved protein InsB product hypothetical protein 2004342 2004079 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_01886 product IS3 family transposase IS1222 2004355 2004522 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01887 product hypothetical protein 2004688 2005497 CDS EC_number 2.1.1.187 gene rlmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12207-MONOMER locus_tag OGMAPBJC_01888 product 23S rRNA m1G745 methyltransferase 2006060 2005494 CDS gene mntP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6999-MONOMER locus_tag OGMAPBJC_01889 product manganese export protein 2006947 2006489 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6998-MONOMER locus_tag OGMAPBJC_01890 note conserved inner membrane protein product hypothetical protein 2007853 2007002 CDS gene manZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANZ-MONOMER locus_tag OGMAPBJC_01891 product mannose PTS permease - ManZ subunit 2008666 2007866 CDS gene manY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANY-MONOMER locus_tag OGMAPBJC_01892 product mannose PTS permease - ManY subunit 2009700 2008729 CDS gene manX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANX-MONOMER locus_tag OGMAPBJC_01893 product mannose PTS permease 2009966 2010175 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01894 product hypothetical protein 2010163 2011719 CDS gene yoaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6997-MONOMER locus_tag OGMAPBJC_01895 product putative inner membrane protein 2013321 2011723 CDS EC_number 3.1.4.52 gene yoaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6996-MONOMER locus_tag OGMAPBJC_01896 product putative phosphodiesterase 2014816 2013452 CDS EC_number 4.3.1.17 gene sdaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LSERINEDEAM1-MONOMER locus_tag OGMAPBJC_01897 product L-serine deaminase I 2015578 2015000 CDS gene nudL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12693-MONOMER locus_tag OGMAPBJC_01898 product putative NUDIX hydrolase with low 3-phosphohydroxypyruvate phosphatase activity 2016943 2015582 CDS EC_number 2.6.1.85 gene pabB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PABASYN-COMPI-MONOMER locus_tag OGMAPBJC_01899 product para-aminobenzoate synthase multi-enzyme complex 2017017 2017196 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6995-MONOMER locus_tag OGMAPBJC_01900 note conserved protein product hypothetical protein 2017615 2017316 CDS gene yoaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6994-MONOMER locus_tag OGMAPBJC_01901 product putative protein 2018381 2018037 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6993-MONOMER locus_tag OGMAPBJC_01902 note conserved protein product hypothetical protein 2018513 2020423 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6992-MONOMER locus_tag OGMAPBJC_01903 note conserved protein product hypothetical protein 2020481 2021176 CDS gene tsaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6991-MONOMER locus_tag OGMAPBJC_01904 product protein involved in threonylcarbamoyladenosine biosynthesis 2021216 2021797 CDS gene yeaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6990-MONOMER locus_tag OGMAPBJC_01905 product putative lipoprotein 2021936 2023687 CDS EC_number 6.2.1.3 gene fadD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACYLCOASYN-MONOMER locus_tag OGMAPBJC_01906 product fatty acyl-CoA synthetase 2023769 2024884 CDS EC_number 3.1.13.5 gene rnd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10858-MONOMER locus_tag OGMAPBJC_01907 product RNase D 2025903 2024938 CDS gene yeaX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6989-MONOMER locus_tag OGMAPBJC_01908 product putative oxidoreductase 2027083 2025959 CDS gene yeaW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6988-MONOMER locus_tag OGMAPBJC_01909 product 2Fe-2S cluster-containing protein 2028545 2027115 CDS gene yeaV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YEAV-MONOMER locus_tag OGMAPBJC_01910 product putative transporter 2029836 2028751 CDS EC_number 1.1.1.83 gene dmlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6986-MONOMER locus_tag OGMAPBJC_01911 product D-malate dehydrogenase (decarboxylating) 2029939 2030862 CDS gene dmlR_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6985-MONOMER locus_tag OGMAPBJC_01912 product DmlR DNA-binding transcriptional regulator 2030989 2031627 CDS gene leuE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6984-MONOMER locus_tag OGMAPBJC_01913 product leucine efflux transporter 2031800 2032159 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6983-MONOMER locus_tag OGMAPBJC_01914 note conserved protein product hypothetical protein 2032163 2032345 CDS gene yoaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6982-MONOMER locus_tag OGMAPBJC_01915 product putative protein 2032493 2032741 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6981-MONOMER locus_tag OGMAPBJC_01916 note conserved inner membrane protein product hypothetical protein 2034033 2033008 CDS EC_number 2.7.7.65 gene yeaP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6980-MONOMER locus_tag OGMAPBJC_01917 product diguanylate cyclase 2034216 2034470 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6979-MONOMER locus_tag OGMAPBJC_01918 note conserved outer membrane protein product hypothetical protein 2034839 2034492 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6978-MONOMER locus_tag OGMAPBJC_01919 note conserved protein product hypothetical protein 2036075 2034894 CDS gene yeaN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1791-MONOMER locus_tag OGMAPBJC_01920 product putative amino acid/amine MFS transporter 2036175 2036993 CDS gene yeaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6976-MONOMER locus_tag OGMAPBJC_01921 product putative DNA-binding transcriptional regulator 2037396 2036950 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6975-MONOMER locus_tag OGMAPBJC_01922 note conserved inner membrane protein product hypothetical protein 2038174 2037671 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6973-MONOMER locus_tag OGMAPBJC_01923 note conserved protein product hypothetical protein 2039707 2038217 CDS EC_number 2.7.7.65 gene yeaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6972-MONOMER locus_tag OGMAPBJC_01924 product putative diguanylate cyclase 2041363 2039888 CDS gene yeaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6971-MONOMER locus_tag OGMAPBJC_01925 product putative diguanylate cyclase 2042793 2041510 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6970-MONOMER locus_tag OGMAPBJC_01926 note conserved protein product hypothetical protein 2044840 2042906 CDS gene yeaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6969-MONOMER locus_tag OGMAPBJC_01927 product protein kinase 2045276 2046022 CDS gene mipA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6968-MONOMER locus_tag OGMAPBJC_01928 product scaffolding protein that interacts with murein polymerase and murein hydrolase 2046112 2046966 CDS gene yeaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6967-MONOMER locus_tag OGMAPBJC_01929 product methylglyoxal reductase 2047898 2047014 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6966-MONOMER locus_tag OGMAPBJC_01930 note conserved protein product hypothetical protein 2048977 2047982 CDS EC_number 1.2.1.12 gene gapA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GAPDH-A-MONOMER locus_tag OGMAPBJC_01931 product glyceraldehyde 3-phosphate dehydrogenase-A monomer 2049319 2049732 CDS EC_number 1.8.4.12 gene msrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12394-MONOMER locus_tag OGMAPBJC_01932 product methionine sulfoxide reductase B 2049774 2050046 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6964-MONOMER locus_tag OGMAPBJC_01933 note conserved protein product hypothetical protein 2050416 2050715 CDS gene ydjL_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6963-MONOMER locus_tag OGMAPBJC_01934 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 2050836 2051492 CDS gene ydjL_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6963-MONOMER locus_tag OGMAPBJC_01935 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 2051519 2052898 CDS gene ydjK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1775-MONOMER locus_tag OGMAPBJC_01936 product putative transporter 2052915 2053958 CDS gene ydjJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6961-MONOMER locus_tag OGMAPBJC_01937 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 2053979 2054815 CDS gene ydjI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6960-MONOMER locus_tag OGMAPBJC_01938 product putative aldolase 2054820 2055767 CDS gene ydjH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6959-MONOMER locus_tag OGMAPBJC_01939 product putative kinase 2055777 2056757 CDS gene ydjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6958-MONOMER locus_tag OGMAPBJC_01940 product methylglyoxal reductase (NADH-dependent) 2056894 2057652 CDS gene ydjF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6957-MONOMER locus_tag OGMAPBJC_01941 product putative DNA-binding transcriptional regulator 2057770 2059128 CDS gene ydjE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDJE-MONOMER locus_tag OGMAPBJC_01942 product YdjE MFS transporter 2059862 2059221 CDS EC_number 3.5.1.19 gene pncA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NICOTINAMID-MONOMER locus_tag OGMAPBJC_01943 product pyrazinamidase / nicotinamidase 2060889 2059873 CDS EC_number 3.5.1.1 gene ansA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANSA-MONOMER locus_tag OGMAPBJC_01944 product asparaginase I 2062912 2061056 CDS gene sppA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10968-MONOMER locus_tag OGMAPBJC_01945 product protease IV 2063073 2063624 CDS gene ydjA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11134-MONOMER locus_tag OGMAPBJC_01946 product putative oxidoreductase 2063741 2064784 CDS EC_number 2.7.9.3 gene selD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10943-MONOMER locus_tag OGMAPBJC_01947 product selenide, water dikinase 2064789 2066750 CDS EC_number 5.99.1.2 gene topB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11014-MONOMER locus_tag OGMAPBJC_01948 product DNA topoisomerase III 2066878 2067918 CDS gene ynjI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6956-MONOMER locus_tag OGMAPBJC_01949 product putative inner membrane protein 2069378 2068035 CDS EC_number 1.4.1.4 gene gdhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GDHA-MONOMER locus_tag OGMAPBJC_01950 product glutamate dehydrogenase 2069614 2069886 CDS gene ynjH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6955-MONOMER locus_tag OGMAPBJC_01951 product putative protein 2070259 2069852 CDS gene nudG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6954-MONOMER locus_tag OGMAPBJC_01952 product oxidized nucleoside triphosphate pyrophosphohydrolase 2070346 2070966 CDS gene ynjF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6953-MONOMER locus_tag OGMAPBJC_01953 product putative phosphatidyl transferase, inner membrane protein 2072282 2070975 CDS EC_number 2.8.1.1 gene ynjE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6952-MONOMER locus_tag OGMAPBJC_01954 product molybdopterin synthase sulfurtransferase 2073002 2072349 CDS gene ynjD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YNJD-MONOMER locus_tag OGMAPBJC_01955 product YnjC/YnjD ABC transporter 2074537 2073002 CDS gene ynjC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YNJC-MONOMER locus_tag OGMAPBJC_01956 product YnjC/YnjD ABC transporter 2075676 2074510 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6949-MONOMER locus_tag OGMAPBJC_01957 note conserved protein product hypothetical protein 2076234 2075686 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6948-MONOMER locus_tag OGMAPBJC_01958 note conserved protein product hypothetical protein 2076941 2076234 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6947-MONOMER locus_tag OGMAPBJC_01959 note conserved inner membrane protein product hypothetical protein 2077633 2076956 CDS gene ydjY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6946-MONOMER locus_tag OGMAPBJC_01960 product putative protein 2078348 2077638 CDS gene ydjX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6945-MONOMER locus_tag OGMAPBJC_01961 product putative inner membrane protein 2079321 2078515 CDS EC_number 3.1.11.2 gene xthA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11073-MONOMER locus_tag OGMAPBJC_01962 product exonuclease III 2079767 2080987 CDS EC_number 2.6.1.81 gene astC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCORNTRANSAM-MONOMER locus_tag OGMAPBJC_01963 product succinylornithine transaminase 2080984 2082018 CDS EC_number 2.3.1.109 gene astA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGSUCCTRAN-MONOMER locus_tag OGMAPBJC_01964 product arginine succinyltransferase 2082015 2083493 CDS EC_number 1.2.1.71 gene astD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCGLUALDDEHYD-MONOMER locus_tag OGMAPBJC_01965 product aldehyde dehydrogenase 2083490 2084833 CDS EC_number 3.5.3.23 gene astB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCARGDIHYDRO-MONOMER locus_tag OGMAPBJC_01966 product succinylarginine dihydrolase 2084826 2085794 CDS EC_number 3.5.1.96 gene astE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCGLUDESUCC-MONOMER locus_tag OGMAPBJC_01967 product succinylglutamate desuccinylase 2086124 2086609 CDS gene spy inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6939-MONOMER locus_tag OGMAPBJC_01968 product ATP independent periplasmic chaperone 2086812 2087387 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6938-MONOMER locus_tag OGMAPBJC_01969 note conserved protein product hypothetical protein 2088234 2087347 CDS gene cho inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6937-MONOMER locus_tag OGMAPBJC_01970 product endonuclease of nucleotide excision repair 2089291 2088464 CDS EC_number 6.3.1.5 gene nadE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAD-SYNTH-MONOMER locus_tag OGMAPBJC_01971 product NAD synthetase, NH3-dependent 2089493 2089831 CDS gene osmE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10044-MONOMER locus_tag OGMAPBJC_01972 product osmotically inducible protein OsmE 2090130 2090450 CDS EC_number 2.7.1.69 gene chbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CELA-MONOMER locus_tag OGMAPBJC_01973 product chitobiose / cellobiose PTS permease - ChbB subunit 2090535 2091893 CDS gene chbC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CELB-MONOMER locus_tag OGMAPBJC_01974 product chitobiose / cellobiose PTS permease - ChbC subunit 2091944 2092294 CDS gene chbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CELC-MONOMER locus_tag OGMAPBJC_01975 product chitobiose / cellobiose PTS permease - ChbA subunit 2092305 2093144 CDS gene chbR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10143-MONOMER locus_tag OGMAPBJC_01976 product ChbR DNA-binding transcriptional dual regulator 2093249 2094601 CDS EC_number 3.2.1.86 gene chbF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10144-MONOMER locus_tag OGMAPBJC_01977 product monoacetylchitobiose-6-phosphate hydrolase 2094614 2095363 CDS gene chbG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12198-MONOMER locus_tag OGMAPBJC_01978 product chito-oligosaccharide mono-deacetylase 2097882 2095621 CDS EC_number 1.11.1.6 gene katE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYDROPEROXIDII-MONOMER locus_tag OGMAPBJC_01979 product heme d synthase / hydroperoxidase 2098065 2098328 CDS gene cedA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6936-MONOMER locus_tag OGMAPBJC_01980 product cell division modulator 2098617 2099420 CDS gene ydjO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6935-MONOMER locus_tag OGMAPBJC_01981 product putative protein 2100815 2099424 CDS gene ydjN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6934-MONOMER locus_tag OGMAPBJC_01982 product putative transporter 2101538 2100948 CDS gene ydjM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6933-MONOMER locus_tag OGMAPBJC_01983 product putative inner membrane protein regulated by LexA 2102369 2101701 CDS EC_number 3.1.3.68 gene yniC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6932-MONOMER locus_tag OGMAPBJC_01984 product 2-deoxyglucose-6-phosphatase 2102516 2103052 CDS gene yniB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6931-MONOMER locus_tag OGMAPBJC_01985 product putative inner membrane protein 2103488 2103093 CDS gene yniA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6930-MONOMER locus_tag OGMAPBJC_01986 product putative phosphotransferase/kinase 2103945 2103508 CDS gene yniA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6930-MONOMER locus_tag OGMAPBJC_01987 product putative phosphotransferase/kinase 2104341 2104051 CDS gene ydiZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6929-MONOMER locus_tag OGMAPBJC_01988 product putative protein 2105371 2104442 CDS EC_number 2.7.1.11 gene pfkB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:6PFK-2-MONOMER locus_tag OGMAPBJC_01989 product 6-phosphofructokinase-2 monomer 2105658 2106416 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6928-MONOMER locus_tag OGMAPBJC_01990 note conserved protein product hypothetical protein 2106576 2106469 CDS gene yniD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2675 locus_tag OGMAPBJC_01991 product small predicted membrane protein 2107554 2106748 CDS gene arpA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11208-MONOMER locus_tag OGMAPBJC_01992 product regulator of acetyl CoA synthetase 2108647 2108174 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_01993 product hypothetical protein 2109171 2111099 CDS EC_number 6.1.1.3 gene thrS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THRS-MONOMER locus_tag OGMAPBJC_01994 product threonyl-tRNA synthetase 2111211 2111645 CDS gene infC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10506-MONOMER locus_tag OGMAPBJC_01995 product protein chain initiation factor IF-3 2111742 2111939 CDS gene rpmI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11231-MONOMER locus_tag OGMAPBJC_01996 product 50S ribosomal subunit protein L35 2111992 2112348 CDS gene rplT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10881-MONOMER locus_tag OGMAPBJC_01997 product 50S ribosomal subunit protein L20 2112799 2113782 CDS EC_number 6.1.1.20 gene pheS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHES-MONOMER locus_tag OGMAPBJC_01998 product phenylalanyl-tRNA synthetase alpha-chain 2113797 2116184 CDS EC_number 6.1.1.20 gene pheT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHET-MONOMER locus_tag OGMAPBJC_01999 product phenylalanyl-tRNA synthetase beta-chain 2116189 2116488 CDS gene ihfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00347 locus_tag OGMAPBJC_02000 product integration host factor (IHF), alpha subunit 2116589 2117569 CDS gene btuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BTUC-MONOMER locus_tag OGMAPBJC_02001 product vitamin B12 ABC transporter - membrane subunit 2117632 2118183 CDS gene btuE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BTUE-MONOMER locus_tag OGMAPBJC_02002 product thioredoxin/glutathione peroxidase 2118183 2118932 CDS EC_number 3.6.3.33 gene btuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BTUD-MONOMER locus_tag OGMAPBJC_02003 product vitamin B12 ABC transporter - ATP binding subunit 2119010 2119474 CDS gene nlpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11133-MONOMER locus_tag OGMAPBJC_02004 product NlpC-putative lipoprotein hydrolase 2119721 2120434 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6925-MONOMER locus_tag OGMAPBJC_02005 note conserved protein product hypothetical protein 2120497 2121933 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6924-MONOMER locus_tag OGMAPBJC_02006 note conserved protein product hypothetical protein 2122128 2121937 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12391-MONOMER locus_tag OGMAPBJC_02007 note conserved protein product hypothetical protein 2123306 2122260 CDS EC_number 2.5.1.54 gene aroH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROH-MONOMER locus_tag OGMAPBJC_02008 product 2-dehydro-3-deoxyphosphoheptonate aldolase 2124296 2123463 CDS gene ppsR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11132-MONOMER locus_tag OGMAPBJC_02009 product PEP synthetase regulatory protein 2124629 2127007 CDS EC_number 2.7.9.2 gene ppsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PEPSYNTH-MONOMER locus_tag OGMAPBJC_02010 product phosphoenolpyruvate synthetase 2128710 2127064 CDS gene fadK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12357-MONOMER locus_tag OGMAPBJC_02011 product short chain acyl-CoA synthetase monomer 2129060 2128767 CDS gene ydiT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6923-MONOMER locus_tag OGMAPBJC_02012 product putative ferredoxin 2130346 2129057 CDS gene ydiS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6922-MONOMER locus_tag OGMAPBJC_02013 product putative flavoprotein 2131340 2130402 CDS gene ydiR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6921-MONOMER locus_tag OGMAPBJC_02014 product putative subunit of YdiQ-YdiR flavoprotein 2131710 2131360 CDS gene ydiQ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6920-MONOMER locus_tag OGMAPBJC_02015 product putative subunit of YdiQ-YdiR flavoprotein 2132615 2131749 CDS gene insEF-1_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2748 locus_tag OGMAPBJC_02016 product IS3 element transposase 2132911 2132612 CDS gene insE-1_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6534-MONOMER locus_tag OGMAPBJC_02017 product IS3 element protein InsE 2133385 2132939 CDS gene ydiQ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6920-MONOMER locus_tag OGMAPBJC_02018 product putative subunit of YdiQ-YdiR flavoprotein 2133422 2133598 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02019 product hypothetical protein 2133701 2134612 CDS gene ydiP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6919-MONOMER locus_tag OGMAPBJC_02020 product putative DNA-binding transcriptional regulator 2135806 2134655 CDS gene ydiO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6918-MONOMER locus_tag OGMAPBJC_02021 product putative acyl-CoA dehydrogenase 2137415 2135820 CDS EC_number 2.8.3.8 gene ydiF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12432-MONOMER locus_tag OGMAPBJC_02022 product fused predicted acetyl-CoA:acetoacetyl-CoA transferase: alpha subunit/beta subunit 2138316 2137558 CDS EC_number 4.2.1.10 gene aroD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROD-MONOMER locus_tag OGMAPBJC_02023 product 3-dehydroquinate dehydratase 2139213 2138347 CDS EC_number 1.1.1.282 gene ydiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11234-MONOMER locus_tag OGMAPBJC_02024 product shikimate dehydrogenase / quinate dehydrogenase 2140490 2139225 CDS gene ydiN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1691-MONOMER locus_tag OGMAPBJC_02025 product putative inner membrane protein YdiN 2141931 2140717 CDS gene ydiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1690-MONOMER locus_tag OGMAPBJC_02026 product putative transporter 2142387 2142031 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6915-MONOMER locus_tag OGMAPBJC_02027 note conserved protein product hypothetical protein 2143928 2142816 CDS gene ydiK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6914-MONOMER locus_tag OGMAPBJC_02028 product putative inner membrane protein 2144317 2147373 CDS gene ydiJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6913-MONOMER locus_tag OGMAPBJC_02029 product putative FAD-linked oxidoreductase 2147370 2147780 CDS gene ydiI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6912-MONOMER locus_tag OGMAPBJC_02030 product esterase 2147880 2148068 CDS gene ydiH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6911-MONOMER locus_tag OGMAPBJC_02031 product putative protein 2148616 2148984 CDS gene sufA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11378-MONOMER locus_tag OGMAPBJC_02032 product Fe-S cluster assembly, scaffold protein 2148993 2150480 CDS gene sufB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6909-MONOMER locus_tag OGMAPBJC_02033 product SufB component of SufBCD Fe-S cluster scaffold complex 2150490 2151236 CDS gene sufC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6908-MONOMER locus_tag OGMAPBJC_02034 product SufC component of SufBCD Fe-S cluster scaffold complex 2151211 2152482 CDS gene sufD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6907-MONOMER locus_tag OGMAPBJC_02035 product SufD component of SufBCD Fe-S cluster scaffold complex 2152479 2153699 CDS EC_number 4.4.1.16 gene sufS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6906-MONOMER locus_tag OGMAPBJC_02036 product L-selenocysteine lyase (and L-cysteine desulfurase) monomer 2153712 2154128 CDS gene sufE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6905-MONOMER locus_tag OGMAPBJC_02037 product sulfur acceptor that activates SufS cysteine desulfurase 2154277 2155281 CDS gene ynhG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6904-MONOMER locus_tag OGMAPBJC_02038 product L,D-transpeptidase YnhG 2155581 2155345 CDS gene lpp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10544-MONOMER locus_tag OGMAPBJC_02039 product murein lipoprotein 2157304 2155892 CDS EC_number 2.7.1.40 gene pykF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PKI-MONOMER locus_tag OGMAPBJC_02040 product pyruvate kinase I monomer 2157861 2158070 CDS gene ydhZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6903-MONOMER locus_tag OGMAPBJC_02041 product putative protein 2158525 2159151 CDS gene ydhY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6902-MONOMER locus_tag OGMAPBJC_02042 product putative 4Fe-4S ferredoxin-type protein 2159172 2161274 CDS gene ydhV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6901-MONOMER locus_tag OGMAPBJC_02043 product putative oxidoreductase 2161287 2161925 CDS gene ydhW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6900-MONOMER locus_tag OGMAPBJC_02044 product putative protein 2161989 2162657 CDS gene ydhX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6899-MONOMER locus_tag OGMAPBJC_02045 product putative 4Fe-4S ferredoxin-type protein 2162654 2163439 CDS gene ydhU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6898-MONOMER locus_tag OGMAPBJC_02046 product putative cytochrome 2163491 2164255 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6897-MONOMER locus_tag OGMAPBJC_02047 note conserved protein product hypothetical protein 2165871 2164267 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6896-MONOMER locus_tag OGMAPBJC_02048 note conserved protein with FAD/NAD(P)-binding domain product hypothetical protein 2166302 2165997 CDS gene ydhR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6895-MONOMER locus_tag OGMAPBJC_02049 product putative mono-oxygenase 2166486 2166410 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02050 product tRNA-Val(gac) 2166567 2166491 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02051 product tRNA-Val(gac) 2166875 2168131 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6894-MONOMER locus_tag OGMAPBJC_02052 note conserved protein product hypothetical protein 2169545 2168172 CDS gene mdtK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDHE-MONOMER locus_tag OGMAPBJC_02053 product multidrug efflux transporter MdtK 2169760 2170401 CDS EC_number 2.5.1.9 gene ribC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBOFLAVIN-SYN-MONOMER locus_tag OGMAPBJC_02054 product riboflavin synthase 2171589 2170441 CDS EC_number 2.1.1.79 gene cfa inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CFA-MONOMER locus_tag OGMAPBJC_02055 product cyclopropane fatty acyl phospholipid synthase 2173091 2171880 CDS gene ydhC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDHC-MONOMER locus_tag OGMAPBJC_02056 product putative transport protein YdhC 2173204 2174136 CDS gene ydhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12140-MONOMER locus_tag OGMAPBJC_02057 product protein with similarity to transcriptional regulators 2175158 2174133 CDS gene purR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00219 locus_tag OGMAPBJC_02058 product PurR-Hypoxanthine DNA-binding transcriptional repressor 2175457 2175546 CDS gene ynhF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2822 locus_tag OGMAPBJC_02059 product small stress response membrane protein 2175712 2176881 CDS gene ydhP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1657-MONOMER locus_tag OGMAPBJC_02060 product YdhP 2177697 2177116 CDS EC_number 1.15.1.1 gene sodB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUPEROX-DISMUTFE-MONOMER locus_tag OGMAPBJC_02061 product superoxide dismutase (Fe) 2178640 2177825 CDS gene ydhO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6892-MONOMER locus_tag OGMAPBJC_02062 product putative lipoprotein 2178974 2179321 CDS gene grxD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12181-MONOMER locus_tag OGMAPBJC_02063 product glutaredoxin 4 2183988 2179372 CDS gene lhr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11548-MONOMER locus_tag OGMAPBJC_02064 product member of ATP-dependent helicase superfamily II 2184728 2184081 CDS gene rnt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11547-MONOMER locus_tag OGMAPBJC_02065 product RNase T 2185238 2184831 CDS EC_number 4.4.1.5 gene gloA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYOXI-MONOMER locus_tag OGMAPBJC_02066 product glyoxalase I 2186416 2185319 CDS gene nemA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6890-MONOMER locus_tag OGMAPBJC_02067 product N-ethylmaleimide reductase, FMN-linked 2187052 2186453 CDS gene nemR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6889-MONOMER locus_tag OGMAPBJC_02068 product NemR DNA-binding transcriptional repressor 2187155 2187394 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6888-MONOMER locus_tag OGMAPBJC_02069 note conserved protein product hypothetical protein 2187443 2188339 CDS gene ydhF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6887-MONOMER locus_tag OGMAPBJC_02070 product putative oxidoreductase 2188420 2188941 CDS EC_number 1.15.1.1 gene sodC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6886-MONOMER locus_tag OGMAPBJC_02071 product superoxide dismutase precursor (Cu-Zn) 2190549 2188942 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6885-MONOMER locus_tag OGMAPBJC_02072 note conserved inner membrane protein product hypothetical protein 2190954 2190652 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6885-MONOMER locus_tag OGMAPBJC_02073 note conserved inner membrane protein product hypothetical protein 2191661 2190954 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6884-MONOMER locus_tag OGMAPBJC_02074 note conserved protein product hypothetical protein 2192050 2191814 CDS gene ydhI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6883-MONOMER locus_tag OGMAPBJC_02075 product putative inner membrane protein 2192251 2192685 CDS gene slyA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6882-MONOMER locus_tag OGMAPBJC_02076 product SlyA DNA-binding transcriptional activator 2193199 2192732 CDS gene slyB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6881-MONOMER locus_tag OGMAPBJC_02077 product outer membrane lipoprotein 2193473 2194582 CDS gene anmK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6880-MONOMER locus_tag OGMAPBJC_02078 product anhydro-N-acetylmuramic acid kinase 2194686 2195009 CDS gene mliC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11488-MONOMER locus_tag OGMAPBJC_02079 product inhibitor of c-type lysozyme, predicted lipoprotein 2195068 2195724 CDS EC_number 1.4.3.5 gene pdxH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PDXH-MONOMER locus_tag OGMAPBJC_02080 product pyridoxine 5'-phosphate oxidase / pyridoxamine 5'-phosphate oxidase 2195853 2197127 CDS EC_number 6.1.1.1 gene tyrS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TYRS-MONOMER locus_tag OGMAPBJC_02081 product tyrosyl-tRNA synthetase 2197189 2198049 CDS EC_number 2.7.1.35 gene pdxY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PDXY-MONOMER locus_tag OGMAPBJC_02082 product pyridoxal kinase 2 2198698 2198093 CDS EC_number 2.5.1.18 gene gstA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GST-MONOMER locus_tag OGMAPBJC_02083 product Gst 2200306 2198804 CDS gene tppB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1634-MONOMER locus_tag OGMAPBJC_02084 product tripeptide / dipeptide:H+ symporter 2200789 2200589 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02085 product hypothetical protein 2201552 2200917 CDS EC_number 4.2.99.18 gene nth inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10662-MONOMER locus_tag OGMAPBJC_02086 product endonuclease III; specific for apurinic and/or apyrimidinic sites 2202247 2201552 CDS gene rsxE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6876-MONOMER locus_tag OGMAPBJC_02087 product integral membrane protein of SoxR-reducing complex 2202871 2202251 CDS gene rsxG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6875-MONOMER locus_tag OGMAPBJC_02088 product member of SoxR-reducing complex 2203933 2202875 CDS gene rsxD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6874-MONOMER locus_tag OGMAPBJC_02089 product integral membrane protein of SoxR-reducing complex 2206156 2203934 CDS gene rsxC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6873-MONOMER locus_tag OGMAPBJC_02090 product member of SoxR-reducing complex 2206727 2206149 CDS gene rsxB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6872-MONOMER locus_tag OGMAPBJC_02091 product member of SoxR-reducing complex 2207308 2206727 CDS gene rsxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6871-MONOMER locus_tag OGMAPBJC_02092 product integral membrane protein of SoxR-reducing complex 2207825 2207385 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6870-MONOMER locus_tag OGMAPBJC_02093 note conserved inner membrane protein product hypothetical protein 2208126 2207911 CDS gene cnu inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6869-MONOMER locus_tag OGMAPBJC_02094 product H-NS- and StpA-binding protein 2208767 2209807 CDS gene ydgJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6868-MONOMER locus_tag OGMAPBJC_02095 product YdgJ 2210842 2209841 CDS EC_number 3.5.4.4 gene add inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADENODEAMIN-MONOMER locus_tag OGMAPBJC_02096 product adenosine deaminase 2212118 2210946 CDS EC_number 4.4.1.8 gene malY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10564-MONOMER locus_tag OGMAPBJC_02097 product bifunctional beta-cystathionase, PLP-dependent and regulator of maltose regulon 2213720 2212128 CDS EC_number 2.7.1.69 gene malX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALX-MONOMER locus_tag OGMAPBJC_02098 product maltose / glucose PTS permease - MalX subunit 2213895 2214923 CDS gene malI_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00361 locus_tag OGMAPBJC_02099 product MalI DNA-binding transcriptional repressor 2215035 2215802 CDS EC_number 1.1.1.159 gene hdhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:7-ALPHA-HYDROXYSTEROID-DEH-MONOMER locus_tag OGMAPBJC_02100 product 7-alpha-hydroxysteroid dehydrogenase 2216035 2216613 CDS gene uidR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6867-MONOMER locus_tag OGMAPBJC_02101 product UidR DNA-binding transcriptional repressor 2217004 2218815 CDS EC_number 3.2.1.31 gene uidA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BETA-GLUCURONID-MONOMER locus_tag OGMAPBJC_02102 product beta-D-glucuronidase 2218812 2220185 CDS gene uidB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UIDB-MONOMER locus_tag OGMAPBJC_02103 product glucuronide:H+ symporter 2220224 2221489 CDS gene uidC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6866-MONOMER locus_tag OGMAPBJC_02104 product membrane-associated protein 2221645 2221550 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02105 product hypothetical protein 2223223 2221715 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6865-MONOMER locus_tag OGMAPBJC_02106 note conserved protein product hypothetical protein 2224499 2223324 CDS EC_number 5.3.1.8 gene manA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANNPISOM-MONOMER locus_tag OGMAPBJC_02107 product mannose-6-phosphate isomerase 2224698 2226344 CDS EC_number 4.2.1.2 gene fumA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUMA-MONOMER locus_tag OGMAPBJC_02108 product fumarase A monomer 2226487 2227890 CDS EC_number 4.2.1.2 gene fumC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUMC-MONOMER locus_tag OGMAPBJC_02109 product fumarase C monomer 2228816 2227887 CDS gene tus inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11038-MONOMER locus_tag OGMAPBJC_02110 product DNA-binding protein; inhibition of replication at Ter sites 2230193 2228892 CDS EC_number 2.7.13.3 gene rstB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P18392 locus_tag OGMAPBJC_02111 product Sensor protein RstB 2230916 2230197 CDS gene yedW_6 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_02112 product putative DNA-binding response regulator in two-component system with YedV 2231045 2231380 CDS gene ydgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6863-MONOMER locus_tag OGMAPBJC_02113 product hypothetical protein 2232099 2231377 CDS EC_number 1.5.1.3 gene folM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6862-MONOMER locus_tag OGMAPBJC_02114 product dihydromonapterin reductase / dihydrofolate reductase 2233518 2232136 CDS gene ydgI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARCD-MONOMER locus_tag OGMAPBJC_02115 product ArcD APC transporter 2234648 2233704 CDS gene ydgH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6860-MONOMER locus_tag OGMAPBJC_02116 product putative protein 2235172 2236704 CDS EC_number 1.6.1.2 gene pntA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PNTA-MONOMER locus_tag OGMAPBJC_02117 product pyridine nucleotide transhydrogenase, alpha subunit 2236715 2238103 CDS EC_number 1.6.1.2 gene pntB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PNTB-MONOMER locus_tag OGMAPBJC_02118 product pyridine nucleotide transhydrogenase, beta subunit 2239162 2238128 CDS gene tqsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6859-MONOMER locus_tag OGMAPBJC_02119 product quorum signal AI-2 exporter 2239574 2239939 CDS gene mdtJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1600-MONOMER locus_tag OGMAPBJC_02120 product spermidine efflux transporter - MdtJ subunit 2239926 2240255 CDS gene mdtI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1599-MONOMER locus_tag OGMAPBJC_02121 product spermidine efflux transporter - MdtI subunit 2241115 2240294 CDS gene ydgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6856-MONOMER locus_tag OGMAPBJC_02122 product putative peptidase 2241699 2241391 CDS gene asr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6855-MONOMER locus_tag OGMAPBJC_02123 product acid shock protein 2243376 2242123 CDS gene ynfM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1596-MONOMER locus_tag OGMAPBJC_02124 product putative transport protein YnfM 2243483 2244376 CDS gene ynfL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6853-MONOMER locus_tag OGMAPBJC_02125 product putative DNA-binding transcriptional regulator 2244511 2245731 CDS gene mlc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01896 locus_tag OGMAPBJC_02126 product Mlc DNA-binding transcriptional repressor 2245856 2246551 CDS EC_number 6.3.3.3 gene ynfK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6851-MONOMER locus_tag OGMAPBJC_02127 product putative dethiobiotin synthetase 2247760 2246504 CDS gene clcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YNFJ-MONOMER locus_tag OGMAPBJC_02128 product chloride ion transporter ClcB 2248569 2247955 CDS gene dmsD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6849-MONOMER locus_tag OGMAPBJC_02129 product DMS reductase maturation protein 2249466 2248612 CDS gene ynfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6848-MONOMER locus_tag OGMAPBJC_02130 product oxidoreductase, predicted membrane anchor subunit 2250085 2249468 CDS gene ynfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6847-MONOMER locus_tag OGMAPBJC_02131 product oxidoreductase, predicted Fe-S subunit 2252492 2250096 CDS gene ynfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6846-MONOMER locus_tag OGMAPBJC_02132 product oxidoreductase subunit 2255006 2252580 CDS gene ynfE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6845-MONOMER locus_tag OGMAPBJC_02133 product oxidoreductase subunit 2255510 2255205 CDS gene ynfD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6844-MONOMER locus_tag OGMAPBJC_02134 product putative protein 2255582 2256328 CDS gene ynfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6843-MONOMER locus_tag OGMAPBJC_02135 product YnfC lipoprotein 2256891 2256331 CDS EC_number 2.3.1.57 gene speG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SPERMACTRAN-MONOMER locus_tag OGMAPBJC_02136 product spermidine acetyltransferase 2257267 2256926 CDS gene ynfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6841-MONOMER locus_tag OGMAPBJC_02137 product putative protein 2257402 2257728 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6840-MONOMER locus_tag OGMAPBJC_02138 note conserved inner membrane protein product hypothetical protein 2257934 2259148 CDS gene rspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6839-MONOMER locus_tag OGMAPBJC_02139 product mannonate/altronate dehydratase 2259160 2260179 CDS gene rspB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6838-MONOMER locus_tag OGMAPBJC_02140 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 2260237 2260365 CDS gene ynfP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPP1 locus_tag OGMAPBJC_02141 product Protein YnfP 2261647 2260367 CDS gene intQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6837-MONOMER locus_tag OGMAPBJC_02142 product Qin prophage; predicted defective integrase 2261918 2261682 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02143 product hypothetical protein 2264477 2262006 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02144 product hypothetical protein 2264761 2264570 CDS gene ydfD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11303-MONOMER locus_tag OGMAPBJC_02145 product Qin prophage; predicted protein 2264946 2264758 CDS gene dicB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10227-MONOMER locus_tag OGMAPBJC_02146 product Qin prophage; cell division inhibition protein 2265346 2265510 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02147 product hypothetical protein 2265732 2265514 CDS gene rzpQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11302-MONOMER locus_tag OGMAPBJC_02148 product Qin prophage; predicted protein 2265890 2265762 CDS gene ydfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11301-MONOMER locus_tag OGMAPBJC_02149 product Qin prophage; small protein 2266047 2265892 CDS gene ydfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11300-MONOMER locus_tag OGMAPBJC_02150 product Qin prophage; predicted protein 2266621 2266214 CDS gene dicA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10226-MONOMER locus_tag OGMAPBJC_02151 product DicA DNA-binding transcriptional repressor 2266705 2266935 CDS gene dicC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10228-MONOMER locus_tag OGMAPBJC_02152 product Qin prophage; DNA-binding transcriptional regulator for DicB 2266919 2267374 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02153 product hypothetical protein 2267371 2267496 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02154 product hypothetical protein 2268101 2268280 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02155 product hypothetical protein 2269271 2268441 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_02156 note IS150 conserved protein InsB product hypothetical protein 2269561 2269298 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_02157 product IS3 family transposase IS1222 2269840 2271153 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISEsa1 locus_tag OGMAPBJC_02158 product ISNCY family transposase ISEsa1 2271922 2271590 CDS gene flxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6833-MONOMER locus_tag OGMAPBJC_02159 product Qin prophage; predicted protein 2272455 2272694 CDS gene relB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10836-MONOMER locus_tag OGMAPBJC_02160 product RelB Qin prophage; antitoxin of the RelE-RelB toxin-antitoxin system and DNA binding transcriptional repressor 2272694 2272981 CDS gene relE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11131-MONOMER locus_tag OGMAPBJC_02161 product Qin prophage; toxin of the RelE-RelB toxin-antitoxin system and cofactor to enhance the repressor activity of RelB 2273053 2273208 CDS gene hokD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11130-MONOMER locus_tag OGMAPBJC_02162 product Qin prophage; small toxic polypeptide 2273425 2273676 CDS gene rem inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11129-MONOMER locus_tag OGMAPBJC_02163 product Qin prophage; predicted protein 2274023 2275072 CDS gene ydfU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6831-MONOMER locus_tag OGMAPBJC_02164 product Qin prophage; predicted protein 2275086 2275838 CDS gene ydfT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6830-MONOMER locus_tag OGMAPBJC_02165 product Qin prophage; predicted antitermination protein Q 2276472 2276260 CDS gene cspF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12205-MONOMER locus_tag OGMAPBJC_02166 product Qin prophage; cold shock protein 2276773 2276988 CDS gene cspB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12203-MONOMER locus_tag OGMAPBJC_02167 product Qin prophage; cold shock protein; predicted DNA-binding transcriptional regulator 2277709 2277590 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02168 product hypothetical protein 2277751 2277957 CDS gene essQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6829-MONOMER locus_tag OGMAPBJC_02169 product Qin prophage; predicted S lysis protein 2277962 2278273 CDS gene ydfR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6828-MONOMER locus_tag OGMAPBJC_02170 product Qin prophage; predicted protein 2278270 2278803 CDS EC_number 3.2.1.17 gene rrrQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6827-MONOMER locus_tag OGMAPBJC_02171 product Qin prophage; predicted lysozyme 2278800 2279297 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6826-MONOMER locus_tag OGMAPBJC_02172 note Qin prophage; conserved protein product hypothetical protein 2279660 2279872 CDS gene cspI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6825-MONOMER locus_tag OGMAPBJC_02173 product Qin prophage; cold shock protein 2280546 2280719 CDS gene gnsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6823-MONOMER locus_tag OGMAPBJC_02174 product Qin prophage; predicted protein 2281281 2280871 CDS gene ydfO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6822-MONOMER locus_tag OGMAPBJC_02175 product Qin prophage; predicted protein 2281448 2282473 CDS gene ydfN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6821-MONOMER locus_tag OGMAPBJC_02176 product Qin prophage; predicted side tail fibre assembly protein 2282473 2283048 CDS gene tfaQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6820-MONOMER locus_tag OGMAPBJC_02177 product Qin prophage; predicted tail fibre assembly protein 2283736 2283146 CDS gene pinQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6819-MONOMER locus_tag OGMAPBJC_02178 product Qin prophage; predicted site-specific recombinase 2284286 2284053 CDS gene ydfK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6818-MONOMER locus_tag OGMAPBJC_02179 product Qin prophage; cold shock gene, predicted DNA-binding transcriptional regulator 2285073 2286356 CDS gene ydfJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1543-MONOMER locus_tag OGMAPBJC_02180 product putative transporter 2286445 2287905 CDS gene ydfI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6816-MONOMER locus_tag OGMAPBJC_02181 product putative mannonate dehydrogenase 2288143 2287940 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6815-MONOMER locus_tag OGMAPBJC_02182 note conserved protein product hypothetical protein 2289006 2288320 CDS gene ydfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6814-MONOMER locus_tag OGMAPBJC_02183 product putative DNA-binding transcriptional regulator 2289841 2289095 CDS EC_number 1.1.1.298 gene ydfG_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12345-MONOMER locus_tag OGMAPBJC_02184 product 3-hydroxy acid dehydrogenase monomer 2289978 2292023 CDS gene dcp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10212-MONOMER locus_tag OGMAPBJC_02185 product dipeptidyl carboxypeptidase II 2292585 2292067 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11645-MONOMER locus_tag OGMAPBJC_02186 note conserved protein product hypothetical protein 2292896 2293159 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_02187 product IS3 family transposase IS1222 2293186 2294016 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_02188 note IS150 conserved protein InsB product hypothetical protein 2294086 2294478 CDS gene ydeI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11644-MONOMER locus_tag OGMAPBJC_02189 product stress response protein 2294733 2295623 CDS EC_number 2.7.7.65 gene ydeH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11643-MONOMER locus_tag OGMAPBJC_02190 product diguanylate cyclase 2295937 2295842 CDS gene yneM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-766 locus_tag OGMAPBJC_02191 product small membrane protein 2296552 2296064 CDS gene ydeE_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDEF-MONOMER locus_tag OGMAPBJC_02192 product putative transport protein YdeE 2297251 2296622 CDS gene ydeE_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDEF-MONOMER locus_tag OGMAPBJC_02193 product putative transport protein YdeE 2297446 2298345 CDS gene eamA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11639-MONOMER locus_tag OGMAPBJC_02194 product O-acetylserine/cysteine export protein 2298594 2298376 CDS gene marB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11599-MONOMER locus_tag OGMAPBJC_02195 product multiple antibiotic resistance protein 2299009 2298626 CDS gene marA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00365 locus_tag OGMAPBJC_02196 product MarA DNA-binding transcriptional dual regulator 2299463 2299029 CDS gene marR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00364 locus_tag OGMAPBJC_02197 product MarR transcriptional repressor 2299675 2300340 CDS gene marC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11637-MONOMER locus_tag OGMAPBJC_02198 product putative transporter 2301555 2300365 CDS gene ydeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDEA-MONOMER locus_tag OGMAPBJC_02199 product arabinose efflux transporter 2302820 2301705 CDS gene yneK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6813-MONOMER locus_tag OGMAPBJC_02200 product putative protein 2303779 2302898 CDS gene yneJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6812-MONOMER locus_tag OGMAPBJC_02201 product putative DNA-binding transcriptional regulator, LysR-type 2303880 2305268 CDS EC_number 1.2.1.16 gene sad inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6811-MONOMER locus_tag OGMAPBJC_02202 product NAD+-dependent succinate semialdehyde dehydrogenase 2305332 2306258 CDS EC_number 3.5.1.2 gene yneH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6810-MONOMER locus_tag OGMAPBJC_02203 product glutaminase 2306258 2306617 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6809-MONOMER locus_tag OGMAPBJC_02204 note conserved protein product hypothetical protein 2306756 2308174 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02205 product hypothetical protein 2308401 2309852 CDS EC_number 1.1.1.58 gene uxaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALTRO-OXIDOREDUCT-MONOMER locus_tag OGMAPBJC_02206 product altronate oxidoreductase 2310059 2310973 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6807-MONOMER locus_tag OGMAPBJC_02207 note conserved inner membrane protein product hypothetical protein 2311735 2310977 CDS EC_number 2.1.1.144 gene tam inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6806-MONOMER locus_tag OGMAPBJC_02208 product trans-aconitate methyltransferase 2312082 2311792 CDS gene lsrG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6805-MONOMER locus_tag OGMAPBJC_02209 product Autoinducer 2-degrading protein 2312981 2312106 CDS gene lsrF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6804-MONOMER locus_tag OGMAPBJC_02210 product putative class I aldolase 2313205 2313008 CDS gene lsrB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YNEA-MONOMER locus_tag OGMAPBJC_02211 product Autoinducer-2 ABC transporter - periplasmic binding protein 2314030 2313245 CDS gene lsrB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YNEA-MONOMER locus_tag OGMAPBJC_02212 product Autoinducer-2 ABC transporter - periplasmic binding protein 2315034 2314042 CDS gene lsrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDEZ-MONOMER locus_tag OGMAPBJC_02213 product Autoinducer-2 ABC transporter - membrane subunit 2316062 2315034 CDS gene lsrC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDEY-MONOMER locus_tag OGMAPBJC_02214 product Autoinducer-2 ABC transporter - membrane subunit 2317591 2316056 CDS gene lsrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDEX-MONOMER locus_tag OGMAPBJC_02215 product AI-2 ABC transporter - ATP binding subunit 2317840 2318793 CDS gene lsrR_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6799-MONOMER locus_tag OGMAPBJC_02216 product LsrR DNA-binding transcriptional repressor 2318872 2320464 CDS gene lsrK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6798-MONOMER locus_tag OGMAPBJC_02217 product autoinducer-2 kinase 2320995 2326415 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02218 product hypothetical protein 2326638 2326904 CDS gene hipB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10442-MONOMER locus_tag OGMAPBJC_02219 product HipB-HipA antitoxin/toxin complex and DNA-binding transcriptional repressor 2326904 2328226 CDS EC_number 2.7.11.1 db_xref COG:COG3550 gene hipA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P23874 locus_tag OGMAPBJC_02220 product Serine/threonine-protein kinase toxin HipA 2329461 2328514 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02221 product hypothetical protein 2331366 2330275 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02222 product hypothetical protein 2332340 2331510 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_02223 note IS150 conserved protein InsB product hypothetical protein 2332630 2332367 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_02224 product IS3 family transposase IS1222 2335025 2333502 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02225 product hypothetical protein 2335856 2335617 CDS gene insO-1_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6132-MONOMER locus_tag OGMAPBJC_02226 product CP4-6 prophage; partial transposase of insertion element IS911A, interrupted by insertion of IS30 element 2336371 2336069 CDS gene insN-1_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6130-MONOMER locus_tag OGMAPBJC_02227 product CP4-6 prophage; partial regulator of insertion element IS911A 2337063 2336428 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02228 product hypothetical protein 2338900 2337065 CDS gene uvrB_1 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_00204 locus_tag OGMAPBJC_02229 product UvrABC system protein B 2339822 2338992 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_02230 note IS150 conserved protein InsB product hypothetical protein 2340112 2339849 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_02231 product IS3 family transposase IS1222 2340447 2340181 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02232 product hypothetical protein 2341753 2342901 CDS gene ydeT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6795-MONOMER locus_tag OGMAPBJC_02233 product putative protein 2342915 2343445 CDS gene ydeS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6794-MONOMER locus_tag OGMAPBJC_02234 product putative fimbrial-like adhesin protein 2343458 2343961 CDS gene ydeR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6793-MONOMER locus_tag OGMAPBJC_02235 product putative fimbrial-like adhesin protein 2344020 2344934 CDS gene ydeQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6792-MONOMER locus_tag OGMAPBJC_02236 product putative fimbrial-like adhesin protein 2345268 2347547 CDS gene ydeP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6791-MONOMER locus_tag OGMAPBJC_02237 product acid resistance protein 2347795 2347992 CDS gene safA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2841 locus_tag OGMAPBJC_02238 product two-component system connector protein 2348067 2348828 CDS gene ydeO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6789-MONOMER locus_tag OGMAPBJC_02239 product YdeO DNA-binding transcriptional dual regulator 2349230 2350912 CDS gene ydeN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6788-MONOMER locus_tag OGMAPBJC_02240 product putative sulfatase 2350964 2352121 CDS gene ydeM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6787-MONOMER locus_tag OGMAPBJC_02241 product putative anaerobic sulfatase maturation enzyme; predicted DNA-binding transcriptional regulator 2352412 2354097 CDS gene yddA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDDA-MONOMER locus_tag OGMAPBJC_02242 product YddA complex 2354135 2356507 CDS gene yddB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11743-MONOMER locus_tag OGMAPBJC_02243 product putative porin protein 2356564 2359347 CDS gene pqqL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11744-MONOMER locus_tag OGMAPBJC_02244 product putative zinc peptidase 2359709 2361109 CDS EC_number 4.1.1.15 gene gadB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTDECARBOXB-MONOMER locus_tag OGMAPBJC_02245 product glutamate decarboxylase B subunit 2361265 2362800 CDS gene gadC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XASA-MONOMER locus_tag OGMAPBJC_02246 product glutamic acid:4-aminobutyrate antiporter 2362931 2364250 CDS gene yddW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6785-MONOMER locus_tag OGMAPBJC_02247 product putative lipoprotein 2364614 2365996 CDS EC_number 2.7.7.65 gene dosC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6784-MONOMER locus_tag OGMAPBJC_02248 product diguanylate cyclase 2366021 2368420 CDS EC_number 3.1.4.52 gene dosP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6783-MONOMER locus_tag OGMAPBJC_02249 product c-di-GMP phosphodiesterase, heme-regulated 2368678 2369259 CDS gene ddpX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6782-MONOMER locus_tag OGMAPBJC_02250 product D-Ala-D-Ala dipeptidase 2369273 2370823 CDS gene ddpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDDS-MONOMER locus_tag OGMAPBJC_02251 product YddS 2370825 2371847 CDS gene ddpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDDR-MONOMER locus_tag OGMAPBJC_02252 product YddR 2371844 2372740 CDS gene ddpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDDQ-MONOMER locus_tag OGMAPBJC_02253 product YddQ 2372737 2373723 CDS gene ddpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDDP-MONOMER locus_tag OGMAPBJC_02254 product YddP 2373716 2374642 CDS gene ddpF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDDO-MONOMER locus_tag OGMAPBJC_02255 product YddO 2375129 2374698 CDS EC_number 1.11.1.15 gene osmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10680-MONOMER locus_tag OGMAPBJC_02256 product osmotically inducible peroxidase OsmC 2375474 2375689 CDS gene bdm inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6776-MONOMER locus_tag OGMAPBJC_02257 product biofilm-dependent modulation protein 2375791 2375928 CDS gene sra inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11508-MONOMER locus_tag OGMAPBJC_02258 product 30S ribosomal subunit protein S22 2376085 2377782 CDS EC_number 1.1.1.38 gene maeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALIC-NAD-MONOMER locus_tag OGMAPBJC_02259 product malate dehydrogenase, NAD-requiring 2377916 2378926 CDS EC_number 1.1.1.1 gene adhP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADHP-MONOMER locus_tag OGMAPBJC_02260 product ethanol dehydrogenase / alcohol dehydrogenase 2379072 2379356 CDS gene yddM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6774-MONOMER locus_tag OGMAPBJC_02261 product putative DNA-binding transcriptional regulator 2380238 2379585 CDS gene fdnI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDNI-MONOMER locus_tag OGMAPBJC_02262 product formate dehydrogenase N, gamma subunit 2381115 2380231 CDS gene fdnH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDNH-MONOMER locus_tag OGMAPBJC_02263 product formate dehydrogenase N, beta subunit 2383539 2381128 CDS EC_number 1.2.1.2 gene fdnG_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDNG-MONOMER locus_tag OGMAPBJC_02264 product formate dehydrogenase N, alpha subunit 2384175 2383588 CDS EC_number 1.2.1.2 gene fdnG_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDNG-MONOMER locus_tag OGMAPBJC_02265 product formate dehydrogenase N, alpha subunit 2384464 2385288 CDS gene yddG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12713-MONOMER locus_tag OGMAPBJC_02266 product aromatic amino acid exporter 2385548 2385838 CDS gene yddL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6773-MONOMER locus_tag OGMAPBJC_02267 product putative lipoprotein 2385898 2386818 CDS gene yddK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6772-MONOMER locus_tag OGMAPBJC_02268 product putative protein 2386857 2387165 CDS gene yddJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6771-MONOMER locus_tag OGMAPBJC_02269 product hypothetical protein 2387199 2387462 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_02270 product IS3 family transposase IS1222 2387489 2388319 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_02271 note IS150 conserved protein InsB product hypothetical protein 2388741 2390129 CDS gene narU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARU-MONOMER locus_tag OGMAPBJC_02272 product nitrate:nitrite antiporter NarU 2390211 2393951 CDS EC_number 1.7.99.4 gene narZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARZ-MONOMER locus_tag OGMAPBJC_02273 product nitrate reductase Z, alpha subunit 2393948 2395492 CDS EC_number 1.7.99.4 gene narY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARY-MONOMER locus_tag OGMAPBJC_02274 product nitrate reductase Z, beta subunit 2395492 2396187 CDS gene narW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARW-MONOMER locus_tag OGMAPBJC_02275 product NarW, probable private chaperone for NarZ nitrate reductase subunit 2396184 2396864 CDS EC_number 1.7.99.4 gene narV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARV-MONOMER locus_tag OGMAPBJC_02276 product nitrate reductase Z, gamma subunit 2396943 2397836 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11825-MONOMER locus_tag OGMAPBJC_02277 note conserved protein product hypothetical protein 2398777 2397932 CDS EC_number 2.3.1.118 gene nhoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6770-MONOMER locus_tag OGMAPBJC_02278 product N-hydroxyarylamine O-acetyltransferase 2398950 2399519 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6769-MONOMER locus_tag OGMAPBJC_02279 note conserved protein product hypothetical protein 2399749 2399516 CDS gene pptA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11761-MONOMER locus_tag OGMAPBJC_02280 product putative 4-oxalocrotonate tautomerase (4-OT) monomer 2400985 2399849 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11526-MONOMER locus_tag OGMAPBJC_02281 note conserved protein product hypothetical protein 2402215 2401469 CDS gene yncI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6767-MONOMER locus_tag OGMAPBJC_02282 product putative protein 2402879 2402397 CDS gene ydcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11760-MONOMER locus_tag OGMAPBJC_02283 product hypothetical protein 2407086 2402863 CDS gene rhsD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10849-MONOMER locus_tag OGMAPBJC_02284 product RhsD protein in rhs element 2409261 2407153 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02285 product hypothetical protein 2410293 2410081 CDS gene yncH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6766-MONOMER locus_tag OGMAPBJC_02286 product hypothetical protein 2410986 2410369 CDS gene yncG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6765-MONOMER locus_tag OGMAPBJC_02287 product putative enzyme 2411253 2412752 CDS gene ansP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANSP-MONOMER locus_tag OGMAPBJC_02288 product L-asparagine transporter 2413926 2412865 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6763-MONOMER locus_tag OGMAPBJC_02289 note conserved protein product hypothetical protein 2414168 2416270 CDS gene yncD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6762-MONOMER locus_tag OGMAPBJC_02290 product putative TonB-dependent receptor 2416971 2416306 CDS gene mcbR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6761-MONOMER locus_tag OGMAPBJC_02291 product McbR DNA-binding transcriptional dual regulator 2418206 2417169 CDS EC_number 1.3.1 gene curA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6760-MONOMER locus_tag OGMAPBJC_02292 product NADPH-dependent curcumin/dihydrocurcumin reductase subunit 2418387 2418905 CDS gene mnaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6759-MONOMER locus_tag OGMAPBJC_02293 product L-amino acid N-acyltransferase 2418902 2419351 CDS gene ydcZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6758-MONOMER locus_tag OGMAPBJC_02294 product putative inner membrane protein 2419585 2419352 CDS gene ydcY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6757-MONOMER locus_tag OGMAPBJC_02295 product hypothetical protein 2419844 2419671 CDS gene ydcX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6756-MONOMER locus_tag OGMAPBJC_02296 product putative inner membrane protein 2421655 2420231 CDS EC_number 1.2.1.19 gene ydcW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6755-MONOMER locus_tag OGMAPBJC_02297 product gamma-aminobutyraldehyde dehydrogenase 2422471 2421677 CDS gene ydcV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDCV-MONOMER locus_tag OGMAPBJC_02298 product YdcS/YdcT/YdcV/YdcU ABC transporter 2423402 2422461 CDS gene ydcU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDCU-MONOMER locus_tag OGMAPBJC_02299 product YdcS/YdcT/YdcV/YdcU ABC transporter 2424416 2423403 CDS gene ydcT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDCT-MONOMER locus_tag OGMAPBJC_02300 product YdcS/YdcT/YdcV/YdcU ABC transporter 2425579 2424434 CDS gene ydcS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YDCS-MONOMER locus_tag OGMAPBJC_02301 product YdcS/YdcT/YdcV/YdcU ABC transporter 2427230 2425824 CDS gene ydcR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6750-MONOMER locus_tag OGMAPBJC_02302 product fused predicted DNA-binding transcriptional regulator and predicted amino transferase 2427746 2427309 CDS gene hicB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6749-MONOMER locus_tag OGMAPBJC_02303 product antitoxin of the HicA-HicB toxin-antitoxin system 2427947 2427771 CDS gene hicA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2673 locus_tag OGMAPBJC_02304 product toxin of the HicA-HicB toxin-antitoxin system 2428229 2428399 CDS gene yncJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6747-MONOMER locus_tag OGMAPBJC_02305 product putative protein 2430452 2428491 CDS gene ydcP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6746-MONOMER locus_tag OGMAPBJC_02306 product putative peptidase 2431061 2430525 CDS gene ydcN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6745-MONOMER locus_tag OGMAPBJC_02307 product putative DNA-binding transcriptional regulator 2431153 2432328 CDS gene ydcO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1433-MONOMER locus_tag OGMAPBJC_02308 product putative benzoate transporter 2433516 2432368 CDS gene ydcM_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6743-MONOMER locus_tag OGMAPBJC_02309 product putative transposase 2434776 2434108 CDS gene ydcL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6742-MONOMER locus_tag OGMAPBJC_02310 product putative lipoprotein 2435671 2435078 CDS gene tehB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11884-MONOMER locus_tag OGMAPBJC_02311 product tellurite methyltransferase 2436660 2435668 CDS gene tehA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TEHA-MONOMER locus_tag OGMAPBJC_02312 product TehA TDT transporter 2436784 2437764 CDS gene ydcK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6741-MONOMER locus_tag OGMAPBJC_02313 product putative enzyme 2438295 2437756 CDS gene rimL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10853-MONOMER locus_tag OGMAPBJC_02314 product ribosomal-protein-L12-serine acetyltransferase 2438582 2438358 CDS gene ydcH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12865-MONOMER locus_tag OGMAPBJC_02315 product putative protein 2440341 2438722 CDS gene mdoD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12859-MONOMER locus_tag OGMAPBJC_02316 product glucan biosynthesis protein D 2441945 2440602 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6738-MONOMER locus_tag OGMAPBJC_02317 note conserved protein product hypothetical protein 2442162 2443085 CDS gene ydcI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6737-MONOMER locus_tag OGMAPBJC_02318 product putative transcriptional regulator LysR-type 2444763 2443123 CDS gene trg inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRG-MONOMER locus_tag OGMAPBJC_02319 product methyl accepting chemotaxis protein - ribose/galactose/glucose sensing 2445104 2445271 CDS gene mokB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6736-MONOMER locus_tag OGMAPBJC_02320 product regulatory peptide whose translation enables hokB expression 2445556 2445383 CDS gene ydcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11219-MONOMER locus_tag OGMAPBJC_02321 product hypothetical protein 2446331 2445801 CDS gene cybB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYTOCHROME-B561-MONOMER locus_tag OGMAPBJC_02322 product cytochrome b561 2446520 2446636 CDS EC_number 1.2.1.12 gene gapA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GAPDH-A-MONOMER locus_tag OGMAPBJC_02323 product glyceraldehyde 3-phosphate dehydrogenase-A monomer 2446895 2447272 CDS EC_number 1.2.1.12 gene gapA_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GAPDH-A-MONOMER locus_tag OGMAPBJC_02324 product glyceraldehyde 3-phosphate dehydrogenase-A monomer 2447269 2447520 CDS EC_number 1.2.1.12 gene gapA_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GAPDH-A-MONOMER locus_tag OGMAPBJC_02325 product glyceraldehyde 3-phosphate dehydrogenase-A monomer 2449001 2447562 CDS EC_number 1.2.1.22 gene aldA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LACTALDDEHYDROG-MONOMER locus_tag OGMAPBJC_02326 product aldehyde dehydrogenase A, NAD-linked 2449998 2449198 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12110-MONOMER locus_tag OGMAPBJC_02327 note conserved protein product hypothetical protein 2454172 2450270 CDS gene hrpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6732-MONOMER locus_tag OGMAPBJC_02328 product ATP-dependent helicase 2454373 2454978 CDS gene azoR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6731-MONOMER locus_tag OGMAPBJC_02329 product NADH:quinone oxidoreductase, FMN-dependent 2456348 2455032 CDS gene ynbD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6730-MONOMER locus_tag OGMAPBJC_02330 product putative phosphatase, inner membrane protein 2457495 2456338 CDS gene ynbC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6729-MONOMER locus_tag OGMAPBJC_02331 product putative hydrolase 2458094 2457522 CDS gene ynbC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6729-MONOMER locus_tag OGMAPBJC_02332 product putative hydrolase 2459006 2458110 CDS gene ynbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6728-MONOMER locus_tag OGMAPBJC_02333 product putative CDP-diglyceride synthase 2459611 2459006 CDS gene ynbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6727-MONOMER locus_tag OGMAPBJC_02334 product YnbA 2462088 2459782 CDS gene ydbD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11310-MONOMER locus_tag OGMAPBJC_02335 product protein involved in detoxification of methylglyoxal 2463011 2462151 CDS gene ydbC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11309-MONOMER locus_tag OGMAPBJC_02336 product putative oxidoreductase, NAD(P)-binding 2469281 2463219 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02337 product hypothetical protein 2470202 2469612 CDS gene paaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6721-MONOMER locus_tag OGMAPBJC_02338 product putative hexapeptide repeat acetyltransferase 2471134 2470184 CDS gene paaX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6720-MONOMER locus_tag OGMAPBJC_02339 product PaaX DNA-binding transcriptional repressor 2472548 2471235 CDS EC_number 6.2.1.30 gene paaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6719-MONOMER locus_tag OGMAPBJC_02340 product phenylacetate-CoA ligase 2473780 2472575 CDS EC_number 2.3.1.174 gene paaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6718-MONOMER locus_tag OGMAPBJC_02341 product beta-ketoadipyl-CoA thiolase 2474202 2473780 CDS gene paaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6717-MONOMER locus_tag OGMAPBJC_02342 product hydroxyphenylacetyl-CoA thioesterase 2475574 2474192 CDS EC_number 1.1.1.157 gene paaH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6716-MONOMER locus_tag OGMAPBJC_02343 product 3-hydroxyadipyl-CoA dehydrogenase (NAD+) 2476409 2475621 CDS EC_number 4.2.1.17 gene paaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6715-MONOMER locus_tag OGMAPBJC_02344 product putative ring 1,2-epoxyphenylacetyl-CoA isomerase (oxepin-CoA forming) 2477176 2476409 CDS EC_number 4.2.1.17 gene paaF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6714-MONOMER locus_tag OGMAPBJC_02345 product putative 2,3-dehydroadipyl-CoA hydratase 2478243 2477173 CDS gene paaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6713-MONOMER locus_tag OGMAPBJC_02346 product ring 1,2-phenylacetyl-CoA epoxidase, reductase subunit 2478748 2478251 CDS gene paaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6712-MONOMER locus_tag OGMAPBJC_02347 product phenylacetate degradation protein 2479509 2478763 CDS gene paaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6711-MONOMER locus_tag OGMAPBJC_02348 product ring 1,2-phenylacetyl-CoA epoxidase, structural subunit 2479805 2479518 CDS gene paaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6710-MONOMER locus_tag OGMAPBJC_02349 product ring 1,2-phenylacetyl-CoA epoxidase subunit 2479819 2480481 CDS gene feaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6706-MONOMER locus_tag OGMAPBJC_02350 product FeaR DNA-binding transcriptional activator 2480979 2480653 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6705-MONOMER locus_tag OGMAPBJC_02351 note conserved protein product hypothetical protein 2481172 2480987 CDS gene ynbE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6704-MONOMER locus_tag OGMAPBJC_02352 product hypothetical protein 2483808 2481169 CDS gene ydbH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6703-MONOMER locus_tag OGMAPBJC_02353 product putative protein 2484016 2485005 CDS EC_number 1.1.1.28 gene ldhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DLACTDEHYDROGNAD-MONOMER locus_tag OGMAPBJC_02354 product D-lactate dehydrogenase - fermentative 2485116 2485538 CDS gene hslJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6702-MONOMER locus_tag OGMAPBJC_02355 product heat shock protein HslJ 2485801 2485535 CDS gene ydbJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2672 locus_tag OGMAPBJC_02356 product putative protein 2486075 2489599 CDS gene ydbK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6701-MONOMER locus_tag OGMAPBJC_02357 product putative pyruvate:flavodoxin oxidoreductase 2489966 2491099 CDS gene ompN_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6700-MONOMER locus_tag OGMAPBJC_02358 product outer membrane pore protein N, non-specific 2491240 2491674 CDS gene uspF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6699-MONOMER locus_tag OGMAPBJC_02359 product nucleotide binding filament protein 2491851 2492786 CDS gene ttcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6675-MONOMER locus_tag OGMAPBJC_02360 product putative C32 tRNA thiolase 2494288 2492915 CDS gene dbpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10210-MONOMER locus_tag OGMAPBJC_02361 product ATP-dependent RNA helicase, specific for 23S rRNA 2494491 2494318 CDS gene ynaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPO3 locus_tag OGMAPBJC_02362 product Protein YnaL 2495749 2494766 CDS gene ydaN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6674-MONOMER locus_tag OGMAPBJC_02363 product putative Zn(II) transporter 2496004 2497236 CDS EC_number 2.7.7.65 gene ydaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6673-MONOMER locus_tag OGMAPBJC_02364 product diguanylate cyclase, transcriptional modulator 2497820 2497257 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6672-MONOMER locus_tag OGMAPBJC_02365 note conserved protein with endonuclease activity product hypothetical protein 2499058 2498150 CDS gene abgR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6671-MONOMER locus_tag OGMAPBJC_02366 product putative DNA-binding transcriptional regulator, LYSR-type 2499234 2500544 CDS gene abgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6670-MONOMER locus_tag OGMAPBJC_02367 product p-aminobenzoyl-glutamate hydrolase subunit A 2500544 2501989 CDS gene abgB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6669-MONOMER locus_tag OGMAPBJC_02368 product p-aminobenzoyl-glutamate hydrolase subunit B 2502026 2503552 CDS gene abgT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ABGT-MONOMER locus_tag OGMAPBJC_02369 product p-aminobenzoyl glutamate:H+ symporter 2503563 2504078 CDS EC_number 2.1.1.63 gene ogt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10668-MONOMER locus_tag OGMAPBJC_02370 product Ogt 2504273 2505025 CDS gene fnr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00197 locus_tag OGMAPBJC_02371 product FNR DNA-binding transcriptional dual regulator 2505177 2506127 CDS gene uspE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11246-MONOMER locus_tag OGMAPBJC_02372 product universal stress protein with a role cellular motility 2506434 2506177 CDS gene ynaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6668-MONOMER locus_tag OGMAPBJC_02373 product putative inner membrane protein 2506678 2507709 CDS gene ynaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-82 locus_tag OGMAPBJC_02374 product mechanosensitive channel YnaI monomer 2509373 2507760 CDS gene mppA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6665-MONOMER locus_tag OGMAPBJC_02375 product murein tripeptide ABC transporter OppBCDFMppA - periplasmic binding protein 2510609 2509710 CDS gene ycjZ_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6664-MONOMER locus_tag OGMAPBJC_02376 product putative transcriptional regulator LysR-type 2510747 2511667 CDS gene ycjY_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6663-MONOMER locus_tag OGMAPBJC_02377 product putative hydrolase 2511738 2511920 CDS gene ymjC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2668 locus_tag OGMAPBJC_02378 product putative oxidoreductase 2512002 2512730 CDS gene mpaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6662-MONOMER locus_tag OGMAPBJC_02379 product murein peptide amidase A 2513670 2512705 CDS gene ycjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6661-MONOMER locus_tag OGMAPBJC_02380 product L-Ala-D/L-Glu epimerase 2513789 2514295 CDS gene tpx inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6660-MONOMER locus_tag OGMAPBJC_02381 product lipid hydroperoxide peroxidase 2515880 2514339 CDS gene tyrR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00413 locus_tag OGMAPBJC_02382 product TyrR DNA-binding transcriptional dual regulator 2517089 2516028 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12870-MONOMER locus_tag OGMAPBJC_02383 note conserved inner membrane protein product hypothetical protein 2518483 2517086 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6659-MONOMER locus_tag OGMAPBJC_02384 note conserved protein product hypothetical protein 2518639 2519637 CDS gene ycjW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6658-MONOMER locus_tag OGMAPBJC_02385 product putative DNA-binding transcriptional regulator, LacI type 2520653 2519748 CDS gene ompG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6657-MONOMER locus_tag OGMAPBJC_02386 product outer membrane porin OmpG 2521780 2520698 CDS gene ycjV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCJV-MONOMER locus_tag OGMAPBJC_02387 product putative sugar transporter subunit: ATP-binding component of ABC superfamily protein 2522453 2521794 CDS EC_number 5.4.2.6 gene ycjU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6655-MONOMER locus_tag OGMAPBJC_02388 product beta-phosphoglucomutase 2524717 2522450 CDS gene ycjT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6654-MONOMER locus_tag OGMAPBJC_02389 product putative hydrolase 2525769 2524714 CDS gene ycjS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6653-MONOMER locus_tag OGMAPBJC_02390 product putative oxidoreductase, NADH-binding 2526567 2525779 CDS gene ycjR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6652-MONOMER locus_tag OGMAPBJC_02391 product putative enzyme 2527638 2526586 CDS gene ycjQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6651-MONOMER locus_tag OGMAPBJC_02392 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 2528511 2527669 CDS gene ycjP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCJP-MONOMER locus_tag OGMAPBJC_02393 product YcjN/YcjO/YcjP ABC transporter 2529379 2528498 CDS gene ycjO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCJO-MONOMER locus_tag OGMAPBJC_02394 product YcjN/YcjO/YcjP ABC transporter 2530692 2529400 CDS gene ycjN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCJN-MONOMER locus_tag OGMAPBJC_02395 product YcjN/YcjO/YcjP ABC transporter 2532385 2530706 CDS EC_number 2.4.1.7 gene ycjM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6647-MONOMER locus_tag OGMAPBJC_02396 product putative glucosyltransferase 2532912 2532598 CDS EC_number 2.8.1.1 gene pspE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10780-MONOMER locus_tag OGMAPBJC_02397 product thiosulfate sulfurtransferase 2533208 2532987 CDS gene pspD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10779-MONOMER locus_tag OGMAPBJC_02398 product peripheral inner membrane phage-shock protein 2533576 2533217 CDS gene pspC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10778-MONOMER locus_tag OGMAPBJC_02399 product PspC transcriptional regulator; toxin of a PspC-PspB toxin-antitoxin pair 2533800 2533576 CDS gene pspB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10777-MONOMER locus_tag OGMAPBJC_02400 product stimulates PspC-mediated transcriptional activation of the psp operon; antitoxin of a PspC-PspB toxin-antitoxin pair 2534522 2533854 CDS gene pspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10776-MONOMER locus_tag OGMAPBJC_02401 product regulatory protein for the phage shock protein operon 2534689 2535666 CDS gene pspF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12344-MONOMER locus_tag OGMAPBJC_02402 product PspF transcriptional dual regulator 2537051 2535786 CDS EC_number 2.6.1.19 gene puuE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6646-MONOMER locus_tag OGMAPBJC_02403 product 4-aminobutyrate aminotransferase 2538369 2537089 CDS gene puuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11822-MONOMER locus_tag OGMAPBJC_02404 product gamma-glutamylputrescine oxidase 2539858 2538371 CDS EC_number 1.2.1.5 gene puuC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALDHDEHYDROG-MONOMER locus_tag OGMAPBJC_02405 product gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase 2540690 2540133 CDS gene puuR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12431-MONOMER locus_tag OGMAPBJC_02406 product DNA-binding transcriptional repressor 2541481 2540717 CDS EC_number 3.5.1.94 gene puuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6645-MONOMER locus_tag OGMAPBJC_02407 product gamma-glutamyl-gamma-aminobutyrate hydrolase 2541693 2543111 CDS EC_number 6.3.1.11 gene puuA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6644-MONOMER locus_tag OGMAPBJC_02408 product glutamate-putrescine ligase 2543414 2544799 CDS gene puuP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1296-MONOMER locus_tag OGMAPBJC_02409 product putrescine:H+ symporter PuuP 2544933 2545178 CDS gene ymjA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6642-MONOMER locus_tag OGMAPBJC_02410 product putative protein 2545491 2547134 CDS gene sapA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SAPA-MONOMER locus_tag OGMAPBJC_02411 product peptide ABC transporter SapABCDF - periplasmic binding protein 2547131 2548096 CDS gene sapB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SAPB-MONOMER locus_tag OGMAPBJC_02412 product peptide ABC transporter SapABCDF - membrane subunit 2548083 2548973 CDS gene sapC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SAPC-MONOMER locus_tag OGMAPBJC_02413 product peptide ABC transporter SapABCDF - membrane subunit 2548973 2549965 CDS gene sapD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SAPD-MONOMER locus_tag OGMAPBJC_02414 product peptide ABC transporter SapABCDF - ATP binding subunit 2549967 2550773 CDS gene sapF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SAPF-MONOMER locus_tag OGMAPBJC_02415 product peptide ABC transporter SapABCDF - ATP binding subunit 2551562 2552350 CDS EC_number 1.3.1.9 gene fabI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ENOYL-ACP-REDUCT-NADH-MONOMER locus_tag OGMAPBJC_02416 product enoyl-[acyl-carrier-protein] reductase 2552494 2553471 CDS gene yciW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6640-MONOMER locus_tag OGMAPBJC_02417 product putative oxidoreductase 2553688 2555622 CDS EC_number 3.1.13.1 gene rnb inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11620-MONOMER locus_tag OGMAPBJC_02418 product ribonuclease II 2555858 2557843 CDS EC_number 3.1.4.52 gene gmr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6639-MONOMER locus_tag OGMAPBJC_02419 product modulator of RNase II stability 2557991 2558164 CDS gene yciZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2820 locus_tag OGMAPBJC_02420 product hypothetical protein 2558254 2559003 CDS gene yciT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6638-MONOMER locus_tag OGMAPBJC_02421 product DNA-binding transcriptional regulator 2559272 2559490 CDS gene osmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10679-MONOMER locus_tag OGMAPBJC_02422 product OsmB osmotically inducible lipoprotein 2559942 2559616 CDS gene yciH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11128-MONOMER locus_tag OGMAPBJC_02423 product translation initiation factor 2560739 2559942 CDS EC_number 4.1.1.23 gene pyrF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OROTPDECARB-MONOMER locus_tag OGMAPBJC_02424 product orotidine-5'-phosphate decarboxylase 2562042 2560873 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12691-MONOMER locus_tag OGMAPBJC_02425 note conserved protein product hypothetical protein 2562357 2562049 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6637-MONOMER locus_tag OGMAPBJC_02426 note conserved inner membrane protein product hypothetical protein 2563270 2562506 CDS EC_number 3.6.1.27 gene pgpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGPPHOSPHAB-MONOMER locus_tag OGMAPBJC_02427 product undecaprenyl pyrophosphate phosphatase [multifunctional] 2563440 2564030 CDS EC_number 3.5.4.25 gene ribA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GTP-CYCLOHYDRO-II-MONOMER locus_tag OGMAPBJC_02428 product GTP cyclohydrolase II 2566769 2564094 CDS EC_number 4.2.1.3 gene acnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACONITASE-MONOMER locus_tag OGMAPBJC_02429 product aconitate hydratase 1 2567028 2566933 CDS gene ymiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPO1 locus_tag OGMAPBJC_02430 product Protein YmiC 2567309 2567142 CDS gene yciX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2886 locus_tag OGMAPBJC_02431 product putative protein 2567440 2567312 CDS gene ymiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2885 locus_tag OGMAPBJC_02432 product small predicted membrane protein 2568745 2567771 CDS gene cysB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00232 locus_tag OGMAPBJC_02433 product CysB-O-acetyl-L-serine DNA-binding transcriptional dual regulator 2571552 2568955 CDS EC_number 5.99.1.2 gene topA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11013-MONOMER locus_tag OGMAPBJC_02434 product DNA topoisomerase I 2571932 2572183 CDS gene yciN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12868-MONOMER locus_tag OGMAPBJC_02435 product putative protein 2573268 2572219 CDS gene sohB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10956-MONOMER locus_tag OGMAPBJC_02436 product putative inner membrane peptidase 2573488 2574246 CDS gene yciK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11759-MONOMER locus_tag OGMAPBJC_02437 product putative oxidoreductase 2574243 2574833 CDS EC_number 2.5.1.17 gene btuR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:COBALADENOSYLTRANS-MONOMER locus_tag OGMAPBJC_02438 product cobinamide adenosyltransferase / cobalamin adenosyltransferase 2575748 2574873 CDS gene rluB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12433-MONOMER locus_tag OGMAPBJC_02439 product 23S rRNA pseudouridine 2605 synthase 2577854 2575959 CDS gene yciQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6636-MONOMER locus_tag OGMAPBJC_02440 product putative inner membrane protein 2578502 2577882 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6635-MONOMER locus_tag OGMAPBJC_02441 note conserved protein product hypothetical protein 2579380 2578499 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6634-MONOMER locus_tag OGMAPBJC_02442 note conserved protein product hypothetical protein 2579654 2581216 CDS EC_number 4.1.3.27 gene trpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANTHRANSYNCOMPI-MONOMER locus_tag OGMAPBJC_02443 product anthranilate synthase component I 2581216 2582811 CDS EC_number 4.1.3.27 gene trpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ANTHRANSYNCOMPII-MONOMER locus_tag OGMAPBJC_02444 product anthranilate synthase component II 2582815 2584173 CDS EC_number 5.3.1.24 gene trpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PRAI-IGPS locus_tag OGMAPBJC_02445 product indole-3-glycerol phosphate synthase / phosphoribosylanthranilate isomerase 2584185 2585378 CDS EC_number 4.2.1.20 gene trpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRYPSYN-BPROTEIN locus_tag OGMAPBJC_02446 product tryptophan synthase, beta subunit 2585378 2586184 CDS EC_number 4.2.1.20 gene trpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRYPSYN-APROTEIN locus_tag OGMAPBJC_02447 product tryptophan synthase, alpha subunit 2586565 2586744 CDS gene yciG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11127-MONOMER locus_tag OGMAPBJC_02448 product putative protein 2586830 2587330 CDS gene yciF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11126-MONOMER locus_tag OGMAPBJC_02449 product putative structural protein 2587376 2587882 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11125-MONOMER locus_tag OGMAPBJC_02450 note conserved protein product hypothetical protein 2588580 2587942 CDS gene ompW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11124-MONOMER locus_tag OGMAPBJC_02451 product OmpW, outer membrane protein 2588937 2589680 CDS gene yciC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11123-MONOMER locus_tag OGMAPBJC_02452 product putative inner membrane protein 2589710 2590249 CDS gene yciB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11122-MONOMER locus_tag OGMAPBJC_02453 product putative inner membrane protein 2590354 2590752 CDS gene yciA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11121-MONOMER locus_tag OGMAPBJC_02454 product acyl-CoA thioesterase 2591511 2590792 CDS gene tonB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11012-MONOMER locus_tag OGMAPBJC_02455 product TonB energy transducing system - TonB subunit 2591735 2592031 CDS gene yciI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11607-MONOMER locus_tag OGMAPBJC_02456 product putative enzyme 2592331 2593584 CDS gene kch inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KCH-MONOMER locus_tag OGMAPBJC_02457 product K+ channel Kch monomer 2593955 2595415 CDS gene clsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARDIOLIPSYN-MONOMER locus_tag OGMAPBJC_02458 product cardiolipin synthase 2595450 2595779 CDS gene yciU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6633-MONOMER locus_tag OGMAPBJC_02459 product putative protein 2596836 2595832 CDS gene oppF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OPPF-MONOMER locus_tag OGMAPBJC_02460 product murein tripeptide ABC transporter / peptide ABC transporter - putative ATP binding subunit 2597846 2596833 CDS gene oppD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OPPD-MONOMER locus_tag OGMAPBJC_02461 product murein tripeptide ABC transporter / peptide ABC transporter - putative ATP binding subunit 2598766 2597858 CDS gene oppC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OPPC-MONOMER locus_tag OGMAPBJC_02462 product murein tripeptide ABC transporter / peptide ABC transporter - putative membrane subunit 2599701 2598781 CDS gene oppB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OPPB-MONOMER locus_tag OGMAPBJC_02463 product murein tripeptide ABC transporter / peptide ABC transporter - putative membrane subunit 2601463 2599787 CDS gene oppA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OPPA-MONOMER locus_tag OGMAPBJC_02464 product peptide ABC transporter - periplasmic binding protein 2601844 2602107 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_02465 product IS3 family transposase IS1222 2602134 2602964 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_02466 note IS150 conserved protein InsB product hypothetical protein 2603062 2603223 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02467 product hypothetical protein 2603354 2603199 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02468 product hypothetical protein 2604028 2603381 CDS gene ychE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11342-MONOMER locus_tag OGMAPBJC_02469 product putative inner membrane protein 2604505 2607180 CDS EC_number 1.2.1.10 gene adhE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADHE-MONOMER locus_tag OGMAPBJC_02470 product pyruvate formate-lyase deactivase [multifunctional] 2607304 2607489 CDS db_xref COG:COG3385 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISCro3 locus_tag OGMAPBJC_02471 product IS4 family transposase ISCro3 2607610 2608200 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02472 product hypothetical protein 2609099 2608482 CDS EC_number 2.7.1.21 gene tdk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TDK-MONOMER locus_tag OGMAPBJC_02473 product thymidine kinase / deoxyuridine kinase 2609704 2610117 CDS gene hns inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00288 locus_tag OGMAPBJC_02474 product H-NS DNA-binding transcriptional dual regulator 2611169 2610261 CDS EC_number 2.7.7.9 gene galU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUC1PURIDYLTRANS-MONOMER locus_tag OGMAPBJC_02475 product UTP--glucose-1-phosphate uridylyltransferase 2612384 2611371 CDS db_xref COG:COG0784 gene rssB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEV1 locus_tag OGMAPBJC_02476 product Regulator of RpoS 2613420 2612476 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12120-MONOMER locus_tag OGMAPBJC_02477 note conserved protein product hypothetical protein 2613494 2613952 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12119-MONOMER locus_tag OGMAPBJC_02478 note conserved protein product hypothetical protein 2614002 2614844 CDS EC_number 3.5.1.10 gene purU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FORMYLTHFDEFORMYL-MONOMER locus_tag OGMAPBJC_02479 product formyltetrahydrofolate deformylase 2615004 2615088 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02480 product tRNA-Tyr(gta) 2615298 2615382 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02481 product tRNA-Tyr(gta) 2616777 2616100 CDS EC_number 1.7.99.4 gene narI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARI-MONOMER locus_tag OGMAPBJC_02482 product nitrate reductase A, gamma subunit 2617487 2616777 CDS gene narJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARJ-MONOMER locus_tag OGMAPBJC_02483 product molybdenum cofactor assembly chaperone subunit (delta subunit) of nitrate reductase 1 2619022 2617484 CDS EC_number 1.7.99.4 gene narH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARH-MONOMER locus_tag OGMAPBJC_02484 product nitrate reductase A, beta subunit 2622762 2619019 CDS EC_number 1.7.99.4 gene narG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARG-MONOMER locus_tag OGMAPBJC_02485 product nitrate reductase A, alpha subunit 2624669 2623278 CDS gene narK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NARK-MONOMER locus_tag OGMAPBJC_02486 product nitrate:nitrite antiporter NarK 2624982 2624764 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02487 product hypothetical protein 2625008 2626804 CDS EC_number 2.7.13.3 gene narX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AFA2 locus_tag OGMAPBJC_02488 product Nitrate/nitrite sensor protein NarX 2626797 2627447 CDS gene fimZ_6 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_02489 product FimZ transcriptional regulator 2628842 2627448 CDS gene ychO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12405-MONOMER locus_tag OGMAPBJC_02490 product putative invasin 2629027 2629380 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12404-MONOMER locus_tag OGMAPBJC_02491 note conserved protein product hypothetical protein 2630140 2629424 CDS gene chaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12403-MONOMER locus_tag OGMAPBJC_02492 product putative cation transport protein 2630507 2630277 CDS gene chaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12402-MONOMER locus_tag OGMAPBJC_02493 product putative cation transport regulator 2630777 2631877 CDS gene chaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHAA-MONOMER locus_tag OGMAPBJC_02494 product Na+ / K+:H+ antiporter ChaA 2632281 2632388 CDS gene ldrC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1603 locus_tag OGMAPBJC_02495 product small toxic polypeptide LdrC 2632816 2632923 CDS gene ldrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1602 locus_tag OGMAPBJC_02496 product small toxic polypeptide LdrB 2633351 2633458 CDS gene ldrC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1603 locus_tag OGMAPBJC_02497 product small toxic polypeptide LdrC 2634461 2633607 CDS EC_number 2.5.1.55 gene kdsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDO-8PSYNTH-MONOMER locus_tag OGMAPBJC_02498 product 3-deoxy-D-manno-octulosonate 8-phosphate synthase 2635306 2634497 CDS gene ychA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11251-MONOMER locus_tag OGMAPBJC_02499 product putative transcriptional regulator 2635702 2635310 CDS gene ychQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6630-MONOMER locus_tag OGMAPBJC_02500 product putative transcriptional regulator 2636532 2635699 CDS EC_number 2.1.1 gene prmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12424-MONOMER locus_tag OGMAPBJC_02501 product protein-(glutamine-N5) methyltransferase 2637614 2636532 CDS gene prfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10761-MONOMER locus_tag OGMAPBJC_02502 product peptide chain release factor RF1 2638912 2637656 CDS EC_number 1.2.1.70 gene hemA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTRNAREDUCT-MONOMER locus_tag OGMAPBJC_02503 product glutamyl-tRNA reductase 2639126 2639749 CDS gene lolB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11293-MONOMER locus_tag OGMAPBJC_02504 product outer membrane lipoprotein, localization of lipoproteins in the outer membrane 2639749 2640600 CDS EC_number 2.7.1.148 gene ispE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11294-MONOMER locus_tag OGMAPBJC_02505 product 4-diphosphocytidyl-2-C-methylerythritol kinase 2640685 2641698 CDS EC_number 2.7.6.1 gene prs inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PRPPSYN-MONOMER locus_tag OGMAPBJC_02506 product ribose-phosphate diphosphokinase 2641850 2643502 CDS gene ychM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCHM-MONOMER locus_tag OGMAPBJC_02507 product bicarbonate / carbonate transporter 2643835 2643557 CDS gene ychH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11533-MONOMER locus_tag OGMAPBJC_02508 product stress-induced protein 2644113 2644697 CDS EC_number 3.1.1.29 gene pth inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10785-MONOMER locus_tag OGMAPBJC_02509 product peptidyl-tRNA hydrolase 2644814 2645905 CDS gene ychF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11404-MONOMER locus_tag OGMAPBJC_02510 product ribosome-binding ATPase 2646329 2646150 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02511 product hypothetical protein 2646674 2649541 CDS gene ycgV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6629-MONOMER locus_tag OGMAPBJC_02512 product putative adhesion and penetration protein 2651560 2649641 CDS gene dhaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6628-MONOMER locus_tag OGMAPBJC_02513 product DhaR DNA-binding transcriptional dual regulator 2651788 2652858 CDS gene dhaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6627-MONOMER locus_tag OGMAPBJC_02514 product dihydroxyacetone kinase subunit K 2652869 2653501 CDS gene dhaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1261 locus_tag OGMAPBJC_02515 product dihydroxyacetone kinase subunit L 2653512 2654930 CDS gene dhaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12399-MONOMER locus_tag OGMAPBJC_02516 product dihydroxyacetone kinase subunit M 2655250 2656947 CDS EC_number 3.2.1.28 gene treA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TREHALAPERI-MONOMER locus_tag OGMAPBJC_02517 product periplasmic trehalase 2657466 2657026 CDS gene ycgY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6625-MONOMER locus_tag OGMAPBJC_02518 product putative protein 2657898 2657644 CDS gene ymgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6624-MONOMER locus_tag OGMAPBJC_02519 product putative inner membrane protein 2658099 2658833 CDS gene ycgR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6623-MONOMER locus_tag OGMAPBJC_02520 product molecular brake that regulates flagellar motility in response to c-di-GMP 2659446 2658835 CDS EC_number 4.2.2 gene emtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6622-MONOMER locus_tag OGMAPBJC_02521 product lytic murein transglycosylase E 2659546 2660460 CDS gene ldcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6621-MONOMER locus_tag OGMAPBJC_02522 product L,D-carboxypeptidase A 2660555 2662291 CDS gene cvrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCGO-MONOMER locus_tag OGMAPBJC_02523 product YcgO CPA1 Transporter 2663747 2662677 CDS EC_number 5.1.1.1 gene dadX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALARACECAT-MONOMER locus_tag OGMAPBJC_02524 product alanine racemase 2, PLP-binding 2665055 2663757 CDS EC_number 1.4.99.1 gene dadA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DALADEHYDROGA-MONOMER locus_tag OGMAPBJC_02525 product D-amino acid dehydrogenase 2665385 2666917 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11516-MONOMER locus_tag OGMAPBJC_02526 note conserved protein product hypothetical protein 2667688 2666969 CDS gene fadR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01520 locus_tag OGMAPBJC_02527 product FadR DNA-binding transcriptional dual regulator 2667909 2669450 CDS gene nhaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NHAB-MONOMER locus_tag OGMAPBJC_02528 product sodium:H+ antiporter 2669596 2670126 CDS db_xref COG:COG1495 gene dsbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0A6M2 locus_tag OGMAPBJC_02529 product Disulfide bond formation protein B 2671440 2670172 CDS gene umuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11056-MONOMER locus_tag OGMAPBJC_02530 product SOS mutagenesis and repair 2671859 2671440 CDS gene umuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11057-MONOMER locus_tag OGMAPBJC_02531 product SOS mutagenesis; error-prone repair; processed to UmuD'; forms complex with UmuC 2672232 2673143 CDS gene hlyE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6619-MONOMER locus_tag OGMAPBJC_02532 product hemolysin E 2673796 2673350 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6618-MONOMER locus_tag OGMAPBJC_02533 note conserved protein product hypothetical protein 2674547 2673888 CDS gene ycgM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6617-MONOMER locus_tag OGMAPBJC_02534 product putative isomerase/hydrolase 2674912 2674619 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6616-MONOMER locus_tag OGMAPBJC_02535 note conserved protein product hypothetical protein 2675154 2675555 CDS gene pliG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6615-MONOMER locus_tag OGMAPBJC_02536 product inhibitor of g-type lysozyme 2676026 2675658 CDS gene ycgJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6614-MONOMER locus_tag OGMAPBJC_02537 product putative protein 2676546 2677241 CDS gene minC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10596-MONOMER locus_tag OGMAPBJC_02538 product cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that regulate septum placement 2677265 2678077 CDS gene minD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10597-MONOMER locus_tag OGMAPBJC_02539 product membrane ATPase of the MinC-MinD-MinE system that regulates septum placement 2678081 2678347 CDS gene minE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10598-MONOMER locus_tag OGMAPBJC_02540 product cell division topological specificity factor and inhibitory component of the MinC-MinD-MinE system that regulates septum placement 2679698 2679982 CDS gene ymgG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6612-MONOMER locus_tag OGMAPBJC_02541 product putative protein 2679992 2680321 CDS gene ymgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6611-MONOMER locus_tag OGMAPBJC_02542 product putative protein 2681420 2680404 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6797-MONOMER locus_tag OGMAPBJC_02543 note conserved protein product hypothetical protein 2683025 2681505 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02544 product hypothetical protein 2683643 2683425 CDS gene ymgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2141 locus_tag OGMAPBJC_02545 product inner membrane protein that interacts with cell division proteins 2685298 2683775 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6608-MONOMER locus_tag OGMAPBJC_02546 note conserved inner membrane protein product hypothetical protein 2685878 2685630 CDS gene ymgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6607-MONOMER locus_tag OGMAPBJC_02547 product protein involved in biofilm formation 2686257 2685991 CDS gene ariR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6606-MONOMER locus_tag OGMAPBJC_02548 product regulator of acid resistance, influenced by indole 2686837 2686601 CDS gene ycgZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6604-MONOMER locus_tag OGMAPBJC_02549 product putative protein 2687151 2687600 CDS gene bluF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6603-MONOMER locus_tag OGMAPBJC_02550 product blue light-responsive regulator of BluR 2687730 2688362 CDS gene bluF_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6603-MONOMER locus_tag OGMAPBJC_02551 product blue light-responsive regulator of BluR 2688567 2689298 CDS gene bluR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6602-MONOMER locus_tag OGMAPBJC_02552 product BluR DNA-binding transcriptional repressor 2689519 2689923 CDS gene ycgX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6601-MONOMER locus_tag OGMAPBJC_02553 product putative protein 2692299 2691049 CDS EC_number 1.1.1.42 gene icd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ISOCITDEH-SUBUNIT locus_tag OGMAPBJC_02554 product isocitrate dehydrogenase 2692471 2693124 CDS gene rluE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6581-MONOMER locus_tag OGMAPBJC_02555 product 23S rRNA pseudouridine 2457 synthase 2693134 2693595 CDS gene nudJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6580-MONOMER locus_tag OGMAPBJC_02556 product HMP-PP hydrolase /thiamin pyrophosphate hydrolase [multifunctional] 2693649 2694755 CDS gene mnmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11344-MONOMER locus_tag OGMAPBJC_02557 product tRNA-specific 2-thiouridylase 2694791 2695432 CDS gene hflD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11345-MONOMER locus_tag OGMAPBJC_02558 product lysogenization regulator 2695436 2696806 CDS EC_number 4.3.2.2 gene purB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASL-MONOMER locus_tag OGMAPBJC_02559 product adenylosuccinate lyase 2696975 2697646 CDS gene yedW_7 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_02560 product putative DNA-binding response regulator in two-component system with YedV 2697646 2699106 CDS EC_number 2.7.13.3 db_xref COG:COG0642 gene phoQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P23837 locus_tag OGMAPBJC_02561 product Sensor protein PhoQ 2699182 2700303 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11430-MONOMER locus_tag OGMAPBJC_02562 note conserved protein product hypothetical protein 2701578 2700352 CDS EC_number 3.4.11.4 gene pepT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11549-MONOMER locus_tag OGMAPBJC_02563 product peptidase T 2701828 2702964 CDS EC_number 3.6.3.31 gene potA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTA-MONOMER locus_tag OGMAPBJC_02564 product putrescine / spermidine ABC transporter - ATP binding subunit 2702948 2703805 CDS gene potB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTB-MONOMER locus_tag OGMAPBJC_02565 product putrescine / spermidine ABC transporter - membrane subunit 2703802 2704596 CDS gene potC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTC-MONOMER locus_tag OGMAPBJC_02566 product putrescine / spermidine ABC transporter - membrane subunit 2704593 2705639 CDS gene potD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTD-MONOMER locus_tag OGMAPBJC_02567 product putrescine / spermidine ABC transporter - periplasmic binding protein 2705697 2706158 CDS gene ymfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6579-MONOMER locus_tag OGMAPBJC_02568 product putative inner membrane protein 2706155 2706943 CDS gene ycfZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6578-MONOMER locus_tag OGMAPBJC_02569 product putative inner membrane protein 2707902 2707063 CDS gene cobB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6577-MONOMER locus_tag OGMAPBJC_02570 product protein deacetylase, Sir2 2708829 2707918 CDS EC_number 2.7.1.59 gene nagK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6576-MONOMER locus_tag OGMAPBJC_02571 product N-acetyl-D-glucosamine kinase 2710096 2708858 CDS gene lolE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCFW-MONOMER locus_tag OGMAPBJC_02572 product LolCDE ABC lipoprotein transporter 2710803 2710102 CDS gene lolD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCFV-MONOMER locus_tag OGMAPBJC_02573 product LolCDE ABC lipoprotein transporter 2711995 2710796 CDS gene lolC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCFU-MONOMER locus_tag OGMAPBJC_02574 product LolCDE ABC lipoprotein transporter 2712257 2713330 CDS gene ycfT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6572-MONOMER locus_tag OGMAPBJC_02575 product putative transport protein 2713410 2716904 CDS gene mfd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11619-MONOMER locus_tag OGMAPBJC_02576 product transcription-repair coupling factor 2717051 2718010 CDS gene ycfS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6571-MONOMER locus_tag OGMAPBJC_02577 product L,D-transpeptidase YcfS 2718349 2718092 CDS gene bhsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6570-MONOMER locus_tag OGMAPBJC_02578 product outer membrane protein involved in copper permeability, stress resistance and biofilm formation 2718527 2719222 CDS gene comR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6569-MONOMER locus_tag OGMAPBJC_02579 product ComR DNA-binding transcriptional repressor 2719823 2719284 CDS gene ycfJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12444-MONOMER locus_tag OGMAPBJC_02580 product putative protein 2721337 2720033 CDS gene ndh inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NADH-DHII-MONOMER locus_tag OGMAPBJC_02581 product NADH:ubiquinone oxidoreductase II 2722279 2721737 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6568-MONOMER locus_tag OGMAPBJC_02582 note conserved protein product hypothetical protein 2723327 2722302 CDS EC_number 3.2.1.52 gene nagZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6567-MONOMER locus_tag OGMAPBJC_02583 product beta-N-acetylhexosaminidase 2724162 2723338 CDS EC_number 2.7.1.89 gene thiK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIKIN-MONOMER locus_tag OGMAPBJC_02584 product thiamin kinase 2724784 2724143 CDS gene lpoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6565-MONOMER locus_tag OGMAPBJC_02585 product outer membrane lipoprotein - activator of PBP1B activity 2725175 2724798 CDS gene ycfL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6564-MONOMER locus_tag OGMAPBJC_02586 product putative protein 2725537 2725178 CDS gene hinT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12172-MONOMER locus_tag OGMAPBJC_02587 product purine nucleoside phosphoramidase monomer 2725871 2728060 CDS gene fhuE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10306-MONOMER locus_tag OGMAPBJC_02588 product ferric coprogen outer membrane porin FhuE 2729553 2728120 CDS EC_number 2.7.1.69 gene ptsG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PTSG-MONOMER locus_tag OGMAPBJC_02589 product glucose PTS permease - PtsG subunit 2730645 2729848 CDS gene ycfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12303-MONOMER locus_tag OGMAPBJC_02590 product putative metallodependent hydrolase 2731660 2730656 CDS EC_number 2.7.7.7 gene holB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11500-MONOMER locus_tag OGMAPBJC_02591 product DNA polymerase III, delta prime subunit 2732298 2731657 CDS EC_number 2.7.4.9 gene tmk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTMPKI-MONOMER locus_tag OGMAPBJC_02592 product dTMP kinase 2733310 2732288 CDS gene yceG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11494-MONOMER locus_tag OGMAPBJC_02593 product putative aminodeoxychorismate lyase 2734122 2733313 CDS EC_number 4.1.3.38 gene pabC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADCLY-MONOMER locus_tag OGMAPBJC_02594 product para-aminobenzoate synthase multi-enzyme complex 2735483 2734242 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:3-OXOACYL-ACP-SYNTHII-MONOMER locus_tag OGMAPBJC_02595 note KASII product hypothetical protein 2735807 2735571 CDS gene acpP_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q0T5U2 locus_tag OGMAPBJC_02596 product Acyl carrier protein 2736752 2736018 CDS EC_number 1.1.1.100 gene fabG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:3-OXOACYL-ACP-REDUCT-MONOMER locus_tag OGMAPBJC_02597 product 3-oxo-acyl-[acyl-carrier-protein] reductase 2737694 2736765 CDS EC_number 2.3.1.39 gene fabD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALONYL-COA-ACP-TRANSACYL-MONOMER locus_tag OGMAPBJC_02598 product malonyl-CoA-ACP transacylase 2738663 2737710 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FABH-MONOMER locus_tag OGMAPBJC_02599 note KASIII product hypothetical protein 2739771 2738731 CDS EC_number 2.3.1 gene plsX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11437-MONOMER locus_tag OGMAPBJC_02600 product fatty acid/phospholipid synthesis protein 2740055 2739882 CDS gene rpmF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10890-MONOMER locus_tag OGMAPBJC_02601 product 50S ribosomal subunit protein L32 2740628 2740107 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11119-MONOMER locus_tag OGMAPBJC_02602 note conserved protein product hypothetical protein 2740788 2741411 CDS gene yceF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11438-MONOMER locus_tag OGMAPBJC_02603 product putative protein 2742482 2741523 CDS gene rluC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11118-MONOMER locus_tag OGMAPBJC_02604 product 23S rRNA pseudouridine synthase 2743055 2746240 CDS gene rne inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10859-MONOMER locus_tag OGMAPBJC_02605 product RNase E 2747389 2746436 CDS gene flgL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11545-MONOMER locus_tag OGMAPBJC_02606 product flagellar biosynthesis; hook-filament junction protein 2749044 2747401 CDS gene flgK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11967-MONOMER locus_tag OGMAPBJC_02607 product flagellar biosynthesis, hook-filament junction protein 1 2750051 2749110 CDS gene flgJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G366-MONOMER locus_tag OGMAPBJC_02608 product FlgJ 2751148 2750051 CDS gene flgI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLGI-FLAGELLAR-P-RING locus_tag OGMAPBJC_02609 product flagellar P-ring protein FlgI 2751858 2751160 CDS gene flgH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLGH-FLAGELLAR-L-RING locus_tag OGMAPBJC_02610 product flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide layer) ring protein 2752693 2751911 CDS gene flgG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLGG-FLAGELLAR-MOTOR-ROD-PROTEIN locus_tag OGMAPBJC_02611 product flagellar basal-body rod protein FlgG 2753620 2752865 CDS gene flgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLGF-FLAGELLAR-MOTOR-ROD-PROTEIN locus_tag OGMAPBJC_02612 product flagellar basal-body rod protein FlgF 2754848 2753640 CDS gene flgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G361-MONOMER locus_tag OGMAPBJC_02613 product flagellar hook protein FlgE 2755568 2754873 CDS gene flgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G360-MONOMER locus_tag OGMAPBJC_02614 product flagellar biosynthesis, initiation of hook assembly 2755984 2755580 CDS gene flgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLGC-FLAGELLAR-MOTOR-ROD-PROTEIN locus_tag OGMAPBJC_02615 product flagellar basal-body rod protein FlgC 2756404 2755988 CDS gene flgB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLGB-FLAGELLAR-MOTOR-ROD-PROTEIN locus_tag OGMAPBJC_02616 product flagellar basal-body rod protein FlgB 2756559 2757218 CDS gene flgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G357-MONOMER locus_tag OGMAPBJC_02617 product flagellar biosynthesis; assembly of basal-body periplasmic P ring 2757294 2757587 CDS gene flgM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G369-MONOMER locus_tag OGMAPBJC_02618 product anti-sigma factor for FliA (sigma 28) 2757592 2758008 CDS gene flgN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6562-MONOMER locus_tag OGMAPBJC_02619 product flagellar biosynthesis protein FlgN 2759583 2758048 CDS gene murJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6561-MONOMER locus_tag OGMAPBJC_02620 product lipid II flippase 2760616 2759693 CDS gene yceM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6560-MONOMER locus_tag OGMAPBJC_02621 product putative oxidoreductase, NAD(P)-binding Rossmann-fold domain 2761265 2760618 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11537-MONOMER locus_tag OGMAPBJC_02622 note conserved protein product hypothetical protein 2761860 2761276 CDS EC_number 2.3.1.128 gene rimJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10851-MONOMER locus_tag OGMAPBJC_02623 product ribosomal-protein-S5-alanine N-acetyltransferase 2762096 2763304 CDS gene mdtH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1065-MONOMER locus_tag OGMAPBJC_02624 product YceL MFS transporter 2763368 2764015 CDS db_xref COG:COG2999 gene grxB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AC59 locus_tag OGMAPBJC_02625 product Glutaredoxin 2 2764149 2764709 CDS gene yceB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11117-MONOMER locus_tag OGMAPBJC_02626 product putative lipoprotein 2764815 2765861 CDS EC_number 3.5.2.3 gene pyrC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIHYDROOROT-MONOMER locus_tag OGMAPBJC_02627 product dihydroorotase 2765935 2766180 CDS gene dinI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6558-MONOMER locus_tag OGMAPBJC_02628 product DNA damage-inducible protein I 2766467 2766721 CDS gene bssS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6557-MONOMER locus_tag OGMAPBJC_02629 product regulator of biofilm formation 2766836 2767954 CDS gene solA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SARCOX-MONOMER locus_tag OGMAPBJC_02630 product N-methyltryptophan oxidase 2768002 2768115 CDS gene yceO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6555-MONOMER locus_tag OGMAPBJC_02631 product small protein involved in biofilm formation and acid stress response 2768376 2768942 CDS gene yceJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6554-MONOMER locus_tag OGMAPBJC_02632 product putative cytochrome b561 2768946 2769521 CDS gene yceI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11820-MONOMER locus_tag OGMAPBJC_02633 product putative protein 2770615 2769563 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11116-MONOMER locus_tag OGMAPBJC_02634 note conserved protein product hypothetical protein 2770840 2771760 CDS gene lpxL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LAUROYLACYLTRAN-MONOMER locus_tag OGMAPBJC_02635 product lauroyl acyltransferase 2771932 2773158 CDS gene mdtG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCEE-MONOMER locus_tag OGMAPBJC_02636 product multidrug efflux transporter MdtG 2773241 2773615 CDS gene msyB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11338-MONOMER locus_tag OGMAPBJC_02637 product acidic protein that suppresses mutants lacking function of protein export 2773843 2773616 CDS gene yceK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12689-MONOMER locus_tag OGMAPBJC_02638 product putative lipoprotein 2776529 2774016 CDS gene mdoH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11886-MONOMER locus_tag OGMAPBJC_02639 product membrane glycosyltransferase; synthesis of membrane-derived oligosaccharide (MDO) 2778054 2776552 CDS gene mdoG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11885-MONOMER locus_tag OGMAPBJC_02640 product periplasmic glucan (MDO) biosynthesis protein 2778481 2779638 CDS gene mdoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6552-MONOMER locus_tag OGMAPBJC_02641 product protein required for succinyl modification of osmoregulated periplasmic glucans 2781127 2779646 CDS gene ymdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6551-MONOMER locus_tag OGMAPBJC_02642 product putative hydrolase 2781602 2781069 CDS gene ymdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6550-MONOMER locus_tag OGMAPBJC_02643 product regulator of RNase III activity 2782008 2781697 CDS gene ymdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6549-MONOMER locus_tag OGMAPBJC_02644 product putative protein 2782461 2782129 CDS gene csgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6548-MONOMER locus_tag OGMAPBJC_02645 product putative curli production protein 2782958 2783875 CDS db_xref COG:COG3039 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISEc35 locus_tag OGMAPBJC_02646 product IS5 family transposase ISEc35 2784117 2784767 CDS gene csgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01379 locus_tag OGMAPBJC_02647 product CsgD DNA-binding transcriptional dual regulator 2784772 2785161 CDS gene csgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6545-MONOMER locus_tag OGMAPBJC_02648 product curli transport specificity factor 2785186 2785602 CDS gene csgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6544-MONOMER locus_tag OGMAPBJC_02649 product curli assembly component 2785629 2786462 CDS gene csgG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6543-MONOMER locus_tag OGMAPBJC_02650 product curli secretion channel 2787047 2786526 CDS gene ycdZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6542-MONOMER locus_tag OGMAPBJC_02651 product putative inner membrane protein 2787673 2787119 CDS gene ycdY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6541-MONOMER locus_tag OGMAPBJC_02652 product protein involved in maturation of YcdX 2788434 2787697 CDS gene ycdX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6540-MONOMER locus_tag OGMAPBJC_02653 product zinc-binding phosphatase 2789427 2788489 CDS EC_number 1.1.1.79 gene ghrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6539-MONOMER locus_tag OGMAPBJC_02654 product glyoxylate reductase / hydroxypyruvate reductase 2789661 2789748 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02655 product tRNA-Ser(gga) 2791470 2790484 CDS gene ycdU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6536-MONOMER locus_tag OGMAPBJC_02656 product putative inner membrane protein 2791790 2791467 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02657 product hypothetical protein 2791876 2792175 CDS gene insE-1_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6534-MONOMER locus_tag OGMAPBJC_02658 product IS3 element protein InsE 2792172 2793038 CDS gene insEF-1_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2748 locus_tag OGMAPBJC_02659 product IS3 element transposase 2794437 2793079 CDS EC_number 2.7.7.65 gene ycdT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6532-MONOMER locus_tag OGMAPBJC_02660 product diguanylate cyclase 2795024 2797447 CDS gene pgaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6531-MONOMER locus_tag OGMAPBJC_02661 product partially N-deacetylated poly-beta-1,6-N-acetyl-D-glucosamine outer membrane porin 2797456 2799474 CDS gene pgaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6530-MONOMER locus_tag OGMAPBJC_02662 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase 2799467 2800792 CDS gene pgaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6529-MONOMER locus_tag OGMAPBJC_02663 product UDP-N-acetyl-D-glucosamine beta-1,6-N-acetyl-D-glucosaminyl transferase 2800794 2801207 CDS gene pgaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6528-MONOMER locus_tag OGMAPBJC_02664 product inner membrane protein involved in biofilm formation 2802321 2801257 CDS gene phoH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11734-MONOMER locus_tag OGMAPBJC_02665 product ATP-binding protein 2803937 2802666 CDS gene efeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11735-MONOMER locus_tag OGMAPBJC_02666 product heme-containing peroxidase/deferrochelatase 2805070 2803943 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6527-MONOMER locus_tag OGMAPBJC_02667 note conserved protein product hypothetical protein 2805958 2805128 CDS db_xref COG:COG0672 gene efeU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q8XAS8 locus_tag OGMAPBJC_02668 product Ferrous iron permease EfeU 2808009 2806501 CDS gene putP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PUTP-MONOMER locus_tag OGMAPBJC_02669 product proline:Na+ symporter 2808432 2812427 CDS EC_number 1.5.99.8 gene putA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PUTA-MONOMER locus_tag OGMAPBJC_02670 product fused PutA transcriptional repressor / proline dehydrogenase / 1-pyrroline-5-carboxylate dehydrogenase 2813105 2812467 CDS gene rutR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01352 locus_tag OGMAPBJC_02671 product RutR DNA-binding transcriptional dual regulator 2813393 2814484 CDS EC_number 1.14.14 gene rutA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6523-MONOMER locus_tag OGMAPBJC_02672 product pyrimidine oxygenase 2814481 2815176 CDS EC_number 3.5.1 gene rutB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6522-MONOMER locus_tag OGMAPBJC_02673 product peroxyureidoacrylate / ureidoacrylate amido hydrolase 2815188 2815574 CDS gene rutC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6521-MONOMER locus_tag OGMAPBJC_02674 product putative aminoacrylate peracid reductase 2815582 2816382 CDS gene rutD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6520-MONOMER locus_tag OGMAPBJC_02675 product putative aminoacrylate hydrolase 2816392 2816982 CDS EC_number 1.1.1.298 gene rutE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6519-MONOMER locus_tag OGMAPBJC_02676 product putative malonic semialdehyde reductase 2816993 2817487 CDS gene rutF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6518-MONOMER locus_tag OGMAPBJC_02677 product flavin reductase 2817508 2818836 CDS gene rutG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B1006-MONOMER locus_tag OGMAPBJC_02678 product putative xanthine/uracil transporter 2819266 2819093 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2665 locus_tag OGMAPBJC_02679 note conserved protein product hypothetical protein 2819639 2820235 CDS gene wrbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01343 locus_tag OGMAPBJC_02680 product WrbA monomer 2820256 2820483 CDS gene yccJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12703-MONOMER locus_tag OGMAPBJC_02681 product putative protein 2821762 2820521 CDS EC_number 3.1.3.10 gene agp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUCOSE-1-PHOSPHAT-MONOMER locus_tag OGMAPBJC_02682 product 3-phytase / glucose-1-phosphatase 2823311 2822055 CDS gene yccE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12196-MONOMER locus_tag OGMAPBJC_02683 product putative protein 2823572 2824492 CDS gene cbpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12193-MONOMER locus_tag OGMAPBJC_02684 product CbpA monomer 2824492 2824797 CDS gene cbpM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12194-MONOMER locus_tag OGMAPBJC_02685 product chaperone modulator protein CbpM 2825548 2824949 CDS gene torD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12195-MONOMER locus_tag OGMAPBJC_02686 product chaperone protein for trimethylamine-N-oxide oxidoreductase I 2828091 2825545 CDS EC_number 1.7.2.3 gene torA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TORA-MONOMER locus_tag OGMAPBJC_02687 product trimethylamine N-oxide reductase, catalytic subunit 2829263 2828091 CDS EC_number 1.7.2.3 gene torC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11815-MONOMER locus_tag OGMAPBJC_02688 product TorC trimethylamine N-oxide reductase, cytochrome c-type subunit 2829393 2830085 CDS gene torR_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TORR-MONOMER locus_tag OGMAPBJC_02689 product TorR transcriptional dual regulator 2831086 2830058 CDS db_xref COG:COG1879 gene torT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P38683 locus_tag OGMAPBJC_02690 product Periplasmic protein TorT 2831214 2833913 CDS EC_number 2.7.13.3 db_xref COG:COG0784 gene torS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P39453 locus_tag OGMAPBJC_02691 product Sensor protein TorS 2833985 2835058 CDS gene yccM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6513-MONOMER locus_tag OGMAPBJC_02692 product putative 4Fe-4S membrane protein 2835280 2835107 CDS gene gnsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1701 locus_tag OGMAPBJC_02693 product putative regulator of phosphatidylethanolamine synthesis 2835886 2835674 CDS gene cspG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6511-MONOMER locus_tag OGMAPBJC_02694 product cold shock protein CspG 2836172 2836384 CDS gene cspH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6510-MONOMER locus_tag OGMAPBJC_02695 product stress protein, member of the CspA family 2836826 2837131 CDS gene gfcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6508-MONOMER locus_tag OGMAPBJC_02696 product putative protein 2837238 2837882 CDS gene gfcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6507-MONOMER locus_tag OGMAPBJC_02697 product putative outer membrane lipoprotein 2837879 2838625 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6506-MONOMER locus_tag OGMAPBJC_02698 note conserved protein product hypothetical protein 2838625 2840721 CDS gene gfcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6505-MONOMER locus_tag OGMAPBJC_02699 product putative lipoprotein 2840767 2841906 CDS gene gfcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6504-MONOMER locus_tag OGMAPBJC_02700 product putative exopolysaccharide export protein 2841894 2842340 CDS EC_number 3.1.3.48 gene etp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6503-MONOMER locus_tag OGMAPBJC_02701 product phosphotyrosine-protein phosphatase 2842360 2844540 CDS gene etk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11826-MONOMER locus_tag OGMAPBJC_02702 product autophosphorylating protein tyrosine kinase 2845953 2844655 CDS EC_number 3.1.3.26 gene appA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:APPA-MONOMER locus_tag OGMAPBJC_02703 product acid phosphatase 2846125 2846033 CDS gene yccB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2817 locus_tag OGMAPBJC_02704 product small outer membrane protein 2847274 2846138 CDS gene appB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:APPB-MONOMER locus_tag OGMAPBJC_02705 product cytochrome bd-II terminal oxidase subunit II 2848830 2847286 CDS gene appC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:APPC-MONOMER locus_tag OGMAPBJC_02706 product cytochrome bd-II terminal oxidase subunit I 2849821 2848964 CDS gene hyaF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10473-MONOMER locus_tag OGMAPBJC_02707 product protein involved in nickel incorporation into hydrogenase 1 proteins 2850216 2849818 CDS gene hyaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10472-MONOMER locus_tag OGMAPBJC_02708 product protein involved in quality control of HyaA 2850800 2850213 CDS gene hyaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10471-MONOMER locus_tag OGMAPBJC_02709 product protein involved in processing of HyaA and HyaB proteins 2851504 2850797 CDS gene hyaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYAC-MONOMER locus_tag OGMAPBJC_02710 product hydrogenase 1, b-type cytochrome subunit 2853316 2851523 CDS EC_number 1.12.99.6 gene hyaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYAB-MONOMER locus_tag OGMAPBJC_02711 product hydrogenase 1, large subunit 2854431 2853313 CDS EC_number 1.12.99.6 gene hyaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYAA-MONOMER locus_tag OGMAPBJC_02712 product hydrogenase 1, small subunit 2854858 2854945 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02713 product tRNA-Ser(tga) 2855152 2855811 CDS gene yccA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11113-MONOMER locus_tag OGMAPBJC_02714 product putative carrier/transport protein; substrate or modulator of FtsH-mediated proteolysis 2855902 2856231 CDS gene tusE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12876-MONOMER locus_tag OGMAPBJC_02715 product sulfur transfer protein 2856506 2856228 CDS EC_number 3.6.1.7 gene yccX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6502-MONOMER locus_tag OGMAPBJC_02716 product acylphosphatase 2856616 2857791 CDS gene rlmI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6501-MONOMER locus_tag OGMAPBJC_02717 product 23S rRNA methyltransferase monomer 2857849 2858166 CDS gene hspQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6500-MONOMER locus_tag OGMAPBJC_02718 product heat shock protein, hemimethylated DNA-binding protein 2858624 2858211 CDS gene yccU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6499-MONOMER locus_tag OGMAPBJC_02719 product putative CoA-binding protein with NAD(P)-binding Rossmann-fold domain protein 2858797 2859459 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6498-MONOMER locus_tag OGMAPBJC_02720 note conserved protein product hypothetical protein 2859555 2860013 CDS EC_number 4.2.3.3 gene mgsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:METHGLYSYN-MONOMER locus_tag OGMAPBJC_02721 product methylglyoxal synthase 2862099 2860045 CDS gene helD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10426-MONOMER locus_tag OGMAPBJC_02722 product DNA helicase IV 2862222 2862668 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6496-MONOMER locus_tag OGMAPBJC_02723 note conserved inner membrane protein product hypothetical protein 2862678 2864840 CDS gene yccS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6495-MONOMER locus_tag OGMAPBJC_02724 product putative inner membrane protein 2865432 2864803 CDS gene sxy inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6494-MONOMER locus_tag OGMAPBJC_02725 product transcriptional coactivator for CRP 2865651 2866160 CDS gene sulA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10984-MONOMER locus_tag OGMAPBJC_02726 product SOS cell division inhibitor 2866517 2867557 CDS gene ompA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10669-MONOMER locus_tag OGMAPBJC_02727 product outer membrane protein 3a (II*;G;d) 2868085 2867633 CDS gene matP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12855-MONOMER locus_tag OGMAPBJC_02728 product macrodomain Ter protein 2868271 2870031 CDS gene ycbZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6493-MONOMER locus_tag OGMAPBJC_02729 product putative ATP-dependent protease 2869992 2870618 CDS EC_number 4.2.1.60 gene fabA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FABA-MONOMER locus_tag OGMAPBJC_02730 product 3-hydroxydecanoyl-[acp] dehydrase 2870855 2870688 CDS gene rmf inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG50004-MONOMER locus_tag OGMAPBJC_02731 product ribosome modulation factor 2871674 2871111 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6492-MONOMER locus_tag OGMAPBJC_02732 note conserved protein product hypothetical protein 2873311 2871671 CDS gene pqiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6491-MONOMER locus_tag OGMAPBJC_02733 product paraquat-inducible protein B 2874569 2873316 CDS gene pqiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6490-MONOMER locus_tag OGMAPBJC_02734 product paraquat-inducible protein A 2876606 2874699 CDS gene uup inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UUP-MONOMER locus_tag OGMAPBJC_02735 product ATP-binding protein with possible role in replication 2878726 2876618 CDS EC_number 2.1.1.173 gene rlmL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6488-MONOMER locus_tag OGMAPBJC_02736 product fused 23S rRNA methyltransferase and 23S rRNA m7G2069 methyltransferase 2878970 2880079 CDS gene ycbX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6487-MONOMER locus_tag OGMAPBJC_02737 product protein involved in base analog detoxification 2880618 2880076 CDS gene zapC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6486-MONOMER locus_tag OGMAPBJC_02738 product cell division factor ZapC, localizes to the cytokinetic ring 2881802 2880792 CDS EC_number 1.3.5.2 gene pyrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIHYDROOROTOX-MONOMER locus_tag OGMAPBJC_02739 product dihydroorotate dehydrogenase, type 2 2882602 2881913 CDS gene ycbF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12397-MONOMER locus_tag OGMAPBJC_02740 product putative periplasmic pilin chaperone 2883179 2882616 CDS gene ycbV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6485-MONOMER locus_tag OGMAPBJC_02741 product putative fimbrial-like adhesin protein 2883681 2883139 CDS gene ycbU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6484-MONOMER locus_tag OGMAPBJC_02742 product putative fimbrial-like adhesin protein 2884763 2883693 CDS gene elfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6483-MONOMER locus_tag OGMAPBJC_02743 product putative fimbrial-like adhesin protein 2887354 2884754 CDS gene elfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6482-MONOMER locus_tag OGMAPBJC_02744 product putative outer membrane usher protein 2888080 2887379 CDS gene elfD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6481-MONOMER locus_tag OGMAPBJC_02745 product putative periplasmic pilin chaperone 2888702 2888163 CDS gene elfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6480-MONOMER locus_tag OGMAPBJC_02746 product fimbrial-like adhesin protein 2889058 2889633 CDS EC_number 1.5.1.38 gene ssuE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-146 locus_tag OGMAPBJC_02747 product NAD(P)H-dependent FMN reductase monomer 2889626 2890585 CDS gene ssuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6478-MONOMER locus_tag OGMAPBJC_02748 product aliphatic sulfonate ABC transporter - periplasmic binding protein 2890582 2891727 CDS EC_number 1.14.14.5 gene ssuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER-162 locus_tag OGMAPBJC_02749 product alkanesulfonate monooxygenase 2891738 2892529 CDS gene ssuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCBM-MONOMER locus_tag OGMAPBJC_02750 product aliphatic sulfonate ABC transporter - membrane subunit 2892526 2893293 CDS gene ssuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCBE-MONOMER locus_tag OGMAPBJC_02751 product aliphatic sulfonate ABC transporter - ATP binding subunit 2895948 2893336 CDS gene pepN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10696-MONOMER locus_tag OGMAPBJC_02752 product aminopeptidase N 2896214 2897416 CDS EC_number 2.4.2.11 gene pncB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NICOTINATEPRIBOSYLTRANS-MONOMER locus_tag OGMAPBJC_02753 product nicotinate phosphoribosyltransferase 2897585 2898985 CDS EC_number 6.1.1.22 gene asnS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASNS-MONOMER locus_tag OGMAPBJC_02754 product asparaginyl-tRNA synthetase 2899588 2900676 CDS gene ompF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10671-MONOMER locus_tag OGMAPBJC_02755 product The Colicin A Import System 2900861 2902051 CDS EC_number 2.6.1.1 gene aspC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPAMINOTRANS-MONOMER locus_tag OGMAPBJC_02756 product aspartate aminotransferase, PLP-dependent 2902920 2902273 CDS gene ycbL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6475-MONOMER locus_tag OGMAPBJC_02757 product putative metal-binding enzyme 2903495 2902947 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6474-MONOMER locus_tag OGMAPBJC_02758 note conserved protein product hypothetical protein 2905523 2903676 CDS gene ycbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11253-MONOMER locus_tag OGMAPBJC_02759 product L,D-transpeptidase YcbB 2910244 2905784 CDS gene mukB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10618-MONOMER locus_tag OGMAPBJC_02760 product cell division protein involved in chromosome partitioning 2910948 2910244 CDS gene mukE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11252-MONOMER locus_tag OGMAPBJC_02761 product protein involved in chromosome partitioning 2912251 2910929 CDS gene mukF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12165-MONOMER locus_tag OGMAPBJC_02762 product Ca2+-binding protein involved in chromosome partitioning 2913033 2912248 CDS gene smtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12167-MONOMER locus_tag OGMAPBJC_02763 product putative S-adenosylmethionine-dependent methyltransferase 2913169 2913948 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12166-MONOMER locus_tag OGMAPBJC_02764 note conserved inner membrane protein product hypothetical protein 2914818 2913925 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6473-MONOMER locus_tag OGMAPBJC_02765 note conserved protein product hypothetical protein 2915718 2914972 CDS EC_number 2.7.7.38 gene kdsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CPM-KDOSYNTH-MONOMER locus_tag OGMAPBJC_02766 product 3-deoxy-D-manno-octulosonate cytidylyltransferase 2915897 2915715 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6472-MONOMER locus_tag OGMAPBJC_02767 note conserved protein product hypothetical protein 2917181 2915949 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6471-MONOMER locus_tag OGMAPBJC_02768 note conserved protein product hypothetical protein 2918204 2917218 CDS EC_number 2.7.1.130 gene lpxK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TETRAACYLDISACC4KIN-MONOMER locus_tag OGMAPBJC_02769 product tetraacyldisaccharide 4'-kinase 2919949 2918201 CDS gene msbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10613-MONOMER locus_tag OGMAPBJC_02770 product ATP-binding lipopolysaccharide transport protein 2922250 2919986 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12375-MONOMER locus_tag OGMAPBJC_02771 note conserved inner membrane protein product hypothetical protein 2922742 2922458 CDS gene ihfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00348 locus_tag OGMAPBJC_02772 product integration host factor (IHF), beta subunit 2924575 2922902 CDS gene rpsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10900-MONOMER locus_tag OGMAPBJC_02773 product 30S ribosomal subunit protein S1 2925369 2924686 CDS gene cmk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CMPKI-MONOMER locus_tag OGMAPBJC_02774 product (d)CMP kinase 2926306 2925542 CDS gene ycaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6470-MONOMER locus_tag OGMAPBJC_02775 product putative heat shock protein 2927758 2926475 CDS EC_number 2.5.1.19 gene aroA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROA-MONOMER locus_tag OGMAPBJC_02776 product 3-phosphoshikimate-1-carboxyvinyltransferase 2928917 2927829 CDS EC_number 2.6.1.52 gene serC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSERTRANSAM-MONOMER locus_tag OGMAPBJC_02777 product phosphohydroxythreonine aminotransferase / 3-phosphoserine aminotransferase 2929808 2929116 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6469-MONOMER locus_tag OGMAPBJC_02778 note conserved inner membrane protein product hypothetical protein 2929938 2931698 CDS gene ycaO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6468-MONOMER locus_tag OGMAPBJC_02779 product protein involved in beta-methylthiolation of ribosomal protein S12 2932104 2932961 CDS gene focA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FOCA-MONOMER locus_tag OGMAPBJC_02780 product formate channel FocA 2933016 2935298 CDS EC_number 2.3.1.54 gene pflB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PYRUVFORMLY-MONOMER locus_tag OGMAPBJC_02781 product pyruvate formate-lyase (inactive) 2935490 2936230 CDS EC_number 1.97.1.4 gene pflA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PFLACTENZ-MONOMER locus_tag OGMAPBJC_02782 product pyruvate formate-lyase activating enzyme 2936902 2936312 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12702-MONOMER locus_tag OGMAPBJC_02783 note conserved protein product hypothetical protein 2937002 2937910 CDS gene ycaN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6467-MONOMER locus_tag OGMAPBJC_02784 product putative transcriptional regulator LYSR-type 2939341 2937911 CDS gene ycaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCAM locus_tag OGMAPBJC_02785 product YcaM predicted APC amino acid transporter 2940699 2939551 CDS gene ycaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YCAD-MONOMER locus_tag OGMAPBJC_02786 product YcaD MFS transporter 2941013 2941639 CDS gene ycaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11241-MONOMER locus_tag OGMAPBJC_02787 product putative hydrolase monomer 2942537 2941674 CDS gene dmsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DMSC-MONOMER locus_tag OGMAPBJC_02788 product dimethyl sulfoxide reductase, chain C 2943156 2942539 CDS gene dmsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DMSB-MONOMER locus_tag OGMAPBJC_02789 product dimethyl sulfoxide reductase, chain B 2945611 2943167 CDS gene dmsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DMSA-MONOMER locus_tag OGMAPBJC_02790 product dimethyl sulfoxide reductase, chain A 2947142 2945850 CDS EC_number 6.1.1.11 gene serS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SERS-MONOMER locus_tag OGMAPBJC_02791 product seryl-tRNA synthetase 2948576 2947233 CDS gene rarA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12690-MONOMER locus_tag OGMAPBJC_02792 product recombination factor 2949198 2948587 CDS gene lolA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6465-MONOMER locus_tag OGMAPBJC_02793 product periplasmic chaperone, effects translocation of lipoproteins from inner membrane to outer 2953346 2949357 CDS gene ftsK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6464-MONOMER locus_tag OGMAPBJC_02794 product essential cell division protein FtsK 2953975 2953481 CDS gene lrp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00353 locus_tag OGMAPBJC_02795 product Lrp transcriptional dual regulator 2954520 2955485 CDS EC_number 1.8.1.9 gene trxB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIOREDOXIN-REDUCT-NADPH-MONOMER locus_tag OGMAPBJC_02796 product thioredoxin reductase monomer 2955608 2957374 CDS gene cydD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYDD-MONOMER locus_tag OGMAPBJC_02797 product glutathione / L-cysteine efflux transporter - CydD subunit 2957375 2959096 CDS gene cydC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYDC-MONOMER locus_tag OGMAPBJC_02798 product glutathione / L-cysteine efflux transporter - CydC subunit 2959138 2959842 CDS EC_number 2.3.2.6 gene aat inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11112-MONOMER locus_tag OGMAPBJC_02799 product leucyl, phenylalanyl-tRNA-protein transferase 2960127 2960345 CDS gene infA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10504-MONOMER locus_tag OGMAPBJC_02800 product protein chain initiation factor IF-1 2960599 2960686 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02801 product tRNA-Ser(gga) 2963305 2961029 CDS gene clpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10156-MONOMER locus_tag OGMAPBJC_02802 product ClpAXP 2963656 2963336 CDS gene clpS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6463-MONOMER locus_tag OGMAPBJC_02803 product specificity factor for ClpA-ClpP chaperone-protease complex 2963979 2964203 CDS gene cspD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11111-MONOMER locus_tag OGMAPBJC_02804 product DNA replication inhibitor 2966222 2964276 CDS gene macB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MACB locus_tag OGMAPBJC_02805 product MacAB-TolC macrolide efflux transport system - membrane subunit 2967316 2966219 CDS gene macA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MACA locus_tag OGMAPBJC_02806 product MacAB-TolC macrolide efflux transport system - membrane fusion protein 2967449 2968441 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6460-MONOMER locus_tag OGMAPBJC_02807 note conserved protein product hypothetical protein 2970096 2968438 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6459-MONOMER locus_tag OGMAPBJC_02808 note conserved protein with a nucleotide triphosphate hydrolase domain product hypothetical protein 2970522 2971217 CDS gene aqpZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AQPZ-MONOMER locus_tag OGMAPBJC_02809 product water channel AqpZ 2971712 2972611 CDS gene ybjE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6458-MONOMER locus_tag OGMAPBJC_02810 product putative transporter 2972755 2974407 CDS gene hcp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6457-MONOMER locus_tag OGMAPBJC_02811 product hybrid-cluster protein 2974419 2975387 CDS gene hcr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6456-MONOMER locus_tag OGMAPBJC_02812 product NADH oxidoreductase 2975520 2977238 CDS EC_number 1.2.5.1 gene poxB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PYRUVOXID-MONOMER locus_tag OGMAPBJC_02813 product pyruvate oxidase monomer 2977275 2978276 CDS gene ltaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LTAA-MONOMER locus_tag OGMAPBJC_02814 product low-specificity L-threonine aldolase 2978287 2979717 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6454-MONOMER locus_tag OGMAPBJC_02815 note conserved protein with NAD(P)-binding Rossmann-fold domain product hypothetical protein 2979816 2980829 CDS gene ybjS_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6453-MONOMER locus_tag OGMAPBJC_02816 product putative NAD(P)H-binding oxidoreductase with NAD(P)-binding Rossmann-fold domain protein 2981656 2980826 CDS EC_number 3.5.1.28 gene amiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6452-MONOMER locus_tag OGMAPBJC_02817 product anhydro-N-acetylmuramoyl-L-alanine amidase 2981976 2981653 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6451-MONOMER locus_tag OGMAPBJC_02818 note conserved protein product hypothetical protein 2982102 2982617 CDS gene ybjP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6450-MONOMER locus_tag OGMAPBJC_02819 product putative lipoprotein 2982835 2983563 CDS gene artP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARTP-MONOMER locus_tag OGMAPBJC_02820 product arginine ABC transporter - ATP binding subunit 2983581 2984312 CDS gene artI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARTI-MONOMER locus_tag OGMAPBJC_02821 product arginine ABC transporter - uncharacterised subunit 2984319 2985035 CDS gene artQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARTQ-MONOMER locus_tag OGMAPBJC_02822 product arginine ABC transporter - membrane subunit 2985035 2985703 CDS gene artM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARTM-MONOMER locus_tag OGMAPBJC_02823 product arginine ABC transporter - membrane subunit 2985994 2986725 CDS gene artJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARTJ-MONOMER locus_tag OGMAPBJC_02824 product arginine ABC transporter - periplasmic binding protein 2988051 2986924 CDS gene rlmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6449-MONOMER locus_tag OGMAPBJC_02825 product 23S rRNA m5U747 methyltransferase 2988580 2988092 CDS gene ybjO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6448-MONOMER locus_tag OGMAPBJC_02826 product putative inner membrane protein 2989485 2988640 CDS gene potI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTI-MONOMER locus_tag OGMAPBJC_02827 product putrescine ABC transporter - membrane subunit 2990435 2989482 CDS gene potH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTH-MONOMER locus_tag OGMAPBJC_02828 product putrescine ABC transporter - membrane subunit 2991578 2990445 CDS gene potG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTG-MONOMER locus_tag OGMAPBJC_02829 product putrescine ABC transporter - ATP binding subunit 2992785 2991673 CDS gene potF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTF-MONOMER locus_tag OGMAPBJC_02830 product putrescine ABC transporter - periplasmic binding protein 2993612 2993136 CDS gene ybjN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6447-MONOMER locus_tag OGMAPBJC_02831 product putative oxidoreductase 2994602 2993700 CDS gene rimK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10852-MONOMER locus_tag OGMAPBJC_02832 product ribosomal protein S6 modification protein 2995385 2994663 CDS gene nfsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11261-MONOMER locus_tag OGMAPBJC_02833 product NADPH nitroreductase monomer 2995656 2995369 CDS gene ybjC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12842-MONOMER locus_tag OGMAPBJC_02834 product putative inner membrane protein 2995816 2996073 CDS db_xref COG:COG0695 gene grxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P68688 locus_tag OGMAPBJC_02835 product Glutaredoxin 1 2996480 2996103 CDS gene ybjM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6446-MONOMER locus_tag OGMAPBJC_02836 product putative inner membrane protein 2996750 2998435 CDS gene ybjL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6445-MONOMER locus_tag OGMAPBJC_02837 product putative transporter 2999146 2998610 CDS gene ybjK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6444-MONOMER locus_tag OGMAPBJC_02838 product putative DNA-binding transcriptional regulator 2999311 3000438 CDS gene ybjJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6443-MONOMER locus_tag OGMAPBJC_02839 product putative transporter 3000438 3001253 CDS gene ybjI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6442-MONOMER locus_tag OGMAPBJC_02840 product FMN phosphatase 3001345 3001623 CDS gene ybjH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6441-MONOMER locus_tag OGMAPBJC_02841 product putative protein 3002896 3001664 CDS gene mdfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CMR-MONOMER locus_tag OGMAPBJC_02842 product multidrug efflux transporter MdfA 3003181 3003777 CDS EC_number 3.6.1.27 gene ybjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6439-MONOMER locus_tag OGMAPBJC_02843 product undecaprenyl pyrophosphate phosphatase 3003835 3004593 CDS gene deoR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01196 locus_tag OGMAPBJC_02844 product DeoR DNA-binding transcriptional repressor 3005842 3004640 CDS EC_number 3.4.16.4 gene dacC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10203-MONOMER locus_tag OGMAPBJC_02845 product penicillin-binding protein 6 3006089 3006715 CDS EC_number 2.5.1.18 gene gstB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6438-MONOMER locus_tag OGMAPBJC_02846 product glutathione S-transferase B 3007827 3006712 CDS gene yliI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6437-MONOMER locus_tag OGMAPBJC_02847 product aldose sugar dehydrogenase 3008321 3007938 CDS gene bssR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6436-MONOMER locus_tag OGMAPBJC_02848 product regulator of biofilm formation 3008534 3009859 CDS gene rimO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6435-MONOMER locus_tag OGMAPBJC_02849 product ribosomal protein S12 D88 methylthiotransferase 3011234 3009906 CDS gene yliF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6434-MONOMER locus_tag OGMAPBJC_02850 product putative diguanylate cyclase 3013590 3011242 CDS EC_number 3.1.4.52 gene yliE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6433-MONOMER locus_tag OGMAPBJC_02851 product putative c-di-GMP-specific phosphodiesterase 3014679 3013768 CDS gene gsiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YLID-MONOMER locus_tag OGMAPBJC_02852 product glutathione ABC transporter - membrane subunit 3015602 3014682 CDS gene gsiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YLIC-MONOMER locus_tag OGMAPBJC_02853 product glutathione ABC transporter - membrane subunit 3017158 3015620 CDS gene gsiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YLIB-MONOMER locus_tag OGMAPBJC_02854 product glutathione ABC transporter - periplasmic binding protein 3019049 3017178 CDS gene gsiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YLIA-MONOMER locus_tag OGMAPBJC_02855 product glutathione ABC transporter - ATP binding subunit 3020001 3019036 CDS EC_number 3.4.19.5 db_xref COG:COG1446 gene iaaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P37595 locus_tag OGMAPBJC_02856 product Isoaspartyl peptidase 3020205 3021440 CDS gene moeA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10153-MONOMER locus_tag OGMAPBJC_02857 product molybdenum::molybdopterin ligase 3021440 3022189 CDS EC_number 2.7.7 gene moeB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10154-MONOMER locus_tag OGMAPBJC_02858 product molybdopterin-synthase adenylyltransferase 3022927 3022265 CDS gene fsaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6428-MONOMER locus_tag OGMAPBJC_02859 product Fsa 3023058 3023957 CDS EC_number 1.97.1.4 gene ybiY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6427-MONOMER locus_tag OGMAPBJC_02860 product putative pyruvate formate lyase activating enzyme 3023963 3026395 CDS EC_number 2.3.1.54 gene ybiW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6426-MONOMER locus_tag OGMAPBJC_02861 product putative pyruvate formate lyase 3026541 3027356 CDS EC_number 3.1.3.23 gene ybiV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6425-MONOMER locus_tag OGMAPBJC_02862 product sugar phosphatase 3027508 3028773 CDS gene ybiU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6424-MONOMER locus_tag OGMAPBJC_02863 product putative protein 3030606 3029014 CDS gene ybiT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6423-MONOMER locus_tag OGMAPBJC_02864 product putative ATP-binding component of a transport system 3030825 3031745 CDS gene ybiS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6422-MONOMER locus_tag OGMAPBJC_02865 product L,D-transpeptidase YbiS 3032922 3031804 CDS gene ybiR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6421-MONOMER locus_tag OGMAPBJC_02866 product putative transporter 3033386 3032919 CDS gene mntR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6420-MONOMER locus_tag OGMAPBJC_02867 product MntR-Mn2+ DNA-binding transcriptional dual regulator 3033572 3033700 CDS gene mntS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DKB3 locus_tag OGMAPBJC_02868 product Small protein MntS 3033972 3035555 CDS gene ybiP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6418-MONOMER locus_tag OGMAPBJC_02869 product putative hydrolase, inner membrane 3036119 3035604 CDS gene ompX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12117-MONOMER locus_tag OGMAPBJC_02870 product outer membrane protein X 3036472 3037359 CDS gene rhtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12134-MONOMER locus_tag OGMAPBJC_02871 product threonine / homoserine efflux transporter 3037658 3038161 CDS gene dps inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11415-MONOMER locus_tag OGMAPBJC_02872 product stationary phase nucleoid protein that sequesters iron and protects DNA from damage 3038565 3039311 CDS gene glnH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLNH-MONOMER locus_tag OGMAPBJC_02873 product glutamine ABC transporter - periplasmic binding protein 3039450 3040109 CDS gene glnP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLNP-MONOMER locus_tag OGMAPBJC_02874 product glutamine ABC transporter - membrane subunit 3040106 3040828 CDS gene glnQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLNQ-MONOMER locus_tag OGMAPBJC_02875 product glutamine ABC transporter - ATP binding subunit 3041089 3043314 CDS gene ybiO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6417-MONOMER locus_tag OGMAPBJC_02876 product mechanosensitive channel YbiO monomer 3044237 3043311 CDS EC_number 2.1.1.181 gene rlmF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6416-MONOMER locus_tag OGMAPBJC_02877 product 23S rRNA methyltransferase 3044513 3044773 CDS gene mcbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6415-MONOMER locus_tag OGMAPBJC_02878 product protein involved in colanic acid production 3045038 3047320 CDS gene fiu inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6414-MONOMER locus_tag OGMAPBJC_02879 product putative outer membrane receptor for iron transport 3047365 3048039 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6413-MONOMER locus_tag OGMAPBJC_02880 note conserved protein product hypothetical protein 3048113 3048379 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12421-MONOMER locus_tag OGMAPBJC_02881 note conserved protein product hypothetical protein 3048644 3048904 CDS gene ybiJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12422-MONOMER locus_tag OGMAPBJC_02882 product putative protein 3050218 3049133 CDS gene ybiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11581-MONOMER locus_tag OGMAPBJC_02883 product putative dehydrogenase 3051321 3050359 CDS gene ybiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11580-MONOMER locus_tag OGMAPBJC_02884 product putative transferase/phosphorylase 3053634 3051349 CDS gene dinG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11357-MONOMER locus_tag OGMAPBJC_02885 product ATP-dependent helicase 3053652 3054101 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11579-MONOMER locus_tag OGMAPBJC_02886 note conserved protein product hypothetical protein 3055697 3054333 CDS gene rhlE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11235-MONOMER locus_tag OGMAPBJC_02887 product ATP-dependent RNA helicase 3055926 3056597 CDS gene ybiH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12406-MONOMER locus_tag OGMAPBJC_02888 product putative DNA-binding transcriptional regulator 3056600 3057595 CDS gene ybhG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6412-MONOMER locus_tag OGMAPBJC_02889 product putative membrane fusion protein 3057588 3059324 CDS gene ybhF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBHF-MONOMER locus_tag OGMAPBJC_02890 product YbhF/YbhR/YbhS ABC transporter 3059317 3060450 CDS gene ybhS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBHS-MONOMER locus_tag OGMAPBJC_02891 product YbhF/YbhR/YbhS ABC transporter 3060461 3061567 CDS gene ybhR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBHR-MONOMER locus_tag OGMAPBJC_02892 product YbhF/YbhR/YbhS ABC transporter 3061939 3061529 CDS gene ybhQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6408-MONOMER locus_tag OGMAPBJC_02893 product putative inner membrane protein 3062072 3062833 CDS gene ybhP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6407-MONOMER locus_tag OGMAPBJC_02894 product putative DNase 3062830 3064071 CDS gene ybhO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6406-MONOMER locus_tag OGMAPBJC_02895 product cardiolipin synthase 2 3064071 3065027 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6405-MONOMER locus_tag OGMAPBJC_02896 note conserved inner membrane protein; predicted DNA-binding transcriptional regulator product hypothetical protein 3065776 3065063 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6404-MONOMER locus_tag OGMAPBJC_02897 note conserved inner membrane protein product hypothetical protein 3066685 3065981 CDS gene ybhL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6403-MONOMER locus_tag OGMAPBJC_02898 product putative inner membrane protein 3067274 3066822 CDS gene moaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11598-MONOMER locus_tag OGMAPBJC_02899 product molybdopterin synthase large subunit 3067521 3067276 CDS db_xref COG:COG1977 gene moaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P30748 locus_tag OGMAPBJC_02900 product Molybdopterin synthase sulfur carrier subunit 3067999 3067514 CDS gene moaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11666-MONOMER locus_tag OGMAPBJC_02901 product MoaC monomer 3068514 3068002 CDS gene moaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1501 locus_tag OGMAPBJC_02902 product MoaB subunit 3069525 3068536 CDS gene moaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11595-MONOMER locus_tag OGMAPBJC_02903 product molybdopterin biosynthesis protein A 3069922 3070830 CDS gene ybhK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6402-MONOMER locus_tag OGMAPBJC_02904 product putative transferase with NAD(P)-binding Rossmann-fold domain protein 3073043 3071022 CDS gene uvrB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11062-MONOMER locus_tag OGMAPBJC_02905 product DNA repair; excision nuclease subunit B 3074299 3073622 CDS EC_number 6.3.3.3 gene bioD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DETHIOBIOTIN-SYN-MONOMER locus_tag OGMAPBJC_02906 product dethiobiotin synthetase monomer 3075047 3074292 CDS gene bioC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10119-MONOMER locus_tag OGMAPBJC_02907 product malonyl-CoA methyltransferase 3076188 3075034 CDS EC_number 2.3.1.47 gene bioF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:7KAPSYN-MONOMER locus_tag OGMAPBJC_02908 product 8-amino-7-oxononanoate synthase monomer 3077225 3076185 CDS EC_number 2.8.1.6 gene bioB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BIOTIN-SYN-MONOMER locus_tag OGMAPBJC_02909 product biotin synthase monomer 3077312 3078601 CDS EC_number 2.6.1.62 gene bioA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DAPASYN-MONOMER locus_tag OGMAPBJC_02910 product adenosylmethionine-8-amino-7-oxononanoate aminotransferase monomer 3078660 3079136 CDS gene ybhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11238-MONOMER locus_tag OGMAPBJC_02911 product putative kinase inhibitor 3079288 3080571 CDS gene ybhC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12875-MONOMER locus_tag OGMAPBJC_02912 product outer membrane lipoprotein 3083066 3080805 CDS gene ybhJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6401-MONOMER locus_tag OGMAPBJC_02913 product putative hydratase 3084682 3083249 CDS gene ybhI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0770-MONOMER locus_tag OGMAPBJC_02914 product YbhI DASS Transporter 3085810 3084758 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6399-MONOMER locus_tag OGMAPBJC_02915 note conserved protein product hypothetical protein 3085994 3086947 CDS gene ybhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6398-MONOMER locus_tag OGMAPBJC_02916 product putative DNA-binding transcriptional regulator 3087983 3086988 CDS EC_number 3.1.1.31 gene pgl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:6PGLUCONOLACT-MONOMER locus_tag OGMAPBJC_02917 product 6-phosphogluconolactonase 3088138 3088956 CDS EC_number 3.1.3.74 gene ybhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11239-MONOMER locus_tag OGMAPBJC_02918 product pyridoxal phosphatase / fructose 1,6-bisphosphatase 3090015 3088957 CDS EC_number 3.6.3.29 gene modC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MODC-MONOMER locus_tag OGMAPBJC_02919 product molybdate ABC transporter - ATP binding subunit 3090707 3090018 CDS gene modB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MODB-MONOMER locus_tag OGMAPBJC_02920 product molybdate ABC transporter - membrane subunit 3091480 3090707 CDS gene modA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MODA-MONOMER locus_tag OGMAPBJC_02921 product molybdate ABC transporter - periplasmic binding protein 3091796 3091647 CDS gene acrZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6396-MONOMER locus_tag OGMAPBJC_02922 product small membrane protein involved in the cell envelope stress response 3091925 3092713 CDS gene modE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-185 locus_tag OGMAPBJC_02923 product ModE-MoO42- DNA-binding transcriptional dual regulator 3092781 3094253 CDS gene modF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MODF-MONOMER locus_tag OGMAPBJC_02924 product ModF 3094514 3095530 CDS EC_number 5.1.3.2 gene galE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPGLUCEPIM-MONOMER locus_tag OGMAPBJC_02925 product UDP-glucose 4-epimerase monomer 3095540 3096586 CDS EC_number 2.7.7.12 gene galT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GALACTURIDYLYLTRANS-MONOMER locus_tag OGMAPBJC_02926 product galactose-1-phosphate uridylyltransferase 3096590 3097738 CDS EC_number 2.7.1.6 gene galK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GALACTOKIN-MONOMER locus_tag OGMAPBJC_02927 product galactokinase 3097732 3098772 CDS EC_number 5.1.3.3 gene galM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALDOSE1EPIM-MONOMER locus_tag OGMAPBJC_02928 product galactose-1-epimerase 3098974 3099726 CDS gene gpmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GPMA-MONOMER locus_tag OGMAPBJC_02929 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase monomer 3100936 3099884 CDS EC_number 2.5.1.54 gene aroG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROG-MONOMER locus_tag OGMAPBJC_02930 product 2-dehydro-3-deoxyphosphoheptonate aldolase 3101252 3101632 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6394-MONOMER locus_tag OGMAPBJC_02931 note conserved protein product hypothetical protein 3101746 3102687 CDS gene zitB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0752-MONOMER locus_tag OGMAPBJC_02932 product Zn2+ / Cd2+ / Ni2+ / Cu2+ efflux transporter ZitB 3103403 3102684 CDS gene pnuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PNUC-MONOMER locus_tag OGMAPBJC_02933 product nicotinamide riboside transporter 3104484 3103441 CDS gene nadA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:QUINOLINATE-SYNTHA-MONOMER locus_tag OGMAPBJC_02934 product quinolinate synthase 3104837 3104762 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02935 product tRNA-Lys(ttt) 3105045 3104970 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02936 product tRNA-Lys(ttt) 3105267 3105192 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02937 product tRNA-Lys(ttt) 3105346 3105271 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02938 product tRNA-Val(tac) 3105473 3105398 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02939 product tRNA-Lys(ttt) 3105551 3105476 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02940 product tRNA-Val(tac) 3105762 3105687 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_02941 product tRNA-Lys(ttt) 3106718 3105927 CDS gene ybgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12854-MONOMER locus_tag OGMAPBJC_02942 product putative periplasmic protein 3107249 3106728 CDS gene pal inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10684-MONOMER locus_tag OGMAPBJC_02943 product The Colicin A Import System 3108576 3107284 CDS gene tolB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11008-MONOMER locus_tag OGMAPBJC_02944 product The Colicin A Import System 3109974 3108709 CDS gene tolA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11007-MONOMER locus_tag OGMAPBJC_02945 product The Colicin A Import System 3110467 3110039 CDS gene tolR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11011-MONOMER locus_tag OGMAPBJC_02946 product The Colicin A Import System 3111163 3110471 CDS gene tolQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11010-MONOMER locus_tag OGMAPBJC_02947 product The Colicin A Import System 3111564 3111160 CDS gene ybgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11110-MONOMER locus_tag OGMAPBJC_02948 product esterase/thioesterase 3112007 3111714 CDS gene ybgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12395-MONOMER locus_tag OGMAPBJC_02949 product putative lipoprotein 3112120 3112007 CDS gene ybgT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2663 locus_tag OGMAPBJC_02950 product small membrane protein 3113274 3112135 CDS gene cydB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYDB-MONOMER locus_tag OGMAPBJC_02951 product cytochrome bd-I terminal oxidase subunit II 3114858 3113290 CDS gene cydA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYDA-MONOMER locus_tag OGMAPBJC_02952 product cytochrome bd-I terminal oxidase subunit I 3118337 3115704 CDS gene mngB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG13236-MONOMER locus_tag OGMAPBJC_02953 product alpha-mannosidase 3120271 3118355 CDS EC_number 2.7.1.69 gene mngA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HRSA-MONOMER locus_tag OGMAPBJC_02954 product 2-O-alpha-mannosyl-D-glycerate PTS permease 3120440 3121162 CDS gene mngR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD01103 locus_tag OGMAPBJC_02955 product MngR DNA-binding transcriptional repressor 3122135 3121266 CDS EC_number 6.2.1.5 gene sucD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCCOASYN-ALPHA locus_tag OGMAPBJC_02956 product succinyl-CoA synthetase, alpha subunit 3123301 3122135 CDS EC_number 6.2.1.5 gene sucC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUCCCOASYN-BETA locus_tag OGMAPBJC_02957 product succinyl-CoA synthetase, beta subunit 3124884 3123667 CDS EC_number 2.3.1.61 db_xref COG:COG0508 gene sucB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AFG6 locus_tag OGMAPBJC_02958 product Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 3127700 3124899 CDS EC_number 1.2.4.2 gene sucA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:E1O-MONOMER locus_tag OGMAPBJC_02959 product subunit of E1(0) component of 2-oxoglutarate dehydrogenase 3128617 3127901 CDS EC_number 1.3.99.1 gene sdhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SDH-FE-S locus_tag OGMAPBJC_02960 product succinate dehydrogenase iron-sulfur protein 3130399 3128633 CDS EC_number 1.3.99.1 gene sdhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SDH-FLAVO locus_tag OGMAPBJC_02961 product succinate dehydrogenase flavoprotein 3130746 3130399 CDS EC_number 1.3.99.1 gene sdhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SDH-MEMB2 locus_tag OGMAPBJC_02962 product succinate dehydrogenase membrane protein 3131144 3130740 CDS EC_number 1.3.99.1 gene sdhC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SDH-MEMB1 locus_tag OGMAPBJC_02963 product succinate dehydrogenase membrane protein 3131525 3131632 CDS gene ybgU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPN5 locus_tag OGMAPBJC_02964 product Protein YbgU 3131838 3133121 CDS EC_number 2.3.3.1 gene gltA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CITSYN-MONOMER locus_tag OGMAPBJC_02965 product citrate synthase monomer 3133511 3134077 CDS gene ybgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12359-MONOMER locus_tag OGMAPBJC_02966 product putative fimbrial-like adhesin protein 3134137 3136584 CDS gene ybgQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6387-MONOMER locus_tag OGMAPBJC_02967 product putative outer membrane usher protein 3136599 3137327 CDS gene ybgP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6386-MONOMER locus_tag OGMAPBJC_02968 product putative fimbrial chaperone 3137324 3138385 CDS gene ybgO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6385-MONOMER locus_tag OGMAPBJC_02969 product putative fimbrial-like adhesin protein 3138537 3139583 CDS gene abrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6384-MONOMER locus_tag OGMAPBJC_02970 product putative regulator 3140371 3139580 CDS EC_number 4.2.99.18 gene nei inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6383-MONOMER locus_tag OGMAPBJC_02971 product endonuclease VIII 3141141 3140407 CDS gene ybgL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6382-MONOMER locus_tag OGMAPBJC_02972 product putative lactam utilization protein 3142063 3141131 CDS gene ybgK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6381-MONOMER locus_tag OGMAPBJC_02973 product putative carboxylase 3142713 3142057 CDS gene ybgJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6380-MONOMER locus_tag OGMAPBJC_02974 product putative carboxylase 3143479 3142736 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6379-MONOMER locus_tag OGMAPBJC_02975 note conserved metal-binding protein product hypothetical protein 3143750 3144463 CDS gene dtpD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0709-MONOMER locus_tag OGMAPBJC_02976 product dipeptide:H+ symporter DtpD 3145326 3144460 CDS gene insEF-1_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2748 locus_tag OGMAPBJC_02977 product IS3 element transposase 3145622 3145323 CDS gene insE-1_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6534-MONOMER locus_tag OGMAPBJC_02978 product IS3 element protein InsE 3145821 3146492 CDS gene dtpD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0709-MONOMER locus_tag OGMAPBJC_02979 product dipeptide:H+ symporter DtpD 3148060 3146642 CDS EC_number 4.1.99.3 gene phr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10736-MONOMER locus_tag OGMAPBJC_02980 product deoxyribodipyrimidine photolyase (photoreactivation) 3148566 3148057 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11108-MONOMER locus_tag OGMAPBJC_02981 note conserved protein product hypothetical protein 3149382 3148714 CDS gene ybfL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6377-MONOMER locus_tag OGMAPBJC_02982 product putative transposase; receptor protein 3149855 3149601 CDS gene ybfQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2662 locus_tag OGMAPBJC_02983 product putative transposase 3150650 3150081 CDS gene ybfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11523-MONOMER locus_tag OGMAPBJC_02984 product putative protein 3152080 3150647 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02985 product hypothetical protein 3152524 3152198 CDS gene ybfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11522-MONOMER locus_tag OGMAPBJC_02986 product putative inner membrane protein 3156717 3152524 CDS gene rhsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10848-MONOMER locus_tag OGMAPBJC_02987 product RhsC protein in rhs element 3157166 3156960 CDS gene ybfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11521-MONOMER locus_tag OGMAPBJC_02988 product putative protein 3157568 3159241 CDS EC_number 3.6.3.12 gene kdpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10513-MONOMER locus_tag OGMAPBJC_02989 product K+ transporting ATPase - K+ channel forming subunit 3159264 3161312 CDS EC_number 3.6.3.12 gene kdpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDPB-MONOMER locus_tag OGMAPBJC_02990 product K+ transporting ATPase - ATP binding subunit 3161321 3161893 CDS EC_number 3.6.3.12 gene kdpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10515-MONOMER locus_tag OGMAPBJC_02991 product K+ transporting ATPase - KdpC subunit 3161886 3164570 CDS EC_number 2.7.13.3 db_xref COG:COG2205 gene kdpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P21865 locus_tag OGMAPBJC_02992 product Sensor protein KdpD 3164567 3165244 CDS gene yedW_8 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_02993 product putative DNA-binding response regulator in two-component system with YedV 3165717 3165460 CDS gene ybfK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2815 locus_tag OGMAPBJC_02994 product hypothetical protein 3165840 3168038 CDS EC_number 4.1.1.17 gene speF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ORNDECARBOXDEG-MONOMER locus_tag OGMAPBJC_02995 product ornithine decarboxylase, degradative 3168035 3169354 CDS gene potE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:POTE-MONOMER locus_tag OGMAPBJC_02996 product putrescine:H+ symporter / putrescine:ornithine antiporter PotE 3169703 3170353 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_02997 product hypothetical protein 3170888 3170394 CDS gene ybfP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6374-MONOMER locus_tag OGMAPBJC_02998 product putative pectinase 3172742 3171102 CDS EC_number 5.4.2.2 gene pgm inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSPHOGLUCMUT-MONOMER locus_tag OGMAPBJC_02999 product phosphoglucomutase 3173313 3172768 CDS gene seqA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12197-MONOMER locus_tag OGMAPBJC_03000 product SeqA, negative modulator of initiation of replication 3173498 3174262 CDS gene ybfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11776-MONOMER locus_tag OGMAPBJC_03001 product esterase 3174333 3174695 CDS gene ybfE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11775-MONOMER locus_tag OGMAPBJC_03002 product LexA-regulated protein 3174835 3175365 CDS db_xref COG:COG0716 gene fldA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P61949 locus_tag OGMAPBJC_03003 product Flavodoxin 1 3175654 3176100 CDS gene fur inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00260 locus_tag OGMAPBJC_03004 product Fur-Fe2+ DNA-binding transcriptional dual regulator 3176510 3176184 CDS gene ybfN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6371-MONOMER locus_tag OGMAPBJC_03005 product putative lipoprotein 3177966 3176560 CDS gene chiP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6370-MONOMER locus_tag OGMAPBJC_03006 product chitobiose outer membrane porin 3180207 3178543 CDS EC_number 6.1.1.18 gene glnS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLNS-MONOMER locus_tag OGMAPBJC_03007 product glutaminyl-tRNA synthetase 3182421 3180475 CDS EC_number 2.7.1.69 gene nagE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAGE-MONOMER locus_tag OGMAPBJC_03008 product N-acetylglucosamine PTS permease 3182754 3183554 CDS EC_number 3.5.99.6 gene nagB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUCOSAMINE-6-P-DEAMIN-MONOMER locus_tag OGMAPBJC_03009 product glucosamine-6-phosphate deaminase 3183614 3184762 CDS EC_number 3.5.1.25 gene nagA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAG6PDEACET-MONOMER locus_tag OGMAPBJC_03010 product N-acetylglucosamine-6-phosphate deacetylase 3184771 3185991 CDS gene nagC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00266 locus_tag OGMAPBJC_03011 product NagC DNA-binding transcriptional dual regulator 3186039 3186791 CDS EC_number 3.1.3.5 gene nagD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10634-MONOMER locus_tag OGMAPBJC_03012 product ribonucleotide monophosphatase 3187188 3188852 CDS EC_number 6.3.5.4 gene asnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASNSYNB-MONOMER locus_tag OGMAPBJC_03013 product asparagine synthetase B 3189232 3189308 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03014 product tRNA-Met(cat) 3189318 3189402 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03015 product tRNA-Leu(tag) 3189426 3189500 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03016 product tRNA-Gln(ttg) 3189535 3189609 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03017 product tRNA-Gln(ttg) 3189625 3189701 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03018 product tRNA-Met(cat) 3189749 3189823 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03019 product tRNA-Gln(ctg) 3189861 3189935 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03020 product tRNA-Gln(ctg) 3191264 3190089 CDS gene ubiF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OCTAPRENYL-METHYL-METHOXY-BENZOQ-OH-MON locus_tag OGMAPBJC_03021 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase 3191410 3192834 CDS gene miaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6364-MONOMER locus_tag OGMAPBJC_03022 product isopentenyl-adenosine A37 tRNA methylthiolase MiaB 3192948 3194027 CDS gene ybeZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6363-MONOMER locus_tag OGMAPBJC_03023 product putative protein with nucleoside triphosphate hydrolase domain protein 3194024 3194491 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6362-MONOMER locus_tag OGMAPBJC_03024 note conserved protein involved in translation product hypothetical protein 3194581 3195459 CDS gene ybeX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6361-MONOMER locus_tag OGMAPBJC_03025 product putative ion transport protein 3195484 3197022 CDS gene lnt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10168-MONOMER locus_tag OGMAPBJC_03026 product apolipoprotein N-acyltransferase 3197426 3198334 CDS gene gltI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6359-MONOMER locus_tag OGMAPBJC_03027 product glutamate / aspartate ABC transporter - periplasmic binding protein 3198504 3199244 CDS gene gltJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLTJ-MONOMER locus_tag OGMAPBJC_03028 product glutamate / aspartate ABC transporter - membrane subunit 3199244 3199918 CDS gene gltK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLTK-MONOMER locus_tag OGMAPBJC_03029 product glutamate / aspartate ABC transporter - membrane subunit 3199918 3200643 CDS gene gltL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLTL-MONOMER locus_tag OGMAPBJC_03030 product glutamate / aspartate ABC transporter - ATP binding subunit 3200761 3201696 CDS gene rihA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6358-MONOMER locus_tag OGMAPBJC_03031 product ribonucleoside hydrolase 1 (pyrimidine-specific) 3201780 3203450 CDS gene hscC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6357-MONOMER locus_tag OGMAPBJC_03032 product Hsc62, Hsp70 family chaperone, binds to RpoD and inhibits transcription 3204961 3203510 CDS gene djlC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6356-MONOMER locus_tag OGMAPBJC_03033 product Hsc56, co-chaperone of Hsc62 3205665 3204958 CDS gene ybeU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6355-MONOMER locus_tag OGMAPBJC_03034 product putative tRNA ligase 3205767 3206321 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6354-MONOMER locus_tag OGMAPBJC_03035 note conserved outer membrane protein product hypothetical protein 3207758 3206331 CDS gene djlB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6353-MONOMER locus_tag OGMAPBJC_03036 product putative chaperone 3208462 3207755 CDS gene ybeR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6352-MONOMER locus_tag OGMAPBJC_03037 product putative protein 3208626 3209603 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6351-MONOMER locus_tag OGMAPBJC_03038 note conserved protein product hypothetical protein 3210155 3209673 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12851-MONOMER locus_tag OGMAPBJC_03039 note conserved protein product hypothetical protein 3210390 3212972 CDS EC_number 6.1.1.4 gene leuS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LEUS-MONOMER locus_tag OGMAPBJC_03040 product leucyl-tRNA synthetase 3212987 3213568 CDS gene lptE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10855-MONOMER locus_tag OGMAPBJC_03041 product outer membrane lipopolysaccharide transport and assembly complex - LptE subunit 3213568 3214599 CDS EC_number 2.7.7.7 gene holA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11412-MONOMER locus_tag OGMAPBJC_03042 product DNA polymerase III, delta subunit 3214601 3215242 CDS EC_number 2.7.7.18 gene nadD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NICONUCADENYLYLTRAN-MONOMER locus_tag OGMAPBJC_03043 product nicotinate-mononucleotide adenylyltransferase 3215266 3215877 CDS EC_number 3.1.3.73 gene cobC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBAZOLEPHOSPHAT-MONOMER locus_tag OGMAPBJC_03044 product putative adenosylcobalamin phosphatase/alpha-ribazole phosphatase 3216245 3216454 CDS gene rsfS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11255-MONOMER locus_tag OGMAPBJC_03045 product ribosomal silencing factor 3216458 3216925 CDS gene rlmH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11254-MONOMER locus_tag OGMAPBJC_03046 product 23S rRNA methyltransferase 3216956 3218857 CDS gene mrdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10606-MONOMER locus_tag OGMAPBJC_03047 product cell shape; peptidoglycan synthetase; penicillin-binding protein 2 3218860 3219972 CDS gene mrdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10607-MONOMER locus_tag OGMAPBJC_03048 product rod shape-determining membrane protein; sensitivity to radiation and drugs 3219983 3221071 CDS gene rlpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10854-MONOMER locus_tag OGMAPBJC_03049 product rare lipoprotein RlpA 3221138 3222421 CDS EC_number 3.4.16.4 gene dacA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10201-MONOMER locus_tag OGMAPBJC_03050 product D-alanyl-D-alanine carboxypeptidase, fraction A; penicillin-binding protein 5 3222531 3222794 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11592-MONOMER locus_tag OGMAPBJC_03051 note conserved protein product hypothetical protein 3222895 3223536 CDS EC_number 2.3.1.181 gene lipB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11591-MONOMER locus_tag OGMAPBJC_03052 product lipoyl(octanoyl) transferase 3223795 3224748 CDS gene ybeF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11594-MONOMER locus_tag OGMAPBJC_03053 product putative DNA-binding transcriptional regulator, LYSR-type 3224957 3225922 CDS EC_number 2.8.1.8 gene lipA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11306-MONOMER locus_tag OGMAPBJC_03054 product lipoate synthase monomer 3226226 3226023 CDS gene tatE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11305-MONOMER locus_tag OGMAPBJC_03055 product TatABCE protein export complex 3227143 3226355 CDS EC_number 3.5.1.128 gene ybeM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:A0A140NCB4 locus_tag OGMAPBJC_03056 product Deaminated glutathione amidase 3227236 3227619 CDS gene crcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12209-MONOMER locus_tag OGMAPBJC_03057 product F- efflux transporter / involved in resistance to camphor-induced chromosome decondensation 3227882 3227673 CDS gene cspE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12179-MONOMER locus_tag OGMAPBJC_03058 product transcription antiterminator and regulator of RNA stability 3228617 3228057 CDS gene pagP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12180-MONOMER locus_tag OGMAPBJC_03059 product PagP monomer 3229206 3230591 CDS gene dcuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DCUC-MONOMER locus_tag OGMAPBJC_03060 product dicarboxylate transporter DcuC 3231312 3230632 CDS db_xref COG:COG4565 gene dpiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEF4 locus_tag OGMAPBJC_03061 product Transcriptional regulatory protein DpiA 3232939 3231281 CDS EC_number 2.7.13.3 db_xref COG:COG3290 gene dpiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P77510 locus_tag OGMAPBJC_03062 product Sensor histidine kinase DpiB 3233318 3234376 CDS EC_number 6.2.1.22 gene citC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CITC-MONOMER locus_tag OGMAPBJC_03063 product citrate lyase synthetase 3234391 3234687 CDS gene citD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACPSUB-MONOMER locus_tag OGMAPBJC_03064 product citrate lyase, acyl carrier gamma subunit 3234684 3235592 CDS EC_number 4.1.3.6 gene citE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CITRYLY-MONOMER locus_tag OGMAPBJC_03065 product citrate lyase, citryl-ACP lyase beta subunit 3235603 3237135 CDS EC_number 4.1.3.6 gene citF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CITTRANS-MONOMER locus_tag OGMAPBJC_03066 product citrate lyase, citrate-ACP transferase alpha subunit 3237139 3237690 CDS EC_number 2.7.7.61 gene citX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6340-MONOMER locus_tag OGMAPBJC_03067 product apo-citrate lyase phosphoribosyl-dephospho-CoA transferase 3237665 3238543 CDS EC_number 2.7.8.25 gene citG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6339-MONOMER locus_tag OGMAPBJC_03068 product triphosphoribosyl-dephospho-CoA synthase 3238594 3240057 CDS gene citT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0612-MONOMER locus_tag OGMAPBJC_03069 product citrate:succinate antiporter 3240171 3240977 CDS EC_number 3.1.27.6 gene rna inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10856-MONOMER locus_tag OGMAPBJC_03070 product RNase I, cleaves phosphodiester bond between any two nucleotides 3241207 3241617 CDS gene rnk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6337-MONOMER locus_tag OGMAPBJC_03071 product regulator of nucleoside diphosphate kinase 3241755 3241844 CDS gene yldA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPN4 locus_tag OGMAPBJC_03072 product Protein YldA 3243086 3241848 CDS gene ybdR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6335-MONOMER locus_tag OGMAPBJC_03073 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 3243307 3243735 CDS gene uspG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6334-MONOMER locus_tag OGMAPBJC_03074 product universal stress protein UP12 3245451 3243856 CDS gene ahpF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11385-MONOMER locus_tag OGMAPBJC_03075 product AhpF component 3246229 3245666 CDS EC_number 1.11.1.15 gene ahpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11384-MONOMER locus_tag OGMAPBJC_03076 product AhpC component 3246601 3247347 CDS db_xref COG:COG1651 gene dsbG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P77202 locus_tag OGMAPBJC_03077 product Thiol:disulfide interchange protein DsbG 3247556 3248458 CDS gene ybdO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6332-MONOMER locus_tag OGMAPBJC_03078 product putative DNA-binding transcriptional regulator LYSR-type 3248605 3249825 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6331-MONOMER locus_tag OGMAPBJC_03079 note conserved protein product hypothetical protein 3249798 3250427 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6330-MONOMER locus_tag OGMAPBJC_03080 note conserved protein product hypothetical protein 3251588 3250428 CDS gene ybdL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6329-MONOMER locus_tag OGMAPBJC_03081 product methionine-oxo-acid transaminase, PLP-dependent 3251697 3252785 CDS gene ybdH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12692-MONOMER locus_tag OGMAPBJC_03082 product putative oxidoreductase 3252850 3253770 CDS gene nfrB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11739-MONOMER locus_tag OGMAPBJC_03083 product bacteriophage N4 receptor, inner membrane subunit 3253813 3254649 CDS gene nfrB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11739-MONOMER locus_tag OGMAPBJC_03084 product bacteriophage N4 receptor, inner membrane subunit 3254636 3257608 CDS gene nfrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11740-MONOMER locus_tag OGMAPBJC_03085 product bacteriophage N4 receptor, outer membrane protein 3257609 3258499 CDS gene ybcH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12448-MONOMER locus_tag OGMAPBJC_03086 product putative protein 3258682 3259443 CDS gene envY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00969 locus_tag OGMAPBJC_03087 product EnvY DNA-binding transcriptional activator 3259565 3259489 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03088 product tRNA-Arg(tct) 3259808 3260440 CDS gene fimZ_7 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11103-MONOMER locus_tag OGMAPBJC_03089 product FimZ transcriptional regulator 3260958 3260443 CDS gene sfmF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12388-MONOMER locus_tag OGMAPBJC_03090 product putative fimbrial-like adhesin protein 3261946 3260969 CDS gene sfmH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6293-MONOMER locus_tag OGMAPBJC_03091 product putative fimbrial-like adhesin protein 3264597 3261988 CDS gene sfmD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6292-MONOMER locus_tag OGMAPBJC_03092 product putative outer membrane export usher protein 3265320 3264628 CDS gene sfmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6291-MONOMER locus_tag OGMAPBJC_03093 product putative pilin chaperone, periplasmic 3266082 3265540 CDS gene sfmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6290-MONOMER locus_tag OGMAPBJC_03094 product putative fimbrial-like adhesin protein 3266553 3267419 CDS EC_number 3.5.4.9 gene folD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FOLD-MONOMER locus_tag OGMAPBJC_03095 product bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase 3267421 3267633 CDS gene ybcJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12879-MONOMER locus_tag OGMAPBJC_03096 product putative RNA-binding protein 3267741 3268262 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12708-MONOMER locus_tag OGMAPBJC_03097 note conserved inner membrane protein product hypothetical protein 3269683 3268298 CDS EC_number 6.1.1.16 gene cysS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYSS-MONOMER locus_tag OGMAPBJC_03098 product cysteinyl-tRNA synthetase 3269857 3270351 CDS EC_number 5.2.1.8 gene ppiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10758-MONOMER locus_tag OGMAPBJC_03099 product peptidyl-prolyl cis-trans isomerase B (rotamase B) 3270354 3271076 CDS gene lpxH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12666-MONOMER locus_tag OGMAPBJC_03100 product UDP-2,3-diacylglucosamine hydrolase 3271194 3271703 CDS EC_number 5.4.99.18 gene purE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PURE-MONOMER locus_tag OGMAPBJC_03101 product N5-carboxyaminoimidazole ribonucleotide mutase 3271700 3272767 CDS EC_number 6.3.4.18 gene purK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PURK-MONOMER locus_tag OGMAPBJC_03102 product N5-carboxyaminoimidazole ribonucleotide synthetase monomer 3273855 3272962 CDS EC_number 2.7.2.2 gene ybcF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12384-MONOMER locus_tag OGMAPBJC_03103 product putative carbamate kinase 3274667 3273852 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6289-MONOMER locus_tag OGMAPBJC_03104 note conserved protein product hypothetical protein 3275937 3274678 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6186-MONOMER locus_tag OGMAPBJC_03105 note conserved protein product hypothetical protein 3277614 3275947 CDS gene fdrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6287-MONOMER locus_tag OGMAPBJC_03106 product putative acyl-CoA synthetase with NAD(P)-binding Rossmann-fold domain protein 3277931 3278980 CDS EC_number 1.1.1.154 gene allD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6286-MONOMER locus_tag OGMAPBJC_03107 product ureidoglycolate dehydrogenase 3279002 3280237 CDS gene allC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6285-MONOMER locus_tag OGMAPBJC_03108 product allantoate amidohydrolase monomer 3280248 3281033 CDS gene allE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6284-MONOMER locus_tag OGMAPBJC_03109 product S-ureidoglycine aminohydrolase 3282406 3281261 CDS EC_number 2.7.1.31 gene glxK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLY3KIN-MONOMER locus_tag OGMAPBJC_03110 product glycerate kinase II 3283729 3282428 CDS gene ybbY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6282-MONOMER locus_tag OGMAPBJC_03111 product putative uracil/xanthine transporter 3285147 3283786 CDS EC_number 3.5.2.5 gene allB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6281-MONOMER locus_tag OGMAPBJC_03112 product allantoinase monomer 3286661 3285207 CDS gene ybbW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0511-MONOMER locus_tag OGMAPBJC_03113 product YbbW NCS1 Transporter 3287708 3286830 CDS EC_number 1.1.1.60 gene glxR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6278-MONOMER locus_tag OGMAPBJC_03114 product tartronate semialdehyde reductase 2 3288584 3287808 CDS EC_number 5.3.1.22 gene hyi inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6277-MONOMER locus_tag OGMAPBJC_03115 product hydroxypyruvate isomerase 3290378 3288597 CDS EC_number 4.1.1.47 gene gcl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYOCARBOLIG-MONOMER locus_tag OGMAPBJC_03116 product glyoxylate carboligase 3291283 3290468 CDS gene allR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6276-MONOMER locus_tag OGMAPBJC_03117 product AllR DNA-binding transcriptional repressor 3291843 3291361 CDS EC_number 3.5.3.19 gene allA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6275-MONOMER locus_tag OGMAPBJC_03118 product ureidoglycolate lyase 3292073 3292999 CDS gene allS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6274-MONOMER locus_tag OGMAPBJC_03119 product AllS transcriptional activator 3293068 3294162 CDS gene ybbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11768-MONOMER locus_tag OGMAPBJC_03120 product tRNA 2-selenouridine synthase 3294278 3294649 CDS gene ylbG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6273-MONOMER locus_tag OGMAPBJC_03121 product putative DNA-binding transcriptional regulator 3295654 3295394 CDS gene ybbD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11770-MONOMER locus_tag OGMAPBJC_03122 product putative protein 3296345 3295635 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6271-MONOMER locus_tag OGMAPBJC_03123 note conserved protein, rhs-like product hypothetical protein 3296713 3296345 CDS gene ybbC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11769-MONOMER locus_tag OGMAPBJC_03124 product putative protein 3301033 3296753 CDS gene rhsD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10849-MONOMER locus_tag OGMAPBJC_03125 product RhsD protein in rhs element 3303878 3301464 CDS gene ybbP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBBP-MONOMER locus_tag OGMAPBJC_03126 product YbbA/YbbP ABC transporter 3304561 3303875 CDS gene ybbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBBA-MONOMER locus_tag OGMAPBJC_03127 product YbbA/YbbP ABC transporter 3304562 3305155 CDS EC_number 3.1.1.5 gene tesA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIOESTERI-MONOMER locus_tag OGMAPBJC_03128 product multifunctional acyl-CoA thioesterase I and protease I and lysophospholipase L1 3305184 3305954 CDS gene ybbO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6269-MONOMER locus_tag OGMAPBJC_03129 product putative oxidoreductase with NAD(P)-binding Rossmann-fold domain protein 3306015 3306869 CDS gene ybbN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6268-MONOMER locus_tag OGMAPBJC_03130 product chaperone and weak protein oxidoreductase 3307711 3306932 CDS gene ybbM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6267-MONOMER locus_tag OGMAPBJC_03131 product putative metal resistance protein 3308375 3307698 CDS gene ybbL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBBL-MONOMER locus_tag OGMAPBJC_03132 product putative transporter subunit: ATP-binding component of ABC superfamily protein 3308521 3309438 CDS gene qmcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6265-MONOMER locus_tag OGMAPBJC_03133 product putative protease, membrane anchored 3309435 3309893 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6264-MONOMER locus_tag OGMAPBJC_03134 note conserved inner membrane protein product hypothetical protein 3310301 3309894 CDS gene cueR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6263-MONOMER locus_tag OGMAPBJC_03135 product CueR transcriptional dual regulator 3311718 3310426 CDS gene ybaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0486-MONOMER locus_tag OGMAPBJC_03136 product YbaT APC transporter 3312653 3311721 CDS EC_number 3.5.1.2 gene ybaS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6261-MONOMER locus_tag OGMAPBJC_03137 product glutaminase 3312915 3315419 CDS gene copA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6260-MONOMER locus_tag OGMAPBJC_03138 product Cu+ efflux ATPase 3316076 3315735 CDS gene ybaQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6259-MONOMER locus_tag OGMAPBJC_03139 product putative DNA-binding transcriptional regulator 3316214 3317008 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6258-MONOMER locus_tag OGMAPBJC_03140 note conserved protein product hypothetical protein 3317212 3317691 CDS gene ybaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12454-MONOMER locus_tag OGMAPBJC_03141 product Cys-tRNAPro and Cys-tRNACys deacylase 3319380 3317728 CDS EC_number 3.6.1.45 gene ushA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:USHA-MONOMER locus_tag OGMAPBJC_03142 product 5'-nucleotidase / UDP-sugar hydrolase 3319598 3320818 CDS gene fsr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FSR-MONOMER locus_tag OGMAPBJC_03143 product fosmidomycin efflux transporter 3321056 3322732 CDS gene ybaL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YBAL-MONOMER locus_tag OGMAPBJC_03144 product YbaL CPA2 transporter 3324166 3322862 CDS EC_number 2.7.1.73 gene gsk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GSK-MONOMER locus_tag OGMAPBJC_03145 product inosine-guanosine kinase 3324318 3325277 CDS gene aes inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11101-MONOMER locus_tag OGMAPBJC_03146 product acetyl esterase 3326236 3325274 CDS EC_number 4.99.1.1 gene hemH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROTOHEME-FERROCHELAT-MONOMER locus_tag OGMAPBJC_03147 product ferrochelatase 3327116 3326472 CDS EC_number 2.7.4.3 gene adk inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADENYL-KIN-MONOMER locus_tag OGMAPBJC_03148 product adenylate kinase 3329171 3327297 CDS gene htpG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10461-MONOMER locus_tag OGMAPBJC_03149 product HtpG monomer 3329886 3329281 CDS gene recR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10834-MONOMER locus_tag OGMAPBJC_03150 product recombination and repair 3330215 3329886 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11100-MONOMER locus_tag OGMAPBJC_03151 note conserved DNA-binding protein product hypothetical protein 3332199 3330268 CDS EC_number 2.7.7.7 db_xref COG:COG2812 gene dnaX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P06710 locus_tag OGMAPBJC_03152 product DNA polymerase III subunit tau 3332879 3332328 CDS EC_number 2.4.2.7 gene apt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADENPRIBOSYLTRAN-MONOMER locus_tag OGMAPBJC_03153 product adenine phosphoribosyltransferase 3333409 3333032 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12843-MONOMER locus_tag OGMAPBJC_03154 note conserved inner membrane protein product hypothetical protein 3333479 3334006 CDS gene priC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10765-MONOMER locus_tag OGMAPBJC_03155 product primosomal replication protein N'' 3334020 3334181 CDS gene ybaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12830-MONOMER locus_tag OGMAPBJC_03156 product small protein involved in the cell envelope stress response 3337755 3334393 CDS gene mscK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6255-MONOMER locus_tag OGMAPBJC_03157 product potassium dependent mechanosensitive channel MscK 3338530 3337883 CDS gene acrR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12116-MONOMER locus_tag OGMAPBJC_03158 product AcrR DNA-binding transcriptional repressor 3338672 3339865 CDS gene acrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11703-MONOMER locus_tag OGMAPBJC_03159 product AcrA membrane fusion protein 3339888 3343037 CDS gene acrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACRB-MONOMER locus_tag OGMAPBJC_03160 product AcrB RND-type permease 3343583 3343957 CDS gene tomB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12429-MONOMER locus_tag OGMAPBJC_03161 product protein that modulates Hha toxicity 3343983 3344201 CDS gene hha inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10439-MONOMER locus_tag OGMAPBJC_03162 product haemolysin expression modulating protein 3344373 3344924 CDS EC_number 2.3.1.79 gene maa inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALTACETYLTRAN-MONOMER locus_tag OGMAPBJC_03163 product maltose acetyltransferase 3345040 3345510 CDS gene ylaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6253-MONOMER locus_tag OGMAPBJC_03164 product putative inner membrane protein 3345674 3347224 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6252-MONOMER locus_tag OGMAPBJC_03165 note conserved inner membrane protein product hypothetical protein 3347619 3347266 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11099-MONOMER locus_tag OGMAPBJC_03166 note conserved protein product hypothetical protein 3347998 3348309 CDS gene atl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6251-MONOMER locus_tag OGMAPBJC_03167 product DNA base-flipping protein 3348912 3348340 CDS gene ybaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6250-MONOMER locus_tag OGMAPBJC_03168 product putative outer membrane lipoprotein 3349130 3349990 CDS gene tesB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIOESTERII-MONOMER locus_tag OGMAPBJC_03169 product thioesterase II 3351325 3350039 CDS gene amtB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AMTB-MONOMER locus_tag OGMAPBJC_03170 product ammonia / ammonium transporter 3351693 3351355 CDS db_xref COG:COG0347 gene glnK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AC55 locus_tag OGMAPBJC_03171 product Nitrogen regulatory protein P-II 2 3353655 3351874 CDS EC_number 3.6.3.44 gene mdlB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MDLB-MONOMER locus_tag OGMAPBJC_03172 product putative multidrug transporter subunit of ABC superfamily: ATP-binding component 3355420 3353648 CDS EC_number 3.6.3.44 gene mdlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MDLA-MONOMER locus_tag OGMAPBJC_03173 product putative multidrug transporter subunit of ABC superfamily: ATP-binding component 3355908 3355450 CDS gene ybaO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6247-MONOMER locus_tag OGMAPBJC_03174 product putative LRP-like transcriptional regulator 3356879 3356061 CDS gene cof inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6246-MONOMER locus_tag OGMAPBJC_03175 product pyridoxal phosphatase / HMP-PP hydrolase 3357216 3358679 CDS gene ybaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG13217-MONOMER locus_tag OGMAPBJC_03176 product putative transporter subunit: periplasmic-binding component of ABC superfamily protein 3358744 3359439 CDS gene queC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6245-MONOMER locus_tag OGMAPBJC_03177 product 7-cyano-7-deazaguanine synthase 3359889 3359491 CDS gene fadM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6244-MONOMER locus_tag OGMAPBJC_03178 product thioesterase III 3360366 3359995 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6243-MONOMER locus_tag OGMAPBJC_03179 note conserved protein product hypothetical protein 3362388 3360517 CDS EC_number 5.2.1.8 gene ppiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6242-MONOMER locus_tag OGMAPBJC_03180 product periplasmic folding helper protein 3362852 3362580 CDS gene hupB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10467-MONOMER locus_tag OGMAPBJC_03181 product transcriptional dual regulator HU-beta, NS1 (HU-1) 3365415 3363061 CDS gene lon inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10542-MONOMER locus_tag OGMAPBJC_03182 product DNA-binding, ATP-dependent protease La 3366877 3365603 CDS gene clpX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10159-MONOMER locus_tag OGMAPBJC_03183 product ClpAXP 3367626 3367003 CDS gene clpP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10158-MONOMER locus_tag OGMAPBJC_03184 product ClpAXP 3369170 3367872 CDS EC_number 5.2.1.8 gene tig inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11003-MONOMER locus_tag OGMAPBJC_03185 product trigger factor; a molecular chaperone involved in cell division 3369828 3369514 CDS gene bolA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10125-MONOMER locus_tag OGMAPBJC_03186 product BolA DNA-binding transcriptional dual regulator 3370136 3370714 CDS gene yajG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12182-MONOMER locus_tag OGMAPBJC_03187 product putative lipoprotein 3370758 3372233 CDS gene ampG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AMPG-MONOMER locus_tag OGMAPBJC_03188 product muropeptide:H+ symporter 3372693 3373640 CDS gene cyoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYOA-MONOMER locus_tag OGMAPBJC_03189 product cytochrome bo terminal oxidase subunit II 3373662 3375653 CDS gene cyoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYOB-MONOMER locus_tag OGMAPBJC_03190 product cytochrome bo terminal oxidase subunit I 3375643 3376257 CDS gene cyoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYOC-MONOMER locus_tag OGMAPBJC_03191 product cytochrome bo terminal oxidase subunit III 3376257 3376586 CDS gene cyoD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYOD-MONOMER locus_tag OGMAPBJC_03192 product cytochrome bo terminal oxidase subunit IV 3376598 3377488 CDS gene cyoE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HEMEOSYN-MONOMER locus_tag OGMAPBJC_03193 product heme O synthase 3377637 3379001 CDS gene yajR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0427-MONOMER locus_tag OGMAPBJC_03194 product YajR MFS transporter 3379620 3379129 CDS gene yajQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6240-MONOMER locus_tag OGMAPBJC_03195 product nucleotide binding protein 3379788 3380699 CDS EC_number 1.1.1.169 gene panE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:2-DEHYDROPANTOATE-REDUCT-MONOMER locus_tag OGMAPBJC_03196 product 2-dehydropantoate 2-reductase 3380662 3381252 CDS gene yajL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HMP-KIN-MONOMER locus_tag OGMAPBJC_03197 product chaperone, protecting proteins in response to oxidative stress 3382754 3381306 CDS gene thiI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THII-MONOMER locus_tag OGMAPBJC_03198 product ThiI 3382960 3383202 CDS EC_number 3.1.11.6 gene xseB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11098-MONOMER locus_tag OGMAPBJC_03199 product exonuclease VII, small subunit 3383202 3384101 CDS EC_number 2.5.1.10 gene ispA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FPPSYN-MONOMER locus_tag OGMAPBJC_03200 product geranyl diphosphate synthase / farnesyl diphosphate synthase 3384126 3385988 CDS EC_number 2.2.1.7 gene dxs inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DXS-MONOMER locus_tag OGMAPBJC_03201 product 1-deoxyxylulose-5-phosphate synthase 3386168 3387142 CDS gene yajO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6236-MONOMER locus_tag OGMAPBJC_03202 product putative NAD(P)H-dependent xylose reductase 3387714 3387196 CDS EC_number 3.1.3.27 gene pgpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGPPHOSPHAA-MONOMER locus_tag OGMAPBJC_03203 product phosphatidylglycerophosphatase A 3388669 3387692 CDS EC_number 2.7.4.16 gene thiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THI-P-KIN-MONOMER locus_tag OGMAPBJC_03204 product thiamin monophosphate kinase 3389166 3388747 CDS gene nusB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10666-MONOMER locus_tag OGMAPBJC_03205 product transcription antitermination protein NusB 3389656 3389186 CDS EC_number 2.5.1.9 gene ribE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LUMAZINESYN-MONOMER locus_tag OGMAPBJC_03206 product 6,7-dimethyl-8-ribityllumazine synthase 3390848 3389745 CDS EC_number 1.1.1.193 gene ribD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBOFLAVINSYNDEAM-MONOMER locus_tag OGMAPBJC_03207 product fused diaminohydroxyphosphoribosylaminopyrimidine deaminase / 5-amino-6-(5-phosphoribosylamino)uracil reductase 3391301 3390852 CDS gene nrdR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11320-MONOMER locus_tag OGMAPBJC_03208 product NrdR-Zn2+ DNA-binding transcriptional repressor 3391452 3391991 CDS gene yajI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12874-MONOMER locus_tag OGMAPBJC_03209 product putative lipoprotein 3392290 3393174 CDS gene tsx inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11035-MONOMER locus_tag OGMAPBJC_03210 product nucleoside channel; receptor of phage T6 and colicin K 3393698 3393351 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11097-MONOMER locus_tag OGMAPBJC_03211 note conserved protein product hypothetical protein 3394798 3393827 CDS gene secF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECF locus_tag OGMAPBJC_03212 product Sec Translocation Complex 3396623 3394809 CDS gene secD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECD locus_tag OGMAPBJC_03213 product Sec Translocation Complex 3397016 3396684 CDS gene yajC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11096-MONOMER locus_tag OGMAPBJC_03214 product Sec Translocation Complex 3398166 3397039 CDS gene tgt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10996-MONOMER locus_tag OGMAPBJC_03215 product tRNA-guanine transglycosylase monomer 3399292 3398222 CDS gene queA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10812-MONOMER locus_tag OGMAPBJC_03216 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase 3399385 3399966 CDS EC_number 3.1.4.14 gene acpH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11095-MONOMER locus_tag OGMAPBJC_03217 product acyl carrier protein phosphodiesterase 3401788 3399971 CDS EC_number 3.2.1.20 gene malZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALTODEXGLUCOSID-MONOMER locus_tag OGMAPBJC_03218 product maltodextrin glucosidase 3403317 3401944 CDS gene proY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROY-MONOMER locus_tag OGMAPBJC_03219 product proline:H+ symporter - cryptic 3404712 3403393 CDS gene brnQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BRNQ-MONOMER locus_tag OGMAPBJC_03220 product branched chain amino acid transporter BrnQ 3406414 3405119 CDS EC_number 2.7.13.3 gene phoR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P08400 locus_tag OGMAPBJC_03221 product Phosphate regulon sensor protein PhoR 3407161 3406472 CDS gene yedW_9 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_03222 product putative DNA-binding response regulator in two-component system with YedV 3407351 3408553 CDS gene sbcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11094-MONOMER locus_tag OGMAPBJC_03223 product ATP-dependent dsDNA exonuclease 3408550 3411693 CDS gene sbcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10927-MONOMER locus_tag OGMAPBJC_03224 product ATP-dependent dsDNA exonuclease 3411735 3413003 CDS gene araJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARAJ-MONOMER locus_tag OGMAPBJC_03225 product putative arabinose efflux transporter 3414156 3413248 CDS EC_number 2.7.1.4 gene mak inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11288-MONOMER locus_tag OGMAPBJC_03226 product manno(fructo)kinase 3414215 3415192 CDS gene rdgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12158-MONOMER locus_tag OGMAPBJC_03227 product nucleoid-associated protein RdgC 3415553 3415672 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03228 product hypothetical protein 3416124 3415840 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12159-MONOMER locus_tag OGMAPBJC_03229 note conserved protein product hypothetical protein 3416873 3416196 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10083-MONOMER locus_tag OGMAPBJC_03230 note conserved protein product hypothetical protein 3417322 3417131 CDS gene yaiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11093-MONOMER locus_tag OGMAPBJC_03231 product putative protein 3417896 3417372 CDS EC_number 2.7.1.71 gene aroL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROL-MONOMER locus_tag OGMAPBJC_03232 product shikimate kinase II 3418537 3418073 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6230-MONOMER locus_tag OGMAPBJC_03233 note conserved protein product hypothetical protein 3418657 3419466 CDS EC_number 1.5.1.2 gene proC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PYRROLINECARBREDUCT-MONOMER locus_tag OGMAPBJC_03234 product pyrroline-5-carboxylate reductase monomer 3420598 3419483 CDS EC_number 2.7.7.65 gene adrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11257-MONOMER locus_tag OGMAPBJC_03235 product putative diguanylate cyclase 3421020 3420700 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11401-MONOMER locus_tag OGMAPBJC_03236 note conserved protein product hypothetical protein 3422554 3421139 CDS EC_number 3.1.3.1 gene phoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALKAPHOSPHA-MONOMER locus_tag OGMAPBJC_03237 product alkaline phosphatase 3422915 3422655 CDS gene iraP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11256-MONOMER locus_tag OGMAPBJC_03238 product anti-adaptor protein for sS stabilization 3423378 3424472 CDS EC_number 6.3.2.4 gene ddlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DALADALALIGA-MONOMER locus_tag OGMAPBJC_03239 product D-alanine-D-alanine ligase A 3424708 3424496 CDS gene yaiZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6229-MONOMER locus_tag OGMAPBJC_03240 product putative inner membrane protein 3424968 3425276 CDS gene yaiY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6228-MONOMER locus_tag OGMAPBJC_03241 product inner membrane protein 3426429 3425335 CDS gene yaiW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6227-MONOMER locus_tag OGMAPBJC_03242 product putative DNA-binding transcriptional regulator 3427662 3426442 CDS gene sbmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SBMA-MONOMER locus_tag OGMAPBJC_03243 product peptide antibiotic transporter 3427867 3427968 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03244 product hypothetical protein 3428014 3429171 CDS gene ampH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12867-MONOMER locus_tag OGMAPBJC_03245 product DD-endopeptidase / DD-carboxypeptidase 3429308 3429571 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_03246 product IS3 family transposase IS1222 3429598 3430428 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_03247 note IS150 conserved protein InsB product hypothetical protein 3432710 3430455 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03248 product hypothetical protein 3433234 3434208 CDS EC_number 4.2.1.24 gene hemB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PORPHOBILSYNTH-MONOMER locus_tag OGMAPBJC_03249 product porphobilinogen synthase 3435217 3434366 CDS EC_number 1.14.11.17 gene tauD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-147 locus_tag OGMAPBJC_03250 product taurine dioxygenase monomer 3436041 3435214 CDS gene tauC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TAUC-MONOMER locus_tag OGMAPBJC_03251 product taurine ABC transporter - membrane subunit 3436805 3436038 CDS EC_number 3.6.3.36 gene tauB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TAUB-MONOMER locus_tag OGMAPBJC_03252 product taurine ABC transporter - ATP binding subunit 3437780 3436818 CDS gene tauA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TAUA-MONOMER locus_tag OGMAPBJC_03253 product taurine ABC transporter - periplasmic binding protein 3438396 3439067 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6216-MONOMER locus_tag OGMAPBJC_03254 note conserved protein product hypothetical protein 3439077 3440273 CDS gene yaiP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6215-MONOMER locus_tag OGMAPBJC_03255 product putative glucosyltransferase 3440834 3441607 CDS gene yaiO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6210-MONOMER locus_tag OGMAPBJC_03256 product outer membrane protein 3441795 3442070 CDS gene frmR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6209-MONOMER locus_tag OGMAPBJC_03257 product regulator protein 3442105 3443214 CDS EC_number 1.1.1.284 gene frmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADHC-MONOMER locus_tag OGMAPBJC_03258 product formaldehyde dehydrogenase, glutathione-dependent 3443306 3444139 CDS EC_number 3.1.2.12 gene frmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6208-MONOMER locus_tag OGMAPBJC_03259 product S-formylglutathione hydrolase 3444804 3444265 CDS gene yaiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6207-MONOMER locus_tag OGMAPBJC_03260 product nucleoprotein/polynucleotide-associated enzyme 3446117 3444906 CDS gene mhpT_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPT-MONOMER locus_tag OGMAPBJC_03261 product 3-hydroxyphenylpropionate / 3-hydroxycinnamate:H+ symporter 3447506 3446493 CDS EC_number 4.1.3.39 gene mhpE_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPELY-MONOMER locus_tag OGMAPBJC_03262 product 4-hydroxy-2-ketovalerate aldolase 3448453 3447503 CDS EC_number 1.2.1.10 gene mhpF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPF-MONOMER locus_tag OGMAPBJC_03263 product acetaldehyde dehydrogenase 2 3449259 3448450 CDS EC_number 4.2.1.80 gene mhpD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPDHYDROL-MONOMER locus_tag OGMAPBJC_03264 product 2-hydroxypentadienoate hydratase 3450135 3449269 CDS EC_number 3.7.1.14 gene mhpC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPCHYDROL-MONOMER locus_tag OGMAPBJC_03265 product 2-hydroxy-6-ketonona-2,4-dienedioate hydrolase 3451097 3450153 CDS EC_number 1.13.11.16 gene mhpB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DHPDIOXYGEN-MONOMER locus_tag OGMAPBJC_03266 product 3-(2,3-dihydroxyphenyl)propionate dioxygenase monomer 3452763 3451099 CDS gene mhpA_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPHYDROXY-MONOMER locus_tag OGMAPBJC_03267 product 3-(3-hydroxyphenyl)propionate 2-hydroxylase 3452840 3453787 CDS gene mhpR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6201-MONOMER locus_tag OGMAPBJC_03268 product MhpR transcriptional activator 3453855 3454946 CDS gene lacI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00763 locus_tag OGMAPBJC_03269 product LacI DNA-binding transcriptional repressor 3455069 3458143 CDS EC_number 3.2.1.23 gene lacZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BETAGALACTOSID-MONOMER locus_tag OGMAPBJC_03270 product beta-galactosidase monomer 3458195 3459448 CDS gene lacY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LACY-MONOMER locus_tag OGMAPBJC_03271 product lactose / melibiose:H+ symporter LacY 3459505 3460125 CDS EC_number 2.3.1.18 gene lacA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GALACTOACETYLTRAN-MONOMER locus_tag OGMAPBJC_03272 product galactoside O-acetyltransferase monomer 3461409 3460228 CDS gene cynX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYNX-MONOMER locus_tag OGMAPBJC_03273 product cyanate transporter 3461885 3461415 CDS EC_number 4.2.1.104 gene cynS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYANLY-MONOMER locus_tag OGMAPBJC_03274 product cyanase monomer 3462575 3461916 CDS EC_number 4.2.1.1 gene cynT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARBODEHYDRAT-MONOMER locus_tag OGMAPBJC_03275 product carbonic anhydrase monomer 3462685 3463584 CDS gene cynR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00291 locus_tag OGMAPBJC_03276 product CynR DNA-binding transcriptional repressor 3465176 3463893 CDS EC_number 3.5.4.1 gene codA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYTDEAM-MONOMER locus_tag OGMAPBJC_03277 product cytosine deaminase 3466425 3465166 CDS gene codB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CODB-MONOMER locus_tag OGMAPBJC_03278 product cytosine transporter 3468736 3466850 CDS EC_number 6.2.1.17 gene prpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6200-MONOMER locus_tag OGMAPBJC_03279 product propionyl-CoA synthetase 3470227 3468776 CDS EC_number 4.2.1.79 gene prpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6199-MONOMER locus_tag OGMAPBJC_03280 product 2-methylcitrate dehydratase 3471430 3470261 CDS EC_number 2.3.3.5 gene prpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6198-MONOMER locus_tag OGMAPBJC_03281 product 2-methylcitrate synthase 3472667 3471777 CDS EC_number 4.1.3.30 gene prpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6196-MONOMER locus_tag OGMAPBJC_03282 product 2-methylisocitrate lyase 3472906 3474492 CDS gene prpR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6195-MONOMER locus_tag OGMAPBJC_03283 product PrpR DNA-binding transcriptional dual regulator 3474865 3474590 CDS gene yahO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6194-MONOMER locus_tag OGMAPBJC_03284 product putative protein 3475051 3475683 CDS gene yahN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6193-MONOMER locus_tag OGMAPBJC_03285 product putative neutral amino acid efflux system 3476015 3475935 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03286 product tRNA-Ser(gga) 3477173 3476358 CDS gene yahL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6191-MONOMER locus_tag OGMAPBJC_03287 product putative protein 3478465 3477416 CDS gene yahK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6190-MONOMER locus_tag OGMAPBJC_03288 product putative oxidoreductase, Zn-dependent and NAD(P)-binding 3480224 3478842 CDS gene yahJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6189-MONOMER locus_tag OGMAPBJC_03289 product putative deaminase with metallo-dependent hydrolase domain protein 3481184 3480234 CDS gene yahI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6188-MONOMER locus_tag OGMAPBJC_03290 product putative carbamate kinase-like protein 3481580 3481260 CDS gene yahH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2772 locus_tag OGMAPBJC_03291 product putative protein 3482964 3481606 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6186-MONOMER locus_tag OGMAPBJC_03292 note conserved protein product hypothetical protein 3484511 3482964 CDS gene yahF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6185-MONOMER locus_tag OGMAPBJC_03293 product putative acyl-CoA synthetase with NAD(P)-binding domain and succinyl-CoA synthetase domain protein 3485365 3484595 CDS gene yahE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6184-MONOMER locus_tag OGMAPBJC_03294 product putative protein 3486010 3485405 CDS gene yahD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6183-MONOMER locus_tag OGMAPBJC_03295 product putative transcriptional regulator with ankyrin domain protein 3486268 3486765 CDS gene yahC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6182-MONOMER locus_tag OGMAPBJC_03296 product putative inner membrane protein 3486857 3487789 CDS gene yahB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6181-MONOMER locus_tag OGMAPBJC_03297 product putative DNA-binding transcriptional regulator LYSR-type 3488919 3487831 CDS gene yahA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11236-MONOMER locus_tag OGMAPBJC_03298 product phosphodiesterase, c-di-GMP-specific 3491827 3489794 CDS gene betT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BETT-MONOMER locus_tag OGMAPBJC_03299 product choline:H+ symporter 3491956 3492543 CDS gene betI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00251 locus_tag OGMAPBJC_03300 product BetI DNA-binding transcriptional repressor 3492557 3494029 CDS EC_number 1.2.1.8 gene betB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BADH-MONOMER locus_tag OGMAPBJC_03301 product betaine aldehyde dehydrogenase 3494043 3495713 CDS EC_number 1.1.99.1 gene betA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHD-MONOMER locus_tag OGMAPBJC_03302 product choline dehydrogenase 3495926 3496594 CDS gene ykgH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6180-MONOMER locus_tag OGMAPBJC_03303 product putative inner membrane protein 3497532 3496837 CDS gene ykgG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6178-MONOMER locus_tag OGMAPBJC_03304 product putative transporter 3498952 3497525 CDS gene ykgF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6177-MONOMER locus_tag OGMAPBJC_03305 product putative amino acid dehydrogenase with NAD(P)-binding domain and ferridoxin-like domain protein 3499682 3498963 CDS gene ykgE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6176-MONOMER locus_tag OGMAPBJC_03306 product putative oxidoreductase 3501063 3500209 CDS gene ykgD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6175-MONOMER locus_tag OGMAPBJC_03307 product putative DNA-binding transcriptional regulator 3501289 3502614 CDS gene ykgC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6174-MONOMER locus_tag OGMAPBJC_03308 product putative oxidoreductase with FAD/NAD(P)-binding domain and dimerization domain protein 3502971 3503564 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6171-MONOMER locus_tag OGMAPBJC_03309 note conserved inner membrane protein product hypothetical protein 3504154 3505005 CDS db_xref COG:COG2207 gene rob_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0ACI0 locus_tag OGMAPBJC_03310 product Right origin-binding protein 3504962 3505120 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03311 product hypothetical protein 3509401 3505145 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03312 product hypothetical protein 3510516 3510617 CDS gene ykgR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2881 locus_tag OGMAPBJC_03313 product small membrane protein 3510978 3511244 CDS gene ykgM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6167-MONOMER locus_tag OGMAPBJC_03314 product putative ribosomal protein 3511244 3511384 CDS gene ykgO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2656 locus_tag OGMAPBJC_03315 product putative ribosomal protein 3512470 3513012 CDS gene ecpR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6165-MONOMER locus_tag OGMAPBJC_03316 product MatA DNA-binding transcriptional dual regulator 3513087 3513674 CDS gene ecpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6164-MONOMER locus_tag OGMAPBJC_03317 product E. coli common pilus - major subunit; cryptic 3513732 3514400 CDS gene ecpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6163-MONOMER locus_tag OGMAPBJC_03318 product hypothetical protein 3514426 3516951 CDS gene ecpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6162-MONOMER locus_tag OGMAPBJC_03319 product hypothetical protein 3516941 3518584 CDS gene ecpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6161-MONOMER locus_tag OGMAPBJC_03320 product hypothetical protein 3518553 3519263 CDS gene ecpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6160-MONOMER locus_tag OGMAPBJC_03321 product hypothetical protein 3520767 3520153 CDS gene yagU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6158-MONOMER locus_tag OGMAPBJC_03322 product inner membrane protein that contributes to acid resistance 3521185 3521874 CDS gene paoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6157-MONOMER locus_tag OGMAPBJC_03323 product aldehyde dehydrogenase, Fe-S subunit 3521871 3522827 CDS EC_number 1.17.1.4 gene paoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6156-MONOMER locus_tag OGMAPBJC_03324 product aldehyde dehydrogenase, FAD-binding subunit 3522824 3525022 CDS EC_number 1.17.1.4 gene paoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6155-MONOMER locus_tag OGMAPBJC_03325 product aldehyde dehydrogenase: molybdenum cofactor-binding subunit 3525032 3525988 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6154-MONOMER locus_tag OGMAPBJC_03326 note conserved protein product hypothetical protein 3525967 3526296 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03327 product hypothetical protein 3527295 3526168 CDS gene nepI_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YICM-MONOMER locus_tag OGMAPBJC_03328 product purine ribonucleoside efflux transporter 3528495 3527437 CDS gene ycjY_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6663-MONOMER locus_tag OGMAPBJC_03329 product putative hydrolase 3528760 3529644 CDS gene ycjZ_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6664-MONOMER locus_tag OGMAPBJC_03330 product putative transcriptional regulator LysR-type 3530506 3530832 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS3411 locus_tag OGMAPBJC_03331 product IS3 family transposase IS3411 3530832 3531311 CDS gene insO-1_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6132-MONOMER locus_tag OGMAPBJC_03332 product CP4-6 prophage; partial transposase of insertion element IS911A, interrupted by insertion of IS30 element 3531903 3533426 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03333 product hypothetical protein 3533618 3533989 CDS gene insF-1_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7126-MONOMER locus_tag OGMAPBJC_03334 product IS3 element protein InsF 3534159 3533992 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03335 product hypothetical protein 3535095 3534373 CDS EC_number 1.1.1.298 gene ydfG_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12345-MONOMER locus_tag OGMAPBJC_03336 product 3-hydroxy acid dehydrogenase monomer 3535194 3536093 CDS gene pgrR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P77333 locus_tag OGMAPBJC_03337 product HTH-type transcriptional regulator PgrR 3537419 3536490 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03338 product hypothetical protein 3538188 3537406 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03339 product hypothetical protein 3538472 3540139 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03340 product hypothetical protein 3540202 3540501 CDS gene insE-1_5 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6534-MONOMER locus_tag OGMAPBJC_03341 product IS3 element protein InsE 3540498 3541364 CDS gene insEF-1_5 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2748 locus_tag OGMAPBJC_03342 product IS3 element transposase 3541785 3542060 CDS gene insA-2_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6139-MONOMER locus_tag OGMAPBJC_03343 product IS1 protein InsA 3542105 3542482 CDS gene insAB-2_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2757 locus_tag OGMAPBJC_03344 product InsAB' transposase 3542826 3543830 CDS EC_number 2.1.3.3 gene argF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHAINF-MONOMER locus_tag OGMAPBJC_03345 product ornithine carbamoyltransferase chain F 3543969 3544727 CDS gene yagI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6144-MONOMER locus_tag OGMAPBJC_03346 product CP4-6 prophage; predicted DNA-binding transcriptional regulator 3546342 3544732 CDS EC_number 3.2.1.37 gene yagH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6143-MONOMER locus_tag OGMAPBJC_03347 product putative beta-xylosidase 3547736 3546354 CDS gene yagG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0270-MONOMER locus_tag OGMAPBJC_03348 product YagG GPH Transporter 3549930 3547963 CDS gene yagF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6141-MONOMER locus_tag OGMAPBJC_03349 product CP4-6 prophage; predicted dehydratase 3550853 3549945 CDS gene yagE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6140-MONOMER locus_tag OGMAPBJC_03350 product CP4-6 prophage; probable 2-keto-3-deoxygluconate aldolase 3551160 3552302 CDS gene yagA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12338-MONOMER locus_tag OGMAPBJC_03351 product CP4-6 prophage; predicted DNA-binding transcriptional regulator 3552396 3552746 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12339-MONOMER locus_tag OGMAPBJC_03352 note CP4-6 prophage; conserved protein product hypothetical protein 3552769 3553107 CDS gene ykgN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2655 locus_tag OGMAPBJC_03353 product putative IS protein 3553256 3553531 CDS gene insA-2_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6139-MONOMER locus_tag OGMAPBJC_03354 product IS1 protein InsA 3553576 3553953 CDS gene insAB-2_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2757 locus_tag OGMAPBJC_03355 product InsAB' transposase 3553955 3554317 CDS gene afuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6137-MONOMER locus_tag OGMAPBJC_03356 product AfuB 3554329 3555375 CDS EC_number 3.6.3.30 gene afuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YAGC-MONOMER locus_tag OGMAPBJC_03357 product CP4-6 prophage; predicted ferric transporter subunit/ATP-binding component of ABC superfamily protein 3556416 3555484 CDS EC_number 2.1.1.10 gene mmuM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MMUM-MONOMER locus_tag OGMAPBJC_03358 product homocysteine methyltransferase 3557830 3556403 CDS gene mmuP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0260-MONOMER locus_tag OGMAPBJC_03359 product S-methyl-L-methionine transporter 3557972 3557883 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03360 product hypothetical protein 3559292 3558081 CDS gene mhpT_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPT-MONOMER locus_tag OGMAPBJC_03361 product 3-hydroxyphenylpropionate / 3-hydroxycinnamate:H+ symporter 3560375 3559362 CDS EC_number 4.1.3.39 gene mhpE_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPELY-MONOMER locus_tag OGMAPBJC_03362 product 4-hydroxy-2-ketovalerate aldolase 3561322 3560372 CDS EC_number 1.2.1.10 gene mhpF_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPF-MONOMER locus_tag OGMAPBJC_03363 product acetaldehyde dehydrogenase 2 3562128 3561319 CDS EC_number 4.2.1.80 gene mhpD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPDHYDROL-MONOMER locus_tag OGMAPBJC_03364 product 2-hydroxypentadienoate hydratase 3563004 3562138 CDS EC_number 3.7.1.14 gene mhpC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPCHYDROL-MONOMER locus_tag OGMAPBJC_03365 product 2-hydroxy-6-ketonona-2,4-dienedioate hydrolase 3563977 3563033 CDS EC_number 1.13.11.16 gene mhpB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DHPDIOXYGEN-MONOMER locus_tag OGMAPBJC_03366 product 3-(2,3-dihydroxyphenyl)propionate dioxygenase monomer 3565340 3563979 CDS gene mhpA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPHYDROXY-MONOMER locus_tag OGMAPBJC_03367 product 3-(3-hydroxyphenyl)propionate 2-hydroxylase 3565616 3565855 CDS gene insO-1_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6132-MONOMER locus_tag OGMAPBJC_03368 product CP4-6 prophage; partial transposase of insertion element IS911A, interrupted by insertion of IS30 element 3566447 3567970 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03369 product hypothetical protein 3569734 3568436 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISSoEn2 locus_tag OGMAPBJC_03370 product IS256 family transposase ISSoEn2 3570324 3570061 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03371 product hypothetical protein 3571147 3571716 CDS gene ibpA_2 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_02000 locus_tag OGMAPBJC_03372 product Small heat shock protein IbpA 3571822 3574704 CDS gene clpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q2YSD6 locus_tag OGMAPBJC_03373 product ATP-dependent Clp protease ATP-binding subunit ClpC 3574704 3574895 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03374 product hypothetical protein 3574956 3575447 CDS gene ftsH_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11506-MONOMER locus_tag OGMAPBJC_03375 product ATP-dependent zinc metalloprotease FtsH 3575428 3576684 CDS gene ftsH_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11506-MONOMER locus_tag OGMAPBJC_03376 product ATP-dependent zinc metalloprotease FtsH 3576772 3577230 CDS db_xref COG:COG0071 gene hspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q06823 locus_tag OGMAPBJC_03377 product Spore protein SP21 3577253 3578167 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03378 product hypothetical protein 3578270 3579157 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03379 product hypothetical protein 3579247 3579858 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03380 product hypothetical protein 3579938 3581083 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03381 product hypothetical protein 3581073 3581513 CDS EC_number 1.8.1.8 db_xref COG:COG0526 gene trxC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AGG4 locus_tag OGMAPBJC_03382 product Thioredoxin 2 3581517 3583232 CDS gene kefC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KEFC-MONOMER locus_tag OGMAPBJC_03383 product K+ : H+ antiporter KefC 3583229 3583726 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03384 product hypothetical protein 3583704 3584669 CDS EC_number 3.4.24.- db_xref COG:COG0501 gene htpX_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P9WHS5 locus_tag OGMAPBJC_03385 product Protease HtpX 3584694 3585845 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03386 product hypothetical protein 3587329 3586070 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03387 product hypothetical protein 3587761 3588624 CDS gene ykfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6128-MONOMER locus_tag OGMAPBJC_03388 product CP4-6 prophage; predicted GTP-binding protein 3588716 3589537 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6127-MONOMER locus_tag OGMAPBJC_03389 note CP4-6 prophage; conserved protein product hypothetical protein 3589754 3590455 CDS gene yfjR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7369-MONOMER locus_tag OGMAPBJC_03390 product CP4-57 prophage; predicted DNA-binding transcriptional regulator 3590496 3590732 CDS gene ypjK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7370-MONOMER locus_tag OGMAPBJC_03391 product CP4-57 prophage; predicted inner membrane protein 3590732 3591175 CDS gene yfjS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7371-MONOMER locus_tag OGMAPBJC_03392 product CP4-57 prophage; inner membrane lipoprotein YfjS 3591198 3591665 CDS gene ykfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6125-MONOMER locus_tag OGMAPBJC_03393 product CP4-6 prophage; predicted protein 3591742 3591981 CDS gene ykfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6124-MONOMER locus_tag OGMAPBJC_03394 product CP4-6 prophage; predicted protein 3592079 3592537 CDS gene yafX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6123-MONOMER locus_tag OGMAPBJC_03395 product CP4-6 prophage; predicted protein 3592553 3593029 CDS gene ykfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6122-MONOMER locus_tag OGMAPBJC_03396 product CP4-6 prophage; predicted DNA repair protein 3593038 3593259 CDS gene ykfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2654 locus_tag OGMAPBJC_03397 product putative protein 3593278 3593595 CDS gene yafW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6121-MONOMER locus_tag OGMAPBJC_03398 product antitoxin of the YkfI-YafW toxin-antitoxin pair 3593616 3593957 CDS gene ykfI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6120-MONOMER locus_tag OGMAPBJC_03399 product toxin of the YkfI-YafW toxin-antitoxin pair 3594073 3594177 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03400 product hypothetical protein 3594414 3594339 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03401 product tRNA-Thr(cgt) 3595782 3594529 CDS EC_number 1.2.1.41 gene proA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTSEMIALDEHYDROG-MONOMER locus_tag OGMAPBJC_03402 product gamma-glutamyl kinase-GP-reductase multienzyme complex 3596897 3595794 CDS EC_number 2.7.2.11 gene proB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTKIN-MONOMER locus_tag OGMAPBJC_03403 product gamma-glutamyl kinase-GP-reductase multienzyme complex 3597185 3598240 CDS gene phoE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-282 locus_tag OGMAPBJC_03404 product outer membrane porin E 3598680 3598279 CDS gene crl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11092-MONOMER locus_tag OGMAPBJC_03405 product Crl transcriptional regulator 3599982 3598738 CDS gene frsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11091-MONOMER locus_tag OGMAPBJC_03406 product fermentation/respiration switch protein 3600532 3600074 CDS EC_number 2.4.2.22 gene gpt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GPT-MONOMER locus_tag OGMAPBJC_03407 product xanthine-guanine phosphoribosyltransferase 3600793 3602250 CDS gene pepD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10695-MONOMER locus_tag OGMAPBJC_03408 product peptidase D 3602564 3602307 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03409 product hypothetical protein 3602873 3602607 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03410 product hypothetical protein 3603552 3603178 CDS gene yafP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6118-MONOMER locus_tag OGMAPBJC_03411 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 3604682 3603627 CDS EC_number 2.7.7.7 gene dinB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6115-MONOMER locus_tag OGMAPBJC_03412 product DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis) 3605388 3604753 CDS gene motB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MOTB-FLAGELLAR-MOTOR-STATOR-PROTEIN locus_tag OGMAPBJC_03413 product MotB protein, enables flagellar motor rotation, linking torque machinery to cell wall 3605483 3606940 CDS gene flhA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G370-MONOMER locus_tag OGMAPBJC_03414 product flagellar biosynthesis protein FlhA 3606924 3607232 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03415 product hypothetical protein 3607290 3607667 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03416 product hypothetical protein 3608497 3607724 CDS gene yafL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6111-MONOMER locus_tag OGMAPBJC_03417 product putative lipoprotein and C40 family peptidase 3608683 3608943 CDS gene dinJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6110-MONOMER locus_tag OGMAPBJC_03418 product DinJ antitoxin of YafQ-DinJ toxin-antitoxin system and DNA-binding transcriptional repressor 3608946 3609224 CDS gene yafQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6109-MONOMER locus_tag OGMAPBJC_03419 product toxin of the YafQ-DinJ toxin-antitoxin system 3609380 3610120 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6108-MONOMER locus_tag OGMAPBJC_03420 note conserved protein product hypothetical protein 3610858 3610091 CDS gene yafJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6107-MONOMER locus_tag OGMAPBJC_03421 product putative amidotransferase 3611645 3611067 CDS gene lpcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6106-MONOMER locus_tag OGMAPBJC_03422 product D-sedoheptulose 7-phosphate isomerase 3611885 3613777 CDS gene fadE_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACYLCOADEHYDROG-MONOMER locus_tag OGMAPBJC_03423 product acyl-CoA dehydrogenase 3613805 3614329 CDS gene fadE_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACYLCOADEHYDROG-MONOMER locus_tag OGMAPBJC_03424 product acyl-CoA dehydrogenase 3614845 3614372 CDS gene ivy inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6104-MONOMER locus_tag OGMAPBJC_03425 product inhibitor of vertebrate C-type lysozyme 3614999 3615769 CDS gene yafV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6103-MONOMER locus_tag OGMAPBJC_03426 product putative C-N hydrolase family amidase, NAD(P)-binding 3617098 3616241 CDS gene yhhI_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11525-MONOMER locus_tag OGMAPBJC_03427 product putative transposase 3617377 3617246 CDS gene ybfD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11524-MONOMER locus_tag OGMAPBJC_03428 product putative DNA ligase 3618632 3618123 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03429 product hypothetical protein 3620233 3618701 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03430 product hypothetical protein 3621128 3620391 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03431 product hypothetical protein 3622986 3621850 CDS gene yhhI_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11525-MONOMER locus_tag OGMAPBJC_03432 product putative transposase 3623772 3623335 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03433 product hypothetical protein 3624505 3623732 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03434 product hypothetical protein 3624521 3625381 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03435 product hypothetical protein 3625603 3626085 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7759-MONOMER locus_tag OGMAPBJC_03436 note conserved protein product hypothetical protein 3626129 3627043 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03437 product hypothetical protein 3627053 3627532 CDS gene ykfM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2812 locus_tag OGMAPBJC_03438 product hypothetical protein 3628454 3627669 CDS gene yafT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6101-MONOMER locus_tag OGMAPBJC_03439 product putative aminopeptidase 3628858 3628782 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03440 product tRNA-Asp(gtc) 3629731 3628991 CDS EC_number 2.7.7.7 gene dnaQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10243-MONOMER locus_tag OGMAPBJC_03441 product DNA polymerase III, epsilon subunit 3629787 3630254 CDS EC_number 3.1.26.4 gene rnhA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10860-MONOMER locus_tag OGMAPBJC_03442 product RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication 3630973 3630251 CDS gene yafS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6100-MONOMER locus_tag OGMAPBJC_03443 product putative S-adenosyl-L-methionine-dependent methyltransferase 3631007 3631762 CDS EC_number 3.1.2.6 gene gloB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYOXII-MONOMER locus_tag OGMAPBJC_03444 product glyoxalase II 3631972 3633192 CDS EC_number 4.2.2 gene mltD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10246-MONOMER locus_tag OGMAPBJC_03445 product membrane-bound lytic murein transglycosylase D 3634010 3633240 CDS gene yafE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11651-MONOMER locus_tag OGMAPBJC_03446 product putative S-adenosylmethionine-dependent methyltransferase 3634867 3634088 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11650-MONOMER locus_tag OGMAPBJC_03447 note conserved protein product hypothetical protein 3635129 3636043 CDS gene yafC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11649-MONOMER locus_tag OGMAPBJC_03448 product putative DNA-binding transcriptional regulator LYSR-type 3636684 3636040 CDS EC_number 1.1.1.274 gene dkgB_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-149 locus_tag OGMAPBJC_03449 product 4-nitrobenzaldehyde reductase [multifunctional] 3636843 3636733 CDS EC_number 1.1.1.274 gene dkgB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-149 locus_tag OGMAPBJC_03450 product 4-nitrobenzaldehyde reductase [multifunctional] 3637082 3637006 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03451 product tRNA-Asp(gtc) 3637250 3637140 rRNA locus_tag OGMAPBJC_03452 product 5S ribosomal RNA score 6.4e-11 3640342 3637442 rRNA locus_tag OGMAPBJC_03453 product 23S ribosomal RNA score 0 3640603 3640528 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03454 product tRNA-Ala(tgc) 3640722 3640646 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03455 product tRNA-Ile(gat) 3642329 3640792 rRNA locus_tag OGMAPBJC_03456 product 16S ribosomal RNA score 0 3643268 3642696 CDS gene gmhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11736-MONOMER locus_tag OGMAPBJC_03457 product D,D-heptose 1,7-bisphosphate phosphatase 3643456 3644487 CDS gene metN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ABC-MONOMER locus_tag OGMAPBJC_03458 product L-methionine / D-methionine ABC transporter - ATP binding subunit 3644480 3645133 CDS gene metI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:METI-MONOMER locus_tag OGMAPBJC_03459 product L-methionine / D-methionine ABC transporter - membrane subunit 3645173 3645988 CDS gene metQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:METQ-MONOMER locus_tag OGMAPBJC_03460 product l-methionine / D-methionine ABC transporter - periplasmic binding protein 3646106 3646510 CDS gene rcsF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RCSF-MONOMER locus_tag OGMAPBJC_03461 product RcsF outer membrane lipoprotein 3646507 3647214 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11503-MONOMER locus_tag OGMAPBJC_03462 note conserved protein product hypothetical protein 3647325 3649043 CDS EC_number 6.1.1.15 gene proS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROS-MONOMER locus_tag OGMAPBJC_03463 product prolyl-tRNA synthetase 3649096 3649920 CDS gene yaeF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12138-MONOMER locus_tag OGMAPBJC_03464 product putative lipoprotein 3650830 3650120 CDS gene nlpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12137-MONOMER locus_tag OGMAPBJC_03465 product outer membrane lipoprotein NlpE, involved in surface sensing 3651266 3650844 CDS EC_number 3.1.1.29 gene arfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12354-MONOMER locus_tag OGMAPBJC_03466 product peptidyl-tRNA hydrolase, ribosome rescue factor 3651808 3651263 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6098-MONOMER locus_tag OGMAPBJC_03467 note conserved protein product hypothetical protein 3651974 3652174 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-741 locus_tag OGMAPBJC_03468 note conserved protein product hypothetical protein 3652161 3652421 CDS gene rof inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6097-MONOMER locus_tag OGMAPBJC_03469 product modulator of Rho-dependent transcription termination 3653768 3652470 CDS gene tilS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6096-MONOMER locus_tag OGMAPBJC_03470 product tRNAIle-lysidine synthetase 3654222 3653833 CDS gene yaeR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6095-MONOMER locus_tag OGMAPBJC_03471 product putative lyase 3656420 3654279 CDS EC_number 4.1.1.18 gene ldcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LDC2-MONOMER locus_tag OGMAPBJC_03472 product lysine decarboxylase 2 3657478 3656519 CDS EC_number 6.4.1.2 gene accA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARBOXYL-TRANSFERASE-ALPHA-MONOMER locus_tag OGMAPBJC_03473 product acetyl-CoA carboxyltransferase, alpha subunit 3660973 3657491 CDS EC_number 2.7.7.7 gene dnaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10238-MONOMER locus_tag OGMAPBJC_03474 product DNA polymerase III, alpha subunit 3661606 3661010 CDS EC_number 3.1.26.4 gene rnhB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10861-MONOMER locus_tag OGMAPBJC_03475 product RNAse HII, degrades RNA of DNA-RNA hybrids 3662751 3661603 CDS EC_number 2.4.1.182 gene lpxB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LIPIDADISACCHARIDESYNTH-MONOMER locus_tag OGMAPBJC_03476 product lipid A disaccharide synthase 3663539 3662751 CDS EC_number 2.3.1.129 gene lpxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPNACETYLGLUCOSAMACYLTRANS-MONOMER locus_tag OGMAPBJC_03477 product UDP-N-acetylglucosamine acyltransferase 3663998 3663543 CDS gene fabZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FABZ-MONOMER locus_tag OGMAPBJC_03478 product 3-hydroxy-acyl-[acyl-carrier-protein] dehydratase 3665128 3664103 CDS gene lpxD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPHYDROXYMYRGLUCOSAMNACETYLTRANS-MONO locus_tag OGMAPBJC_03479 product UDP-3-O-(R-3-hydroxymyristoyl)-glucosamine N-acyltransferase 3665617 3665132 CDS gene hlpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10455-MONOMER locus_tag OGMAPBJC_03480 product periplasmic chaperone 3668171 3665739 CDS gene bamA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6093-MONOMER locus_tag OGMAPBJC_03481 product Outer Membrane Protein Assembly Complex - BamA subunit 3669553 3668201 CDS gene rseP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12436-MONOMER locus_tag OGMAPBJC_03482 product RseP zinc protease, signal peptide peptidase 3670314 3669565 CDS EC_number 2.7.7.41 gene cdsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CDPDIGLYSYN-MONOMER locus_tag OGMAPBJC_03483 product CDP-diglyceride synthetase 3670435 3670283 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03484 product hypothetical protein 3671193 3670435 CDS EC_number 2.5.1.31 gene ispU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UPPSYN-MONOMER locus_tag OGMAPBJC_03485 product subunit of undecaprenyl diphosphate synthase 3672578 3671382 CDS EC_number 1.1.1.267 gene dxr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DXPREDISOM-MONOMER locus_tag OGMAPBJC_03486 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase 3673227 3672670 CDS gene frr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10335-MONOMER locus_tag OGMAPBJC_03487 product ribosome recycling factor 3674244 3673519 CDS EC_number 2.7.4.22 gene pyrH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UMPKI-MONOMER locus_tag OGMAPBJC_03488 product uridylate kinase 3675242 3674391 CDS gene tsf inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11033-MONOMER locus_tag OGMAPBJC_03489 product protein chain elongation factor EF-Ts 3676225 3675500 CDS gene rpsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10901-MONOMER locus_tag OGMAPBJC_03490 product 30S ribosomal subunit protein S2 3676593 3677387 CDS gene map inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10570-MONOMER locus_tag OGMAPBJC_03491 product methionine aminopeptidase 3677449 3680121 CDS EC_number 2.7.7.59 gene glnD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLND-MONOMER locus_tag OGMAPBJC_03492 product [protein-PII] uridylyltransferase 3680152 3680976 CDS EC_number 2.3.1.117 gene dapD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2001 locus_tag OGMAPBJC_03493 product tetrahydrodipicolinate succinylase subunit 3681030 3681842 CDS gene yaeI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12337-MONOMER locus_tag OGMAPBJC_03494 product phosphodiesterase 3682004 3682390 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12336-MONOMER locus_tag OGMAPBJC_03495 note conserved protein product hypothetical protein 3683636 3682479 CDS gene cdaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12335-MONOMER locus_tag OGMAPBJC_03496 product CdaR DNA-binding transcriptional activator 3685215 3683791 CDS gene degP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10463-MONOMER locus_tag OGMAPBJC_03497 product serine protease Do 3686862 3685345 CDS EC_number 3.1.5.1 gene dgt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DGTPTRIPHYDRO-MONOMER locus_tag OGMAPBJC_03498 product deoxyguanosine triphosphate triphosphohydrolase 3686946 3687644 CDS EC_number 3.2.2.9 gene mtn inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11090-MONOMER locus_tag OGMAPBJC_03499 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase monomer 3687637 3688437 CDS gene btuF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12334-MONOMER locus_tag OGMAPBJC_03500 product vitamin B12 ABC transporter - periplasmic binding protein 3688475 3689098 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12333-MONOMER locus_tag OGMAPBJC_03501 note conserved inner membrane protein product hypothetical protein 3689489 3689145 CDS gene erpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12332-MONOMER locus_tag OGMAPBJC_03502 product essential respiratory protein A 3690992 3689571 CDS gene clcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YADQ-MONOMER locus_tag OGMAPBJC_03503 product chloride:H+ antiporter ClcA 3691217 3692497 CDS EC_number 5.4.3.8 gene hemL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GSAAMINOTRANS-MONOMER locus_tag OGMAPBJC_03504 product glutamate-1-semialdehyde aminotransferase 3694637 3692655 CDS gene fhuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FHUB-MONOMER locus_tag OGMAPBJC_03505 product iron (III) hydroxamate ABC transporter - membrane subunit 3695524 3694634 CDS gene fhuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FHUD-MONOMER locus_tag OGMAPBJC_03506 product iron (III) hydroxamate ABC transporter - periplasmic binding protein 3696321 3695524 CDS EC_number 3.6.3.34 gene fhuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FHUC-MONOMER locus_tag OGMAPBJC_03507 product iron (III) hydroxamate ABC transporter - ATP binding subunit 3698615 3696372 CDS gene fhuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10302-MONOMER locus_tag OGMAPBJC_03508 product ferrichrome / phage / antibiotic outer membrane porin FhuA 3701369 3698835 CDS EC_number 2.4.1.129 gene mrcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10605-MONOMER locus_tag OGMAPBJC_03509 product penicillin-binding protein 1B 3703994 3701565 CDS gene hrpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12329-MONOMER locus_tag OGMAPBJC_03510 product putative ATP-dependent helicase 3704068 3704598 CDS gene ligT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12330-MONOMER locus_tag OGMAPBJC_03511 product 2'-5' RNA ligase 3704613 3705317 CDS gene sfsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10949-MONOMER locus_tag OGMAPBJC_03512 product putative DNA-binding transcriptional regulator of maltose metabolism 3705495 3705950 CDS gene dksA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10230-MONOMER locus_tag OGMAPBJC_03513 product RNA polymerase-binding transcription factor DksA 3705987 3706913 CDS gene gluQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11362-MONOMER locus_tag OGMAPBJC_03514 product glutamyl-Q tRNAAsp synthetase 3707006 3708370 CDS EC_number 2.7.7.19 gene pcnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10690-MONOMER locus_tag OGMAPBJC_03515 product poly(A) polymerase I 3708367 3708846 CDS EC_number 2.7.6.3 gene folK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:H2PTERIDINEPYROPHOSPHOKIN-MONOMER locus_tag OGMAPBJC_03516 product 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase 3709216 3709800 CDS gene yadN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12328-MONOMER locus_tag OGMAPBJC_03517 product putative fimbrial-like adhesin protein 3709905 3710645 CDS gene yadV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11973-MONOMER locus_tag OGMAPBJC_03518 product putative pilin chaperone similar to PapD 3710680 3711954 CDS gene htrE_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11972-MONOMER locus_tag OGMAPBJC_03519 product putative outer membrane usher protein 3712004 3712267 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_03520 product IS3 family transposase IS1222 3712294 3713124 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_03521 note IS150 conserved protein InsB product hypothetical protein 3713180 3714502 CDS gene htrE_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11972-MONOMER locus_tag OGMAPBJC_03522 product putative outer membrane usher protein 3714519 3715088 CDS gene yadM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12327-MONOMER locus_tag OGMAPBJC_03523 product putative fimbrial-like adhesin protein 3715100 3715705 CDS gene yadL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12326-MONOMER locus_tag OGMAPBJC_03524 product hypothetical protein 3715732 3716328 CDS gene yadK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12325-MONOMER locus_tag OGMAPBJC_03525 product putative fimbrial-like adhesin protein 3716378 3716734 CDS gene yadC_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11678-MONOMER locus_tag OGMAPBJC_03526 product putative fimbrial-like adhesin protein 3717591 3716761 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_03527 note IS150 conserved protein InsB product hypothetical protein 3717881 3717618 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_03528 product IS3 family transposase IS1222 3717894 3718841 CDS gene yadC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11678-MONOMER locus_tag OGMAPBJC_03529 product putative fimbrial-like adhesin protein 3718955 3719749 CDS EC_number 2.1.2.11 gene panB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:3-CH3-2-OXOBUTANOATE-OH-CH3-XFER-MONOMER locus_tag OGMAPBJC_03530 product 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer 3719761 3720612 CDS EC_number 6.3.2.1 gene panC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PANTOATE-BETA-ALANINE-LIG-MONOMER locus_tag OGMAPBJC_03531 product pantothenate synthetase monomer 3721588 3720686 CDS gene yadD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11748-MONOMER locus_tag OGMAPBJC_03532 product putative transposase 3721862 3722242 CDS EC_number 4.1.1.11 gene panD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0C7I4 locus_tag OGMAPBJC_03533 product Aspartate 1-decarboxylase 3723475 3722246 CDS gene yadE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11749-MONOMER locus_tag OGMAPBJC_03534 product putative polysaccharide deacetylase lipoprotein 3723979 3723539 CDS gene yadI_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AGAX-MONOMER locus_tag OGMAPBJC_03535 product AgaX 3724854 3724084 CDS gene yadH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YADH-MONOMER locus_tag OGMAPBJC_03536 product YadG/YadH ABC transporter 3725777 3724851 CDS gene yadG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YADG-MONOMER locus_tag OGMAPBJC_03537 product YadG/YadH ABC transporter 3725886 3726548 CDS EC_number 4.2.1.1 gene can inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12319-MONOMER locus_tag OGMAPBJC_03538 product carbonic anhydrase 2 monomer 3727125 3726589 CDS EC_number 2.4.2.8 gene hpt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYPOXANPRIBOSYLTRAN-MONOMER locus_tag OGMAPBJC_03539 product hypoxanthine-guanine phosphoribosyltransferase 3727331 3729721 CDS EC_number 1.1.5.2 gene gcd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUCDEHYDROG-MONOMER locus_tag OGMAPBJC_03540 product glucose dehydrogenase 3731473 3729923 CDS gene cueO_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12318-MONOMER locus_tag OGMAPBJC_03541 product multicopper oxidase with role in copper homeostasis 3731678 3731986 CDS gene yacC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11089-MONOMER locus_tag OGMAPBJC_03542 product putative protein 3732092 3732958 CDS EC_number 2.5.1.16 gene speE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SPERMIDINESYN-MONOMER locus_tag OGMAPBJC_03543 product spermidine synthase 3732974 3733768 CDS EC_number 4.1.1.50 gene speD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SPED-MONOMER locus_tag OGMAPBJC_03544 product adenosylmethionine decarboxylase, proenzyme 3734168 3733806 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12605-MONOMER locus_tag OGMAPBJC_03545 note conserved protein product hypothetical protein 3736940 3734343 CDS EC_number 4.2.1.99 gene acnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACONITATEDEHYDRB-MONOMER locus_tag OGMAPBJC_03546 product bifunctional aconitate hydratase 2 and 2-methylisocitrate dehydratase 3737295 3739148 CDS gene yacH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12315-MONOMER locus_tag OGMAPBJC_03547 product putative membrane protein 3740643 3739219 CDS EC_number 1.8.1.4 gene lpd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:E3-MONOMER locus_tag OGMAPBJC_03548 product E3 monomer 3742860 3740968 CDS EC_number 2.3.1.12 db_xref COG:COG0508 gene aceF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P06959 locus_tag OGMAPBJC_03549 product Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex 3745538 3742875 CDS EC_number 1.2.4.1 gene aceE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:E1P-MONOMER locus_tag OGMAPBJC_03550 product subunit of E1p component of pyruvate dehydrogenase complex 3746463 3745699 CDS gene pdhR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11088-MONOMER locus_tag OGMAPBJC_03551 product PdhR DNA-binding transcriptional dual regulator 3747007 3748377 CDS gene aroP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AROP-MONOMER locus_tag OGMAPBJC_03552 product aromatic amino acid:H+ symporter AroP 3749274 3748420 CDS gene ampE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10042-MONOMER locus_tag OGMAPBJC_03553 product putative inner membrane protein 3749822 3749271 CDS EC_number 3.5.1.28 gene ampD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10041-MONOMER locus_tag OGMAPBJC_03554 product N-acetyl-anhydromuramyl-L-alanine-amidase 3749910 3750803 CDS EC_number 2.4.2.19 gene nadC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:QUINOPRIBOTRANS-MONOMER locus_tag OGMAPBJC_03555 product quinolinate phosphoribosyltransferase (decarboxylating) monomer 3751006 3751446 CDS gene ppdD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12107-MONOMER locus_tag OGMAPBJC_03556 product prepilin peptidase dependent protein 3751456 3752841 CDS gene hofB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12106-MONOMER locus_tag OGMAPBJC_03557 product protein involved in plasmid replication 3752831 3754033 CDS gene hofC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11798-MONOMER locus_tag OGMAPBJC_03558 product protein transport protein HofC 3755111 3754068 CDS EC_number 1.7.1.7 gene guaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GMP-REDUCT-MONOMER locus_tag OGMAPBJC_03559 product GMP reductase 3755336 3755956 CDS EC_number 2.7.1.24 gene coaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12312-MONOMER locus_tag OGMAPBJC_03560 product dephospho-CoA kinase 3755956 3756699 CDS gene zapD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12313-MONOMER locus_tag OGMAPBJC_03561 product cell division factor ZapD 3756709 3756906 CDS gene yacG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12314-MONOMER locus_tag OGMAPBJC_03562 product DNA gyrase inhibitor YacG 3757511 3757122 CDS gene mutT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10626-MONOMER locus_tag OGMAPBJC_03563 product 8-oxo-dGTP diphosphatase 3760276 3757571 CDS gene secA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECA locus_tag OGMAPBJC_03564 product Sec Translocation Complex 3760925 3760338 CDS gene secM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11087-MONOMER locus_tag OGMAPBJC_03565 product secretion monitor that regulates SecA translation (General Secretory Pathway) 3761998 3761081 CDS gene lpxC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPACYLGLCNACDEACETYL-MONOMER locus_tag OGMAPBJC_03566 product UDP-3-O-acyl-N-acetylglucosamine deacetylase 3763250 3762099 CDS gene ftsZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10347-MONOMER locus_tag OGMAPBJC_03567 product essential cell division protein FtsZ 3764573 3763311 CDS gene ftsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10339-MONOMER locus_tag OGMAPBJC_03568 product essential cell division protein FtsA 3765400 3764570 CDS gene ftsQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10342-MONOMER locus_tag OGMAPBJC_03569 product essential cell division protein FtsQ 3766322 3765402 CDS EC_number 6.3.2.4 gene ddlB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DALADALALIGB-MONOMER locus_tag OGMAPBJC_03570 product D-alanine-D-alanine ligase B 3767790 3766315 CDS EC_number 6.3.2.8 gene murC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDP-NACMUR-ALA-LIG-MONOMER locus_tag OGMAPBJC_03571 product UDP-N-acetylmuramate-alanine ligase 3768911 3767844 CDS EC_number 2.4.1.227 gene murG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NACGLCTRANS-MONOMER locus_tag OGMAPBJC_03572 product N-acetylglucosaminyl transferase 3770152 3768908 CDS gene ftsW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10344-MONOMER locus_tag OGMAPBJC_03573 product essential cell division protein FtsW; lipid II flippase 3771468 3770152 CDS EC_number 6.3.2.9 gene murD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDP-NACMURALA-GLU-LIG-MONOMER locus_tag OGMAPBJC_03574 product UDP-N-acetylmuramoyl-L-alanine:D-glutamate ligase 3772553 3771471 CDS EC_number 2.7.8.13 gene mraY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHOSNACMURPENTATRANS-MONOMER locus_tag OGMAPBJC_03575 product phospho-N-acetylmuramoyl-pentapeptide transferase 3773905 3772547 CDS EC_number 6.3.2.10 gene murF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDP-NACMURALGLDAPAALIG-MONOMER locus_tag OGMAPBJC_03576 product D-alanyl-D-alanine-adding enzyme 3775389 3773902 CDS EC_number 6.3.2.13 gene murE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDP-NACMURALGLDAPLIG-MONOMER locus_tag OGMAPBJC_03577 product UDP-N-acetylmuramoylalanyl-D-glutamate 2,6-diaminopimelate ligase 3777142 3775376 CDS EC_number 2.4.1.129 gene ftsI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10341-MONOMER locus_tag OGMAPBJC_03578 product essential cell division protein FtsI; penicillin-binding protein 3 3777523 3777158 CDS gene ftsL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11086-MONOMER locus_tag OGMAPBJC_03579 product essential cell division protein FtsL 3778461 3777520 CDS gene rsmH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11085-MONOMER locus_tag OGMAPBJC_03580 product 16S rRNA methyltransferase 3778921 3778463 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11084-MONOMER locus_tag OGMAPBJC_03581 note conserved protein product hypothetical protein 3780527 3779523 CDS gene cra inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00521 locus_tag OGMAPBJC_03582 product Cra DNA-binding transcriptional dual regulator 3781198 3780707 CDS EC_number 2.2.1.6 gene ilvH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETOLACTSYNIII-HCHAIN-MONOMER locus_tag OGMAPBJC_03583 product acetolactate synthase / acetohydroxybutanoate synthase 3782925 3781201 CDS EC_number 2.2.1.6 gene ilvI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETOLACTSYNIII-ICHAIN-MONOMER locus_tag OGMAPBJC_03584 product acetolactate synthase / acetohydroxybutanoate synthase 3784187 3783243 CDS gene leuO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00519 locus_tag OGMAPBJC_03585 product LeuO DNA-binding transcriptional dual activator 3785026 3786597 CDS EC_number 2.3.3.13 gene leuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:2-ISOPROPYLMALATESYN-MONOMER locus_tag OGMAPBJC_03586 product 2-isopropylmalate synthase 3786597 3787688 CDS EC_number 1.1.1.85 gene leuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:3-ISOPROPYLMALDEHYDROG-MONOMER locus_tag OGMAPBJC_03587 product 3-isopropylmalate dehydrogenase 3787691 3789091 CDS EC_number 4.2.1.33 gene leuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LEUC-MONOMER locus_tag OGMAPBJC_03588 product isopropylmalate isomerase 3789102 3789707 CDS EC_number 4.2.1.33 gene leuD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LEUD-MONOMER locus_tag OGMAPBJC_03589 product isopropylmalate isomerase 3790934 3789756 CDS gene setA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B0070-MONOMER locus_tag OGMAPBJC_03590 product sugar / lactose efflux transporter SetA 3791167 3791036 CDS gene sgrT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2842 locus_tag OGMAPBJC_03591 product SgrT, regulator of PtsG activity 3791256 3792911 CDS gene sgrR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12094-MONOMER locus_tag OGMAPBJC_03592 product SgrR DNA-binding transcriptional dual regulator 3793075 3794058 CDS gene tbpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SFUA-MONOMER locus_tag OGMAPBJC_03593 product thiamin ABC transporter - periplasmic binding protein 3794034 3795644 CDS gene thiP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SFUB-MONOMER locus_tag OGMAPBJC_03594 product thiamin ABC transporter - membrane subunit 3795628 3796326 CDS gene thiQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SFUC-MONOMER locus_tag OGMAPBJC_03595 product thiamin ABC transporter - ATP binding subunit 3797204 3796440 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11571-MONOMER locus_tag OGMAPBJC_03596 note conserved inner membrane protein product hypothetical protein 3798168 3797290 CDS gene araC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00242 locus_tag OGMAPBJC_03597 product AraC-Arabinose DNA-binding transcriptional activator 3798507 3800207 CDS EC_number 2.7.1.16 gene araB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBULOKIN-MONOMER locus_tag OGMAPBJC_03598 product L-ribulokinase monomer 3800218 3801720 CDS EC_number 5.3.1.4 gene araA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARABISOM-MONOMER locus_tag OGMAPBJC_03599 product L-arabinose isomerase monomer 3802005 3802700 CDS EC_number 5.1.3.4 gene araD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBULPEPIM-MONOMER locus_tag OGMAPBJC_03600 product L-ribulose 5-phosphate 4-epimerase monomer 3802775 3805126 CDS EC_number 2.7.7.7 gene polB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10747-MONOMER locus_tag OGMAPBJC_03601 product DNA polymerase II 3805291 3808197 CDS gene hepA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11083-MONOMER locus_tag OGMAPBJC_03602 product RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor 3808209 3808868 CDS gene rluA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12609-MONOMER locus_tag OGMAPBJC_03603 product 23S rRNA and tRNA pseudouridine synthase 3809821 3808985 CDS gene djlA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11570-MONOMER locus_tag OGMAPBJC_03604 product chaperone with DnaK 3810055 3812409 CDS gene lptD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11569-MONOMER locus_tag OGMAPBJC_03605 product outer membrane lipopolysaccharide transport and assembly complex - LptD subunit 3812462 3813748 CDS EC_number 5.2.1.8 gene surA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10985-MONOMER locus_tag OGMAPBJC_03606 product peptidyl-prolyl cis-trans isomerase (PPIase) 3813748 3814737 CDS EC_number 1.1.1.262 gene pdxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PDXA-MONOMER locus_tag OGMAPBJC_03607 product 4-hydroxy-L-threonine phosphate dehydrogenase, NAD-dependent 3814734 3815555 CDS EC_number 2.1.1.182 gene rsmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10523-MONOMER locus_tag OGMAPBJC_03608 product 16S rRNA,m62A1519 dimethyltransferase 3815558 3815935 CDS gene apaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10047-MONOMER locus_tag OGMAPBJC_03609 product hypothetical protein 3815942 3816784 CDS EC_number 3.6.1.41 gene apaH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10048-MONOMER locus_tag OGMAPBJC_03610 product diadenosine tetraphosphatase 3817452 3816862 CDS EC_number 1.5.1.3 gene folA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIHYDROFOLATEREDUCT-MONOMER locus_tag OGMAPBJC_03611 product dihydrofolate reductase 3819395 3817533 CDS gene kefC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KEFC-MONOMER locus_tag OGMAPBJC_03612 product K+ : H+ antiporter KefC 3819918 3819388 CDS gene kefF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11568-MONOMER locus_tag OGMAPBJC_03613 product regulator of KefC-mediated potassium transport and quinone oxidoreductase 3821357 3820026 CDS gene yaaU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YAAU-MONOMER locus_tag OGMAPBJC_03614 product YaaU 3821702 3821415 CDS gene fixX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11565-MONOMER locus_tag OGMAPBJC_03615 product putative ferredoxin possibly involved in anaerobic carnitine metabolism 3822985 3821699 CDS gene fixC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11564-MONOMER locus_tag OGMAPBJC_03616 product flavoprotein (electron transport), possibly involved in anaerobic carnitine metabolism 3823977 3823036 CDS gene fixB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11563-MONOMER locus_tag OGMAPBJC_03617 product putative flavoprotein subunit required for anaerobic carnitine metabolism 3824762 3823992 CDS gene fixA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11562-MONOMER locus_tag OGMAPBJC_03618 product putative flavoprotein subunit required for anaerobic carnitine metabolism 3825236 3826750 CDS gene caiT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CAIT-MONOMER locus_tag OGMAPBJC_03619 product L-carnitine : gamma-butyrobetaine antiporter 3826781 3827923 CDS gene caiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CROBETREDUCT-MONOMER locus_tag OGMAPBJC_03620 product crotonobetainyl-CoA reductase 3828052 3829269 CDS gene caiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARNDEHYDRA-MONOMER locus_tag OGMAPBJC_03621 product CaiB monomer 3829343 3830896 CDS gene caiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CAIC-MONOMER locus_tag OGMAPBJC_03622 product carnitine-CoA ligase 3831005 3831790 CDS gene caiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARNRACE-MONOMER locus_tag OGMAPBJC_03623 product crotonobetainyl-CoA hydratase 3831796 3832386 CDS gene caiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CAIE-MONOMER locus_tag OGMAPBJC_03624 product putative acyl transferase 3832990 3832595 CDS gene caiF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6088-MONOMER locus_tag OGMAPBJC_03625 product CaiF-L-carnitine DNA-binding Transcriptional Activator 3833025 3833243 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03626 product hypothetical protein 3836472 3833251 CDS EC_number 6.3.5.5 gene carB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARBPSYN-LARGE locus_tag OGMAPBJC_03627 product carbamoyl phosphate synthetase 3837638 3836490 CDS EC_number 6.3.5.5 gene carA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CARBPSYN-SMALL locus_tag OGMAPBJC_03628 product carbamoyl phosphate synthetase 3838915 3838094 CDS EC_number 1.3.1.26 gene dapB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIHYDROPICRED-MONOMER locus_tag OGMAPBJC_03629 product dihydrodipicolinate reductase 3839996 3839082 CDS gene rihC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11082-MONOMER locus_tag OGMAPBJC_03630 product ribonucleoside hydrolase 3 3841012 3840062 CDS EC_number 1.17.1.2 gene ispH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11081-MONOMER locus_tag OGMAPBJC_03631 product 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase 3841463 3841014 CDS EC_number 5.2.1.8 gene fkpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11080-MONOMER locus_tag OGMAPBJC_03632 product peptidyl-prolyl cis-trans isomerase 3842082 3841588 CDS gene lspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10548-MONOMER locus_tag OGMAPBJC_03633 product prolipoprotein signal peptidase II 3844898 3842082 CDS EC_number 6.1.1.5 gene ileS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ILES-MONOMER locus_tag OGMAPBJC_03634 product isoleucyl-tRNA synthetase 3845882 3844941 CDS EC_number 2.7.7.2 gene ribF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBF-MONOMER locus_tag OGMAPBJC_03635 product bifunctional riboflavin kinase / FMN adenylyltransferase 3846211 3846474 CDS gene rpsT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10919-MONOMER locus_tag OGMAPBJC_03636 product 30S ribosomal subunit protein S20 3846958 3847905 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03637 product hypothetical protein 3848957 3849964 CDS gene yehB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11988-MONOMER locus_tag OGMAPBJC_03638 product putative outer membrane usher protein 3849977 3850201 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03639 product hypothetical protein 3850511 3850936 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03640 product hypothetical protein 3851874 3850975 CDS gene nhaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00474 locus_tag OGMAPBJC_03641 product NhaR transcriptional activator 3853106 3851940 CDS gene nhaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NHAA-MONOMER locus_tag OGMAPBJC_03642 product sodium:H+ antiporter NhaA 3853692 3853844 CDS gene hokC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1564 locus_tag OGMAPBJC_03643 product HokC, Gef toxin; interferes with membrane function when in excess 3853922 3855034 CDS gene insL-3_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7255-MONOMER locus_tag OGMAPBJC_03644 product putative IS186/IS421 transposase 3855057 3855197 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03645 product hypothetical protein 3856427 3855297 CDS gene dnaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10240-MONOMER locus_tag OGMAPBJC_03646 product chaperone with DnaK; heat shock protein 3858432 3856516 CDS gene dnaK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10241-MONOMER locus_tag OGMAPBJC_03647 product chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins 3858809 3859213 CDS gene yaaI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G8202-MONOMER locus_tag OGMAPBJC_03648 product putative protein 3859239 3859952 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6082-MONOMER locus_tag OGMAPBJC_03649 note conserved protein product hypothetical protein 3860101 3860667 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11512-MONOMER locus_tag OGMAPBJC_03650 note conserved inner membrane protein associated with acetate transport product hypothetical protein 3861289 3860702 CDS gene mog inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11511-MONOMER locus_tag OGMAPBJC_03651 product MogA 3862357 3861404 CDS gene talB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRANSALDOLB-MONOMER locus_tag OGMAPBJC_03652 product transaldolase B 3862636 3864066 CDS gene yaaJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YAAJ-MONOMER locus_tag OGMAPBJC_03653 product inner membrane protein YaaJ 3864136 3864912 CDS gene yaaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10011-MONOMER locus_tag OGMAPBJC_03654 product protein that reduces intracellular iron levels under peroxide stress 3865361 3865065 CDS gene yaaX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6081-MONOMER locus_tag OGMAPBJC_03655 product putative protein 3866861 3865575 CDS EC_number 4.2.3.1 gene thrC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THRESYN-MONOMER locus_tag OGMAPBJC_03656 product threonine synthase 3867794 3866862 CDS EC_number 2.7.1.39 gene thrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HOMOSERKIN-MONOMER locus_tag OGMAPBJC_03657 product homoserine kinase 3870258 3867796 CDS EC_number 2.7.2.4 gene thrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPKINIHOMOSERDEHYDROGI-MONOMER locus_tag OGMAPBJC_03658 product aspartate kinase / homoserine dehydrogenase 3871304 3870618 CDS gene yjtD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12309-MONOMER locus_tag OGMAPBJC_03659 product putative rRNA methyltransferase 3871940 3872656 CDS gene torR_4 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TORR-MONOMER locus_tag OGMAPBJC_03660 product TorR transcriptional dual regulator 3874066 3872714 CDS gene creD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10145-MONOMER locus_tag OGMAPBJC_03661 product putative inner membrane protein 3875548 3874124 CDS EC_number 2.7.13.3 db_xref COG:COG0642 gene creC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P08401 locus_tag OGMAPBJC_03662 product Sensor protein CreC 3876237 3875548 CDS gene torR_5 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TORR-MONOMER locus_tag OGMAPBJC_03663 product TorR transcriptional dual regulator 3876723 3876250 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11217-MONOMER locus_tag OGMAPBJC_03664 note conserved protein product hypothetical protein 3876934 3877803 CDS gene rob_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD04418 locus_tag OGMAPBJC_03665 product Rob DNA-binding transcriptional activator 3878447 3877800 CDS EC_number 5.4.2.1 gene ytjC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGAM2-MONOMER locus_tag OGMAPBJC_03666 product putative phosphoglycerate mutase 2 3878499 3879020 CDS EC_number 3.6.1.19 gene yjjX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12600-MONOMER locus_tag OGMAPBJC_03667 product ITPase/XTPase 3879401 3879105 CDS gene trpR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00423 locus_tag OGMAPBJC_03668 product TrpR-Tryptophan DNA-binding transcriptional repressor 3881446 3879521 CDS EC_number 4.2.2 gene slt inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10950-MONOMER locus_tag OGMAPBJC_03669 product soluble lytic murein transglycosylase 3881782 3883449 CDS gene yjjK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJJK-MONOMER locus_tag OGMAPBJC_03670 product YjjK 3883723 3883556 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03671 product hypothetical protein 3884989 3883757 CDS EC_number 2.7.7.1 gene nadR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD04413 locus_tag OGMAPBJC_03672 product NadR DNA-binding transcriptional repressor and NMN adenylyltransferase 3886392 3885010 CDS gene radA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11296-MONOMER locus_tag OGMAPBJC_03673 product DNA recombination protein 3887409 3886441 CDS EC_number 3.1.3.3 gene serB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSERPHOSPHA-MONOMER locus_tag OGMAPBJC_03674 product phosphoserine phosphatase 3887515 3888159 CDS gene ytjB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10951-MONOMER locus_tag OGMAPBJC_03675 product membrane protein 3888187 3889203 CDS gene lplA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11796-MONOMER locus_tag OGMAPBJC_03676 product lipoyl-protein ligase A 3889235 3889498 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03677 product hypothetical protein 3890378 3889659 CDS EC_number 2.4.2.1 gene deoD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DEOD-MONOMER locus_tag OGMAPBJC_03678 product purine nucleoside phosphorylase deoD-type 3891658 3890435 CDS EC_number 5.4.2.7 gene deoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PPENTOMUT-MONOMER locus_tag OGMAPBJC_03679 product phosphopentomutase 3893032 3891710 CDS EC_number 2.4.2.4 gene deoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DEOA-MONOMER locus_tag OGMAPBJC_03680 product thymidine phosphorylase / uracil phosphorylase 3893938 3893159 CDS EC_number 4.1.2.4 gene deoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DEOXYRIBOSE-P-ALD-MONOMER locus_tag OGMAPBJC_03681 product deoxyribose-phosphate aldolase 3894196 3895746 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12171-MONOMER locus_tag OGMAPBJC_03682 note conserved protein, may be involved in nitrogen metabolism product hypothetical protein 3895877 3896581 CDS gene yjjW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7953-MONOMER locus_tag OGMAPBJC_03683 product putative pyruvate formate lyase activating enzyme 3897880 3897098 CDS gene yjjV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7952-MONOMER locus_tag OGMAPBJC_03684 product putative DNase 3898950 3897877 CDS gene yjjU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7951-MONOMER locus_tag OGMAPBJC_03685 product putative esterase 3899233 3899072 CDS gene ytjA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2697 locus_tag OGMAPBJC_03686 product putative protein 3899965 3899360 CDS gene osmY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11391-MONOMER locus_tag OGMAPBJC_03687 product hyperosmotically inducible periplasmic protein 3901947 3900358 CDS gene prfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12114-MONOMER locus_tag OGMAPBJC_03688 product peptide chain release factor RF3 3902715 3902038 CDS EC_number 3.1.3.5 gene yjjG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12115-MONOMER locus_tag OGMAPBJC_03689 product pyrimidine nucleotidase 3903176 3902730 CDS EC_number 2.3.1.128 gene rimI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10850-MONOMER locus_tag OGMAPBJC_03690 product ribosomal-protein-S18-alanine N-acetyltransferase 3903558 3903145 CDS EC_number 2.7.7.7 gene holD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11414-MONOMER locus_tag OGMAPBJC_03691 product DNA polymerase III, ps subunit 3903661 3904692 CDS EC_number 2.1.1.172 gene rsmC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7950-MONOMER locus_tag OGMAPBJC_03692 product 16S rRNA methyltransferase 3904890 3904976 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03693 product tRNA-Leu(cag) 3905005 3905091 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03694 product tRNA-Leu(cag) 3905126 3905212 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03695 product tRNA-Leu(cag) 3905487 3905251 CDS gene yjjZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2696 locus_tag OGMAPBJC_03696 product putative protein 3905628 3906416 CDS gene fhuF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7949-MONOMER locus_tag OGMAPBJC_03697 product acts in reduction of ferrioxamine B iron 3907131 3906454 CDS gene bglJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7948-MONOMER locus_tag OGMAPBJC_03698 product BglJ DNA-binding transcriptional regulator 3907814 3907089 CDS gene yjjQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7947-MONOMER locus_tag OGMAPBJC_03699 product putative DNA-binding transcriptional regulator 3908435 3909205 CDS gene yjjP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7946-MONOMER locus_tag OGMAPBJC_03700 product putative inner membrane structural protein 3909196 3909669 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0ADD2 locus_tag OGMAPBJC_03701 note UPF0442 protein YjjB product hypothetical protein 3909776 3910315 CDS gene dnaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10244-MONOMER locus_tag OGMAPBJC_03702 product primosome 3910318 3911055 CDS gene dnaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10237-MONOMER locus_tag OGMAPBJC_03703 product chromosome replication; initiation and chain elongation 3911104 3911598 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11214-MONOMER locus_tag OGMAPBJC_03704 note conserved protein product hypothetical protein 3911852 3914143 CDS EC_number 2.7.8.20 gene mdoB inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01070 locus_tag OGMAPBJC_03705 product Phosphoglycerol transferase I 3915302 3914280 CDS gene yjjN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7945-MONOMER locus_tag OGMAPBJC_03706 product putative L-galactonate oxidoreductase 3915441 3916355 CDS gene yjjM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7944-MONOMER locus_tag OGMAPBJC_03707 product putative DNA-binding transcriptional regulator 3916570 3917931 CDS gene yjjL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJIZ-MONOMER locus_tag OGMAPBJC_03708 product galactonate:H+ symporter 3919644 3917980 CDS gene tsr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TSR-MONOMER locus_tag OGMAPBJC_03709 product methyl accepting chemotaxis protein - serine sensing 3920209 3919763 CDS gene farR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0DPR8 locus_tag OGMAPBJC_03710 product HTH-type transcriptional regulator FarR 3920481 3921770 CDS db_xref COG:COG0179 gene hpcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P37352 locus_tag OGMAPBJC_03711 product Homoprotocatechuate catabolism bifunctional isomerase/decarboxylase 3921767 3923233 CDS EC_number 1.2.1.5 gene puuC_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALDHDEHYDROG-MONOMER locus_tag OGMAPBJC_03712 product gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase 3923235 3924086 CDS EC_number 1.13.11.15 db_xref COG:COG3384 gene hpcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q05353 locus_tag OGMAPBJC_03713 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase 3924096 3924476 CDS EC_number 5.3.3.10 gene hpcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q05354 locus_tag OGMAPBJC_03714 product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase 3924587 3925390 CDS EC_number 4.2.1.80 gene mhpD_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MHPDHYDROL-MONOMER locus_tag OGMAPBJC_03715 product 2-hydroxypentadienoate hydratase 3925401 3926189 CDS EC_number 4.1.2 gene yfaU_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7158-MONOMER locus_tag OGMAPBJC_03716 product 2-keto-3-deoxy-L-rhamnonate aldolase 3926364 3927740 CDS gene yfaV_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B2246-MONOMER locus_tag OGMAPBJC_03717 product putative transporter 3927750 3928640 CDS gene rhaR_2 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01533 locus_tag OGMAPBJC_03718 product HTH-type transcriptional activator RhaR 3928891 3930453 CDS EC_number 1.14.14.9 db_xref COG:COG2368 gene hpaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q57160 locus_tag OGMAPBJC_03719 product 4-hydroxyphenylacetate 3-monooxygenase oxygenase component 3930471 3930983 CDS gene rutF_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6518-MONOMER locus_tag OGMAPBJC_03720 product flavin reductase 3931376 3933526 CDS gene yjiY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7942-MONOMER locus_tag OGMAPBJC_03721 product putative inner membrane protein 3933657 3933860 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7941-MONOMER locus_tag OGMAPBJC_03722 note conserved protein product hypothetical protein 3933871 3934827 CDS gene yjiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10021-MONOMER locus_tag OGMAPBJC_03723 product P-loop guanosine triphosphatase 3936548 3934896 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03724 product hypothetical protein 3936826 3937563 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03725 product hypothetical protein 3937777 3939189 CDS gene yjiR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7936-MONOMER locus_tag OGMAPBJC_03726 product putative regulator 3940376 3939432 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7197-MONOMER locus_tag OGMAPBJC_03727 note conserved protein product hypothetical protein 3940843 3942075 CDS gene mdtM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJIO-MONOMER locus_tag OGMAPBJC_03728 product multidrug efflux transporter MdtM 3942116 3943396 CDS gene yjiN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7933-MONOMER locus_tag OGMAPBJC_03729 product hypothetical protein 3943512 3944663 CDS gene yjiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7932-MONOMER locus_tag OGMAPBJC_03730 product hypothetical protein 3944673 3945440 CDS gene yjiL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7931-MONOMER locus_tag OGMAPBJC_03731 product putative ATPase, activator of (R)-hydroxyglutaryl-CoA dehdratase 3945437 3945694 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03732 product hypothetical protein 3945648 3946619 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7930-MONOMER locus_tag OGMAPBJC_03733 note conserved protein product hypothetical protein 3946687 3947865 CDS gene yjiJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7929-MONOMER locus_tag OGMAPBJC_03734 product putative transport protein 3948432 3947878 CDS gene kptA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7928-MONOMER locus_tag OGMAPBJC_03735 product enzyme with tRNA 2'-phosphotransferase activity 3948682 3949365 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7927-MONOMER locus_tag OGMAPBJC_03736 note conserved inner membrane protein product hypothetical protein 3949362 3949823 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7926-MONOMER locus_tag OGMAPBJC_03737 note conserved inner membrane protein product hypothetical protein 3949836 3951008 CDS gene iadA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7925-MONOMER locus_tag OGMAPBJC_03738 product isoaspartyl dipeptidase 3951073 3951984 CDS gene yjiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7924-MONOMER locus_tag OGMAPBJC_03739 product YjiE transcriptional dual regulator 3952369 3951977 CDS gene iraD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7923-MONOMER locus_tag OGMAPBJC_03740 product inhibitor of sS proteolysis 3953042 3953872 CDS gene yjiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7922-MONOMER locus_tag OGMAPBJC_03741 product hypothetical protein 3954738 3954013 CDS gene uxuR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG20249-MONOMER locus_tag OGMAPBJC_03742 product UxuR DNA-binding transcriptional repressor 3954785 3954979 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03743 product hypothetical protein 3956461 3955001 CDS EC_number 1.1.1.57 gene uxuB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANNONOXIDOREDUCT-MONOMER locus_tag OGMAPBJC_03744 product D-mannonate oxidoreductase 3957726 3956542 CDS EC_number 4.2.1.8 gene uxuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MANNONDEHYDRAT-MONOMER locus_tag OGMAPBJC_03745 product D-mannonate dehydratase 3958066 3959409 CDS gene gntP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GNTP-MONOMER locus_tag OGMAPBJC_03746 product gluconate / fructuronate transporter GntP 3960484 3959582 CDS gene fimH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10315-MONOMER locus_tag OGMAPBJC_03747 product minor fimbrial subunit, D-mannose specific adhesin 3960642 3960968 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS3411 locus_tag OGMAPBJC_03748 product IS3 family transposase IS3411 3960968 3961447 CDS gene insO-1_5 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6132-MONOMER locus_tag OGMAPBJC_03749 product CP4-6 prophage; partial transposase of insertion element IS911A, interrupted by insertion of IS30 element 3962039 3963562 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03750 product hypothetical protein 3963754 3964125 CDS gene insF-1_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7126-MONOMER locus_tag OGMAPBJC_03751 product IS3 element protein InsF 3964491 3964165 CDS gene insN-1_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6130-MONOMER locus_tag OGMAPBJC_03752 product CP4-6 prophage; partial regulator of insertion element IS911A 3964592 3965164 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03753 product hypothetical protein 3966037 3965213 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03754 product hypothetical protein 3966655 3966571 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03755 product tRNA-Leu(caa) 3966851 3967870 CDS gene yjgB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11436-MONOMER locus_tag OGMAPBJC_03756 product putative alcohol dehydrogenase, Zn-dependent and NAD(P)-binding 3968000 3969502 CDS gene yjgR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7890-MONOMER locus_tag OGMAPBJC_03757 product putative ATPase 3970703 3969621 CDS gene lptG_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7889-MONOMER locus_tag OGMAPBJC_03758 product LptABCFG ABC transporter 3971782 3970703 CDS gene lptF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7888-MONOMER locus_tag OGMAPBJC_03759 product LptABCFG ABC transporter 3972070 3973581 CDS gene pepA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10694-MONOMER locus_tag OGMAPBJC_03760 product aminopeptidase A/I 3973935 3974378 CDS EC_number 2.7.7.7 gene holC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11413-MONOMER locus_tag OGMAPBJC_03761 product DNA polymerase III, kh subunit 3974378 3977233 CDS EC_number 6.1.1.9 gene valS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:VALS-MONOMER locus_tag OGMAPBJC_03762 product valyl-tRNA synthetase 3978485 3977289 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7887-MONOMER locus_tag OGMAPBJC_03763 note conserved inner membrane protein product hypothetical protein 3978678 3979181 CDS gene yjgM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7886-MONOMER locus_tag OGMAPBJC_03764 product putative acetyltransferase 3979643 3979227 CDS gene rraB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7885-MONOMER locus_tag OGMAPBJC_03765 product ribonuclease E inhibitor protein B 3979805 3980809 CDS EC_number 2.1.3.3 gene argI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHAINI-MONOMER locus_tag OGMAPBJC_03766 product ornithine carbamoyltransferase chain I 3982557 3980974 CDS gene yjgL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7884-MONOMER locus_tag OGMAPBJC_03767 product putative protein 3983132 3982680 CDS gene tabA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7883-MONOMER locus_tag OGMAPBJC_03768 product toxin-antitoxin biofilm protein 3983870 3983277 CDS gene bdcR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7882-MONOMER locus_tag OGMAPBJC_03769 product putative transcriptional regulator 3983941 3984654 CDS gene bdcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7880-MONOMER locus_tag OGMAPBJC_03770 product c-di-GMP binding protein involved in biofilm dispersal 3984785 3985180 CDS gene yjgH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7879-MONOMER locus_tag OGMAPBJC_03771 product putative mRNA endoribonuclease 3985599 3986534 CDS EC_number 2.1.3.2 gene pyrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPCARBCAT-MONOMER locus_tag OGMAPBJC_03772 product aspartate carbamoyltransferase, PyrB subunit 3986547 3987008 CDS gene pyrI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPCARBREG-MONOMER locus_tag OGMAPBJC_03773 product aspartate carbamoyltransferase, PyrI subunit 3987081 3987467 CDS gene ridA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7877-MONOMER locus_tag OGMAPBJC_03774 product putative enamine/imine deaminase 3990369 3987673 CDS EC_number 3.6.3.2 gene mgtA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MGTA-MONOMER locus_tag OGMAPBJC_03775 product Mg2+ / Ni2+ transporting ATPase 3990748 3991695 CDS gene treR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12202-MONOMER locus_tag OGMAPBJC_03776 product TreR transcriptional repressor 3991814 3993235 CDS EC_number 2.7.1.69 gene treB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TREB-MONOMER locus_tag OGMAPBJC_03777 product trehalose PTS permease - TreB subunit 3993285 3994940 CDS EC_number 3.2.1.93 gene treC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRE6PHYDRO-MONOMER locus_tag OGMAPBJC_03778 product trehalose-6-phosphate hydrolase 3995334 3997472 CDS gene nrdD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBONUCLEOSIDE-TRIP-REDUCT-MONOMER locus_tag OGMAPBJC_03779 product ribonucleoside-triphosphate reductase 3997632 3998096 CDS gene nrdG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RNTRACTIV-MONOMER locus_tag OGMAPBJC_03780 product anaerobic nucleoside-triphosphate reductase activating system 3998527 3998141 CDS db_xref COG:COG3783 gene cybC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0ABE7 locus_tag OGMAPBJC_03781 product Soluble cytochrome b562 4000062 3998710 CDS gene pmbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10741-MONOMER locus_tag OGMAPBJC_03782 product protease involved in Microcin B17 maturation and in sensitivity to the DNA gyrase inhibitor LetD 4000156 4000707 CDS gene yjgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11410-MONOMER locus_tag OGMAPBJC_03783 product putative alpha-helix protein 4002231 4000858 CDS gene mpl inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12440-MONOMER locus_tag OGMAPBJC_03784 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase 4002407 4003405 CDS EC_number 3.1.3.11 gene fbp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:F16B-MONOMER locus_tag OGMAPBJC_03785 product fructose-1,6-bisphosphatase monomer 4004433 4003438 CDS gene yjfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJFF-MONOMER locus_tag OGMAPBJC_03786 product galactofuranose / galactospyranose ABC transporter - putative membrane subunit 4005442 4004420 CDS gene ytfT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YTFT-MONOMER locus_tag OGMAPBJC_03787 product galactofuranose / galactopyranose ABC transporter - putative membrane subunit 4006958 4005456 CDS gene ytfR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YTFR-MONOMER locus_tag OGMAPBJC_03788 product galactofuranose / galactopyranose ABC transporter - putative ATP binding subunit 4008054 4007098 CDS gene ytfQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YTFQ-MONOMER locus_tag OGMAPBJC_03789 product galactofuranose / galactopyranose ABC transporter - periplasmic binding protein 4008364 4008894 CDS EC_number 3.6.1.1 gene ppa inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:INORGPYROPHOSPHAT-MONOMER locus_tag OGMAPBJC_03790 product inorganic pyrophosphatase 4009288 4008974 CDS gene chpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12096-MONOMER locus_tag OGMAPBJC_03791 product ChpB toxin of the ChpB-ChpS toxin-antitoxin system 4009569 4009318 CDS gene chpS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11250-MONOMER locus_tag OGMAPBJC_03792 product ChpS antitoxin of the ChpB-ChpS toxin-antitoxin system 4010122 4009781 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7876-MONOMER locus_tag OGMAPBJC_03793 note conserved protein product hypothetical protein 4013904 4010125 CDS gene tamB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7875-MONOMER locus_tag OGMAPBJC_03794 product translocation and assembly module - TamB subunit 4015634 4013901 CDS gene tamA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7874-MONOMER locus_tag OGMAPBJC_03795 product translocation and assembly module - TamA subunit 4015840 4016478 CDS EC_number 1.8.4.11 gene msrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11433-MONOMER locus_tag OGMAPBJC_03796 product methionine sulfoxide reductase A 4016801 4018144 CDS gene ytfL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7873-MONOMER locus_tag OGMAPBJC_03797 product putative transport protein 4018412 4018206 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7872-MONOMER locus_tag OGMAPBJC_03798 note conserved protein product hypothetical protein 4018737 4019294 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7871-MONOMER locus_tag OGMAPBJC_03799 note conserved protein product hypothetical protein 4020024 4019284 CDS EC_number 3.1.3.7 gene cysQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10043-MONOMER locus_tag OGMAPBJC_03800 product adenosine-3'(2'),5'-bisphosphate nucleotidase 4020214 4022157 CDS EC_number 3.1.4.16 gene cpdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CPDB-MONOMER locus_tag OGMAPBJC_03801 product 2',3'-cyclic nucleotide 2'-phosphodiesterase / 3'-nucleotidase 4022660 4022280 CDS gene ytfH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7869-MONOMER locus_tag OGMAPBJC_03802 product putative transcriptional regulator 4022749 4023609 CDS EC_number 1.6.5.2 gene ytfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7868-MONOMER locus_tag OGMAPBJC_03803 product NAD(P)H:quinone oxidoreductase 4023718 4024683 CDS gene ytfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7867-MONOMER locus_tag OGMAPBJC_03804 product inner membrane protein 4024791 4025453 CDS gene ytfE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7866-MONOMER locus_tag OGMAPBJC_03805 product protein involved in repair of stress-damaged iron-sulfur clusters 4026910 4025498 CDS gene cycA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYCA-MONOMER locus_tag OGMAPBJC_03806 product serine / alanine / glycine / cycloserine:H+symporter 4027839 4027219 CDS EC_number 5.2.1.8 gene fklB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7865-MONOMER locus_tag OGMAPBJC_03807 product FKBP-type peptidyl-prolyl cis-trans isomerase (rotamase) 4028058 4028696 CDS gene ytfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7864-MONOMER locus_tag OGMAPBJC_03808 product putative cell envelope opacity-associated protein 4029327 4028680 CDS gene nicS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q88FX7 locus_tag OGMAPBJC_03809 product HTH-type transcriptional repressor NicS 4029540 4030331 CDS EC_number 1.1.1.127 gene kduD_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDUD-MONOMER locus_tag OGMAPBJC_03810 product 2-deoxy-D-gluconate 3-dehydrogenase 4030341 4031183 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03811 product hypothetical protein 4031193 4031969 CDS EC_number 4.2.1.17 gene paaF_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6714-MONOMER locus_tag OGMAPBJC_03812 product putative 2,3-dehydroadipyl-CoA hydratase 4031979 4033520 CDS EC_number 2.8.3.8 gene ydiF_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12432-MONOMER locus_tag OGMAPBJC_03813 product fused predicted acetyl-CoA:acetoacetyl-CoA transferase: alpha subunit/beta subunit 4033517 4035598 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03814 product hypothetical protein 4035619 4036095 CDS db_xref COG:COG3090 gene siaQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:Q9KR65 locus_tag OGMAPBJC_03815 product Sialic acid TRAP transporter small permease protein SiaQ 4036138 4037439 CDS gene yiaN_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12282-MONOMER locus_tag OGMAPBJC_03816 product 2,3-diketo-L-gulonate:Na+ symporter - membrane subunit 4037492 4038463 CDS gene yiaO_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12283-MONOMER locus_tag OGMAPBJC_03817 product 2,3-diketo-L-gulonate:Na+ symporter - periplasmic binding protein 4039024 4038575 CDS gene rplI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10870-MONOMER locus_tag OGMAPBJC_03818 product 50S ribosomal subunit protein L9 4039293 4039066 CDS gene rpsR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10917-MONOMER locus_tag OGMAPBJC_03819 product 30S ribosomal subunit protein S18 4039612 4039298 CDS gene priB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10764-MONOMER locus_tag OGMAPBJC_03820 product primosome 4040014 4039619 CDS gene rpsF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10905-MONOMER locus_tag OGMAPBJC_03821 product 30S ribosomal subunit protein S6 4040342 4040617 CDS gene yjfY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7861-MONOMER locus_tag OGMAPBJC_03822 product putative protein 4041432 4040746 CDS EC_number 5.1.3.4 gene ulaF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7860-MONOMER locus_tag OGMAPBJC_03823 product L-ribulose 5-phosphate 4-epimerase 4042286 4041432 CDS EC_number 5.1.3.22 gene ulaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7859-MONOMER locus_tag OGMAPBJC_03824 product L-xylulose 5-phosphate 3-epimerase 4042946 4042296 CDS EC_number 4.1.1.85 gene ulaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7858-MONOMER locus_tag OGMAPBJC_03825 product 3-keto-L-gulonate 6-phosphate decarboxylase 4043424 4042960 CDS gene ulaC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJFU-MONOMER locus_tag OGMAPBJC_03826 product L-ascorbate PTS permease - UlaC subunit 4043739 4043434 CDS EC_number 2.7.1.69 gene ulaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJFT-MONOMER locus_tag OGMAPBJC_03827 product L-ascorbate PTS permease - UlaB subunit 4045152 4043755 CDS gene ulaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SGAT-MONOMER locus_tag OGMAPBJC_03828 product L-ascorbate PTS permease - UlaA subunit 4045507 4046571 CDS gene ulaG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7855-MONOMER locus_tag OGMAPBJC_03829 product L-ascorbate 6-phosphate lactonase 4046679 4047434 CDS gene ulaR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7854-MONOMER locus_tag OGMAPBJC_03830 product UlaR DNA-binding transcriptional repressor 4048180 4047431 CDS gene yjfP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7853-MONOMER locus_tag OGMAPBJC_03831 product esterase 4048362 4048691 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7852-MONOMER locus_tag OGMAPBJC_03832 note conserved protein product hypothetical protein 4048840 4049115 CDS gene yjfN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7851-MONOMER locus_tag OGMAPBJC_03833 product putative protein 4050857 4049232 CDS gene aidB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11811-MONOMER locus_tag OGMAPBJC_03834 product isovaleryl-CoA dehydrogenase and DNA-binding transcriptional repressor 4052104 4050941 CDS gene yjfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11812-MONOMER locus_tag OGMAPBJC_03835 product putative synthetase/amidase 4052745 4052107 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7850-MONOMER locus_tag OGMAPBJC_03836 note conserved protein product hypothetical protein 4053153 4052755 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7849-MONOMER locus_tag OGMAPBJC_03837 note conserved inner membrane protein product hypothetical protein 4053830 4053171 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7848-MONOMER locus_tag OGMAPBJC_03838 note conserved protein product hypothetical protein 4054579 4053881 CDS gene yjfJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7847-MONOMER locus_tag OGMAPBJC_03839 product putative transcriptional regulator effector protein 4054999 4054598 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7846-MONOMER locus_tag OGMAPBJC_03840 note conserved protein product hypothetical protein 4055857 4055126 CDS gene rlmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7845-MONOMER locus_tag OGMAPBJC_03841 product 23S rRNA 2'-O-ribose methyltransferase monomer 4058478 4056037 CDS EC_number 3.1.13.1 gene rnr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11259-MONOMER locus_tag OGMAPBJC_03842 product RNase R 4058942 4058517 CDS gene nsrR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11212-MONOMER locus_tag OGMAPBJC_03843 product NsrR-nitric oxide 4060445 4059147 CDS EC_number 6.3.4.4 gene purA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADENYLOSUCCINATE-SYN-MONOMER locus_tag OGMAPBJC_03844 product adenylosuccinate synthetase 4060746 4060549 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7844-MONOMER locus_tag OGMAPBJC_03845 note conserved inner membrane protein product hypothetical protein 4061832 4060828 CDS gene hflC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10435-MONOMER locus_tag OGMAPBJC_03846 product regulator of FtsH protease 4063094 4061835 CDS gene hflK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10436-MONOMER locus_tag OGMAPBJC_03847 product regulator of FtsH protease 4064460 4063180 CDS gene hflX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10437-MONOMER locus_tag OGMAPBJC_03848 product GTPase associated with the 50S subunit of the ribosome 4064844 4064536 CDS gene hfq inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10438-MONOMER locus_tag OGMAPBJC_03849 product RNA-binding protein that affects many cellular processes; of mammalian Sm/Sm-like proteins 4065880 4064930 CDS EC_number 2.5.1.75 gene miaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10595-MONOMER locus_tag OGMAPBJC_03850 product tRNA(i6A37) synthase 4067720 4065873 CDS gene mutL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11281-MONOMER locus_tag OGMAPBJC_03851 product MutHLS complex, methyl-directed mismatch repair 4069067 4067730 CDS EC_number 3.5.1.28 gene amiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NACMURLALAAMI2-MONOMER locus_tag OGMAPBJC_03852 product N-acetylmuramoyl-L-alanine amidase 2 4069547 4069086 CDS gene tsaE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11757-MONOMER locus_tag OGMAPBJC_03853 product protein involved in threonylcarbamoyladenosine biosynthesis 4071051 4069519 CDS gene yjeF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11758-MONOMER locus_tag OGMAPBJC_03854 product NAD(P)HX epimerase / NAD(P)HX dehydratase 4071065 4072204 CDS gene queG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7843-MONOMER locus_tag OGMAPBJC_03855 product epoxyqueuosine reductase 4072549 4072474 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03856 product tRNA-Gly(gcc) 4072660 4072585 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03857 product tRNA-Gly(gcc) 4072893 4072818 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03858 product tRNA-Gly(gcc) 4073649 4073104 CDS gene orn inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7842-MONOMER locus_tag OGMAPBJC_03859 product oligoribonuclease monomer 4073744 4074796 CDS gene rsgA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7841-MONOMER locus_tag OGMAPBJC_03860 product ribosome small subunit-dependent GTPase A 4074893 4075861 CDS EC_number 4.1.1.65 gene psd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSD-MONOMER locus_tag OGMAPBJC_03861 product phosphatidylserine decarboxylase, proenzyme 4075883 4079206 CDS gene mscM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7840-MONOMER locus_tag OGMAPBJC_03862 product mechanosensitive channel of miniconductance McsM monomer 4079537 4079235 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7839-MONOMER locus_tag OGMAPBJC_03863 note conserved inner membrane protein product hypothetical protein 4079860 4079546 CDS gene yjeN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7838-MONOMER locus_tag OGMAPBJC_03864 product putative protein 4081369 4079912 CDS gene yjeM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJEM-MONOMER locus_tag OGMAPBJC_03865 product YjeM APC transporter 4082610 4081633 CDS gene epmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11211-MONOMER locus_tag OGMAPBJC_03866 product EF-P-lysine lysyltransferase 4082935 4084743 CDS EC_number 1.3.99.1 gene frdA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUM-FLAVO locus_tag OGMAPBJC_03867 product fumarate reductase flavoprotein 4084736 4085470 CDS EC_number 1.3.99.1 gene frdB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUM-FE-S locus_tag OGMAPBJC_03868 product fumarate reductase iron-sulfur protein 4085481 4085876 CDS EC_number 1.3.99.1 gene frdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUM-MEMB1 locus_tag OGMAPBJC_03869 product fumarate reductase membrane protein 4085887 4086246 CDS EC_number 1.3.99.1 gene frdD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUM-MEMB2 locus_tag OGMAPBJC_03870 product fumarate reductase membrane protein 4086309 4087442 CDS EC_number 3.5.2.6 gene ampC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10040-MONOMER locus_tag OGMAPBJC_03871 product beta-lactamase; penicillin resistance 4087531 4088064 CDS gene blc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7837-MONOMER locus_tag OGMAPBJC_03872 product Blc outer membrane lipoprotein (lipocalin) 4088378 4088061 CDS gene sugE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUGE-MONOMER locus_tag OGMAPBJC_03873 product SugE SMR transporter 4088706 4088560 CDS gene ecnB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1563 locus_tag OGMAPBJC_03874 product entericidin B 4088942 4088817 CDS gene ecnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1562 locus_tag OGMAPBJC_03875 product entericidin A, antidote to lipoprotein entericidin B 4089560 4088994 CDS gene yeiP_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12035-MONOMER locus_tag OGMAPBJC_03876 product putative dehydrogenase, NAD-dependent 4089602 4090630 CDS gene epmB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7836-MONOMER locus_tag OGMAPBJC_03877 product lysine 2,3-aminomutase 4091025 4091894 CDS gene yjeJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7835-MONOMER locus_tag OGMAPBJC_03878 product putative protein 4092440 4092087 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7834-MONOMER locus_tag OGMAPBJC_03879 note conserved protein product hypothetical protein 4094224 4092578 CDS gene groL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10599-MONOMER locus_tag OGMAPBJC_03880 product GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein 4094561 4094268 CDS gene groS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10600-MONOMER locus_tag OGMAPBJC_03881 product GroES, chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase activity 4094837 4096093 CDS gene yjeH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:B4141-MONOMER locus_tag OGMAPBJC_03882 product YjeH APC transporter 4096585 4096109 CDS gene fxsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7832-MONOMER locus_tag OGMAPBJC_03883 product inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7 4096922 4098358 CDS EC_number 4.3.1.1 gene aspA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPARTASE-MONOMER locus_tag OGMAPBJC_03884 product aspartate ammonia-lyase 4098476 4099777 CDS gene dcuA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DCUA-MONOMER locus_tag OGMAPBJC_03885 product dicarboxylate transporter DcuA 4099893 4100231 CDS gene cutA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12177-MONOMER locus_tag OGMAPBJC_03886 product copper binding protein CutA 4100207 4101904 CDS EC_number 1.8.1.8 db_xref COG:COG4232 gene dsbD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P36655 locus_tag OGMAPBJC_03887 product Thiol:disulfide interchange protein DsbD 4101941 4102516 CDS gene yjdC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12176-MONOMER locus_tag OGMAPBJC_03888 product putative transcriptional regulator 4102623 4102698 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_03889 product tRNA-Phe(gaa) 4103821 4102991 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7777-MONOMER locus_tag OGMAPBJC_03890 note IS150 conserved protein InsB product hypothetical protein 4104111 4103848 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:IS1222 locus_tag OGMAPBJC_03891 product IS3 family transposase IS1222 4104124 4104738 CDS gene yjdL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJDL-MONOMER locus_tag OGMAPBJC_03892 product dipeptide:H+ symporter YjdL 4104975 4106492 CDS EC_number 6.1.1.6 gene lysU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LYSU-MONOMER locus_tag OGMAPBJC_03893 product lysyl-tRNA synthetase 4106784 4106611 CDS gene yjdO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2694 locus_tag OGMAPBJC_03894 product putative protein 4107108 4106812 CDS gene yjdK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7830-MONOMER locus_tag OGMAPBJC_03895 product putative protein 4107607 4107335 CDS gene yjdJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7829-MONOMER locus_tag OGMAPBJC_03896 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 4107849 4107619 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7828-MONOMER locus_tag OGMAPBJC_03897 note conserved protein product hypothetical protein 4108030 4109661 CDS EC_number 2.7.13.3 db_xref COG:COG3290 gene dcuS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEC8 locus_tag OGMAPBJC_03898 product Sensor histidine kinase DcuS 4109658 4110377 CDS db_xref COG:COG4565 gene dcuR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AD01 locus_tag OGMAPBJC_03899 product Transcriptional regulatory protein DcuR 4110948 4112288 CDS gene dcuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DCUB-MONOMER locus_tag OGMAPBJC_03900 product dicarboxylate transporter DcuB 4112366 4114012 CDS EC_number 4.2.1.2 gene fumB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUMB-MONOMER locus_tag OGMAPBJC_03901 product fumarase B monomer 4114135 4114764 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7825-MONOMER locus_tag OGMAPBJC_03902 note conserved inner membrane protein product hypothetical protein 4116312 4114903 CDS gene melB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MELB-MONOMER locus_tag OGMAPBJC_03903 product melibiose:H+/Na+/Li+ symporter 4117782 4116427 CDS EC_number 3.2.1.22 gene melA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALPHAGALACTOSID-MONOMER locus_tag OGMAPBJC_03904 product alpha-galactosidase monomer 4118065 4118973 CDS gene melR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00208 locus_tag OGMAPBJC_03905 product MelR DNA-binding transcriptional dual regulator 4119169 4121439 CDS EC_number 4.1.1.19 gene adiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGDECARBOXDEG-MONOMER locus_tag OGMAPBJC_03906 product Adi 4121764 4122525 CDS gene adiY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11966-MONOMER locus_tag OGMAPBJC_03907 product AdiY DNA-binding transcriptional activator 4122662 4123999 CDS gene adiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJDE-MONOMER locus_tag OGMAPBJC_03908 product AdiC arginine:agmatine antiporter 4124103 4125746 CDS gene eptA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11613-MONOMER locus_tag OGMAPBJC_03909 product putative metal-dependent hydrolase 4125743 4126411 CDS gene yedW_10 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_03910 product putative DNA-binding response regulator in two-component system with YedV 4126412 4127512 CDS EC_number 2.7.13.3 gene basS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P30844 locus_tag OGMAPBJC_03911 product Sensor protein BasS 4127577 4127488 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03912 product hypothetical protein 4129191 4127689 CDS gene proP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROP-MONOMER locus_tag OGMAPBJC_03913 product osmolyte:H+ symporter ProP 4130333 4129455 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7823-MONOMER locus_tag OGMAPBJC_03914 note conserved protein product hypothetical protein 4132558 4130330 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11210-MONOMER locus_tag OGMAPBJC_03915 note conserved protein with nucleoside triphosphate hydrolase domain product hypothetical protein 4132960 4133295 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10711-MONOMER locus_tag OGMAPBJC_03916 note conserved protein product hypothetical protein 4133655 4134098 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10712-MONOMER locus_tag OGMAPBJC_03917 note conserved protein product hypothetical protein 4134231 4135019 CDS EC_number 3.6.3.28 gene phnC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHNC-MONOMER locus_tag OGMAPBJC_03918 product phosphonate ABC transporter - ATP binding subunit 4135044 4136060 CDS gene phnD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHND-MONOMER locus_tag OGMAPBJC_03919 product phosphonate ABC transporter - periplasmic binding protein 4136166 4136945 CDS db_xref COG:COG3639 gene phnE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:A0QQ68 locus_tag OGMAPBJC_03920 product Phosphate-import permease protein PhnE 4136966 4137691 CDS gene phnF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10715-MONOMER locus_tag OGMAPBJC_03921 product PhnF predicted transcriptional regulator 4137692 4138144 CDS gene phnG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10716-MONOMER locus_tag OGMAPBJC_03922 product PhnG subunit of methylphosphonate degradation complex 4138141 4138725 CDS gene phnH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10717-MONOMER locus_tag OGMAPBJC_03923 product PhnH subunit of methylphosphonate degradation complex 4138725 4139789 CDS gene phnI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10718-MONOMER locus_tag OGMAPBJC_03924 product PhnI subunit of methylphosphonate degradation complex 4139782 4140627 CDS gene phnJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10719-MONOMER locus_tag OGMAPBJC_03925 product carbon-phosphorous lyase 4140624 4141382 CDS gene phnK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHNK-MONOMER locus_tag OGMAPBJC_03926 product putative carbon-phosphorous lyase subunit 4141493 4142173 CDS gene phnL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PHNL-MONOMER locus_tag OGMAPBJC_03927 product PhnL subunit of methylphosphonate degradation complex 4142170 4143306 CDS gene phnM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10722-MONOMER locus_tag OGMAPBJC_03928 product RPnTP hydrolase 4143306 4143863 CDS EC_number 2.7.4.23 gene phnN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10723-MONOMER locus_tag OGMAPBJC_03929 product ribose 1,5-bisphosphokinase 4143850 4144284 CDS gene phnO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10724-MONOMER locus_tag OGMAPBJC_03930 product putative acyltransferase with acyl-CoA N-acyltransferase domain protein 4144286 4145044 CDS gene phnP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10725-MONOMER locus_tag OGMAPBJC_03931 product 5-phospho-alpha-D-ribosyl 1,2-cyclic phosphate phosphodiesterase 4145520 4145191 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-1541 locus_tag OGMAPBJC_03932 note conserved protein product hypothetical protein 4146038 4145589 CDS EC_number 5.3.1.6 gene rpiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIB5PISOMB-MONOMER locus_tag OGMAPBJC_03933 product allose-6-phosphate isomerase / ribose-5-phosphate isomerase B monomer 4146397 4147287 CDS gene murR_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7262-MONOMER locus_tag OGMAPBJC_03934 product MurR-MurNAc-6-P 4147346 4148281 CDS gene alsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCX-MONOMER locus_tag OGMAPBJC_03935 product D-allose ABC transporter - periplasmic binding protein 4148408 4149940 CDS EC_number 3.6.3.17 gene alsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCW-MONOMER locus_tag OGMAPBJC_03936 product D-allose ABC transporter - ATP binding subunit 4149919 4150899 CDS gene alsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCV-MONOMER locus_tag OGMAPBJC_03937 product D-allose ABC transporter - membrane subunit 4150910 4151605 CDS gene alsE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11957-MONOMER locus_tag OGMAPBJC_03938 product allulose-6-phosphate 3-epimerase 4151589 4152518 CDS EC_number 2.7.1.55 gene alsK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11956-MONOMER locus_tag OGMAPBJC_03939 product D-allose kinase 4152791 4154776 CDS gene yjcS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11955-MONOMER locus_tag OGMAPBJC_03940 product putative alkyl sulfatase 4154985 4155260 CDS gene ytcA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2830 locus_tag OGMAPBJC_03941 product hypothetical protein 4155279 4156310 CDS gene sdsR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11954-MONOMER locus_tag OGMAPBJC_03942 product SdsRQP multidrug efflux transport system - predicted membrane fusion protein 4156310 4158361 CDS gene sdsQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCQ-MONOMER locus_tag OGMAPBJC_03943 product SdsRQP multidrug efflux transport system - uncharacterised component 4158358 4159824 CDS gene sdsP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11952-MONOMER locus_tag OGMAPBJC_03944 product SdsRQP multidrug efflux transport system - predicted outer membrane factor 4160022 4160441 CDS EC_number 1.2.1.2 gene fdhF_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FORMATEDEHYDROGH-MONOMER locus_tag OGMAPBJC_03945 product formate dehydrogenase H 4160490 4162169 CDS EC_number 1.2.1.2 gene fdhF_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FORMATEDEHYDROGH-MONOMER locus_tag OGMAPBJC_03946 product formate dehydrogenase H 4162263 4162952 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11951-MONOMER locus_tag OGMAPBJC_03947 note conserved protein product hypothetical protein 4164795 4163482 CDS gene gltP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLTP-MONOMER locus_tag OGMAPBJC_03948 product glutamate / aspartate : H+ symporter GltP 4165733 4165137 CDS gene nrfG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11950-MONOMER locus_tag OGMAPBJC_03949 product NrfG 4166113 4165730 CDS gene nrfF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11949-MONOMER locus_tag OGMAPBJC_03950 product activator of formate-dependent nitrite reductase complex 4167713 4166106 CDS gene nrfE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11948-MONOMER locus_tag OGMAPBJC_03951 product formate-dependent nitrite reductase; possible assembly function 4168800 4167844 CDS gene nrfD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NRFD-MONOMER locus_tag OGMAPBJC_03952 product formate dependent nitrate reductase - NrfD subunit 4169468 4168797 CDS gene nrfC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NRFC-MONOMER locus_tag OGMAPBJC_03953 product formate-dependent nitrite reductase, 4Fe-4S subunit 4170031 4169465 CDS gene nrfB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYTOCHROMEC-MONOMER locus_tag OGMAPBJC_03954 product formate-dependent nitrite reductase - penta-heme cytochrome c 4171512 4170076 CDS EC_number 1.7.2.2 gene nrfA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CYTOCHROMEC552-MONOMER locus_tag OGMAPBJC_03955 product formate dependent nitrite reductase - NrfA subunit 4171905 4173863 CDS EC_number 6.2.1.1 gene acs inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACS-MONOMER locus_tag OGMAPBJC_03956 product acetyl-CoA synthetase (AMP-forming) 4174063 4174377 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCH-MONOMER locus_tag OGMAPBJC_03957 note conserved inner membrane protein product hypothetical protein 4174374 4176023 CDS gene actP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCG-MONOMER locus_tag OGMAPBJC_03958 product acetate / glycolate transporter 4176201 4177493 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11941-MONOMER locus_tag OGMAPBJC_03959 note conserved protein product hypothetical protein 4179296 4177647 CDS gene yjcE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YJCE-MONOMER locus_tag OGMAPBJC_03960 product YjcE CPA1 transporter 4180796 4179447 CDS gene yjcD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11939-MONOMER locus_tag OGMAPBJC_03961 product putative permease 4181805 4181341 CDS gene soxR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD04132 locus_tag OGMAPBJC_03962 product SoxR DNA-binding transcriptional dual regulator 4181891 4182214 CDS gene soxS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00406 locus_tag OGMAPBJC_03963 product SoxS DNA-binding transcriptional dual regulator 4183803 4182217 CDS gene yjcC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11938-MONOMER locus_tag OGMAPBJC_03964 product putative c-di-GMP-specific phosphodiesterase 4184233 4184514 CDS gene yjcB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11937-MONOMER locus_tag OGMAPBJC_03965 product putative inner membrane protein 4185149 4184613 CDS gene ssb inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10976-MONOMER locus_tag OGMAPBJC_03966 product ssDNA-binding protein 4185403 4188225 CDS gene uvrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11061-MONOMER locus_tag OGMAPBJC_03967 product excision nuclease subunit A 4188616 4188260 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11936-MONOMER locus_tag OGMAPBJC_03968 note conserved protein product hypothetical protein 4189036 4188620 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11935-MONOMER locus_tag OGMAPBJC_03969 note conserved protein product hypothetical protein 4189860 4189147 CDS EC_number 3.1.3.2 gene aphA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:APHA-MONOMER locus_tag OGMAPBJC_03970 product acid phosphatase/phosphotransferase monomer 4190262 4190465 CDS gene yjbS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2829 locus_tag OGMAPBJC_03971 product hypothetical protein 4192160 4190967 CDS EC_number 2.6.1.57 gene tyrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TYRB-MONOMER locus_tag OGMAPBJC_03972 product tyrosine aminotransferase 4193492 4192413 CDS EC_number 5.1.1.1 gene alr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ALARACEBIOSYN-MONOMER locus_tag OGMAPBJC_03973 product alanine racemase 1, PLP-binding, biosynthetic 4194960 4193545 CDS gene dnaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10236-MONOMER locus_tag OGMAPBJC_03974 product primosome 4195043 4196026 CDS EC_number 1.6.5.5 gene qor inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:QOR-MONOMER locus_tag OGMAPBJC_03975 product quinone oxidoreductase 4196434 4196192 CDS gene pspG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11933-MONOMER locus_tag OGMAPBJC_03976 product phage shock protein G 4197605 4196568 CDS gene dusA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11932-MONOMER locus_tag OGMAPBJC_03977 product tRNA-dihydrouridine synthase A 4198675 4197968 CDS gene yjbM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11931-MONOMER locus_tag OGMAPBJC_03978 product putative protein 4198953 4198699 CDS gene yjbL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11930-MONOMER locus_tag OGMAPBJC_03979 product putative protein 4199271 4199786 CDS gene zur inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11929-MONOMER locus_tag OGMAPBJC_03980 product Zur-Zn2+ DNA-binding transcriptional repressor 4200037 4199828 CDS gene yjbJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11928-MONOMER locus_tag OGMAPBJC_03981 product putative stress response protein 4201478 4200153 CDS gene dinF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DINF-MONOMER locus_tag OGMAPBJC_03982 product DinF MATE Transporter 4202159 4201551 CDS gene lexA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00205 locus_tag OGMAPBJC_03983 product LexA DNA-binding transcriptional repressor 4202637 4202269 CDS EC_number 2.7.1.107 gene dgkA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIACYLGLYKIN-MONOMER locus_tag OGMAPBJC_03984 product diacylglycerol kinase 4202808 4205231 CDS EC_number 2.3.1.15 gene plsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCEROL-3-P-ACYLTRANSFER-MONOMER locus_tag OGMAPBJC_03985 product glycerol-3-phosphate acyltransferase 4206258 4205386 CDS gene ubiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:4OHBENZOATE-OCTAPRENYLTRANSFER-MONOMER locus_tag OGMAPBJC_03986 product 4-hydroxybenzoate octaprenyltransferase 4206768 4206271 CDS EC_number 4.1.3.40 gene ubiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CHORPYRLY-MONOMER locus_tag OGMAPBJC_03987 product chorismate lyase 4208319 4206991 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11927-MONOMER locus_tag OGMAPBJC_03988 note conserved protein product hypothetical protein 4208571 4208377 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03989 product hypothetical protein 4208673 4208825 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03990 product hypothetical protein 4209720 4208800 CDS gene malM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10559-MONOMER locus_tag OGMAPBJC_03991 product maltose regulon periplasmic protein 4211303 4209963 CDS gene lamB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10528-MONOMER locus_tag OGMAPBJC_03992 product maltose outer membrane porin / phage lambda receptor protein 4212490 4211375 CDS EC_number 3.6.3.19 gene malK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALK-MONOMER locus_tag OGMAPBJC_03993 product maltose ABC transporter - ATP binding subunit 4212667 4212762 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_03994 product hypothetical protein 4212855 4214045 CDS gene malE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALE-MONOMER locus_tag OGMAPBJC_03995 product maltose ABC transporter - periplasmic binding protein 4214199 4215743 CDS gene malF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALF-MONOMER locus_tag OGMAPBJC_03996 product maltose ABC transporter - membrane subunit 4215758 4216648 CDS gene malG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALG-MONOMER locus_tag OGMAPBJC_03997 product maltose ABC transporter - membrane subunit 4217020 4218495 CDS gene xylE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:XYLE-MONOMER locus_tag OGMAPBJC_03998 product xylose:H+ symporter 4218949 4218539 CDS gene psiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11209-MONOMER locus_tag OGMAPBJC_03999 product putative phosphate starvation-inducible protein 4221640 4219544 CDS gene yjbH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11926-MONOMER locus_tag OGMAPBJC_04000 product putative porin 4222377 4221640 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11925-MONOMER locus_tag OGMAPBJC_04001 note conserved protein product hypothetical protein 4223012 4222374 CDS gene yjbF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11924-MONOMER locus_tag OGMAPBJC_04002 product putative lipoprotein 4223369 4223127 CDS gene yjbE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11923-MONOMER locus_tag OGMAPBJC_04003 product putative protein 4225530 4223881 CDS EC_number 5.3.1.9 gene pgi inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PGLUCISOM locus_tag OGMAPBJC_04004 product phosphoglucose isomerase 4226055 4227404 CDS EC_number 2.7.2.4 gene lysC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPKINIII-MONOMER locus_tag OGMAPBJC_04005 product aspartate kinase III 4227656 4227928 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11922-MONOMER locus_tag OGMAPBJC_04006 note conserved protein product hypothetical protein 4228933 4228061 CDS gene rluF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11921-MONOMER locus_tag OGMAPBJC_04007 product 23S rRNA pseudouridine 2604 synthase 4229145 4229834 CDS gene pepE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11920-MONOMER locus_tag OGMAPBJC_04008 product peptidase E, a dipeptidase where amino-terminal residue is aspartate 4231555 4229924 CDS gene yjbB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11919-MONOMER locus_tag OGMAPBJC_04009 product putative inorganic phosphate export protein 4235458 4231775 CDS EC_number 2.1.1.13 gene metH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HOMOCYSMETB12-MONOMER locus_tag OGMAPBJC_04010 product cobalamin-dependent methionine synthase 4235658 4236482 CDS gene iclR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD04099 locus_tag OGMAPBJC_04011 product IclR transcriptional repressor 4236799 4238373 CDS gene arpA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11208-MONOMER locus_tag OGMAPBJC_04012 product regulator of acetyl CoA synthetase 4240078 4238342 CDS EC_number 2.7.11.5 gene aceK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ICITDEHASE-KIN-PHOSPHA locus_tag OGMAPBJC_04013 product isocitrate dehydrogenase phosphatase / isocitrate dehydrogenase kinase 4241663 4240359 CDS EC_number 4.1.3.1 gene aceA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ISOCIT-LYASE-MONOMER locus_tag OGMAPBJC_04014 product isocitrate lyase monomer 4243294 4241693 CDS EC_number 2.3.3.9 gene aceB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MALATE-SYNTHASE locus_tag OGMAPBJC_04015 product malate synthase A 4244492 4243563 CDS EC_number 2.3.1.46 gene metA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HOMSUCTRAN-MONOMER locus_tag OGMAPBJC_04016 product homoserine O-succinyltransferase 4244649 4245092 CDS gene yjaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11207-MONOMER locus_tag OGMAPBJC_04017 product putative acetyltransferase 4245324 4245214 rRNA locus_tag OGMAPBJC_04018 product 5S ribosomal RNA score 1.9e-11 4248323 4245423 rRNA locus_tag OGMAPBJC_04019 product 23S ribosomal RNA score 0 4248594 4248519 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04020 product tRNA-Glu(ttc) 4250218 4248681 rRNA locus_tag OGMAPBJC_04021 product 16S ribosomal RNA score 0 4250838 4252427 CDS EC_number 3.5.4.10 gene purH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:AICARTRANSIMPCYCLO-CPLX locus_tag OGMAPBJC_04022 product AICAR transformylase / IMP cyclohydrolase 4252439 4253728 CDS EC_number 6.3.4.13 gene purD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCRIBONUCSYN-MONOMER locus_tag OGMAPBJC_04023 product phosphoribosylamine-glycine ligase 4255050 4253725 CDS db_xref COG:COG2204 gene zraR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P14375 locus_tag OGMAPBJC_04024 product Transcriptional regulatory protein ZraR 4256423 4255047 CDS EC_number 2.7.13.3 gene zraS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P14377 locus_tag OGMAPBJC_04025 product Sensor protein ZraS 4256661 4257080 CDS gene zraP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11918-MONOMER locus_tag OGMAPBJC_04026 product zinc homeostasis protein 4257717 4257082 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11917-MONOMER locus_tag OGMAPBJC_04027 note conserved protein product hypothetical protein 4258062 4257790 CDS gene hupA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10466-MONOMER locus_tag OGMAPBJC_04028 product transcriptional dual regulator HU-alpha (HU-2) 4258839 4258249 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11916-MONOMER locus_tag OGMAPBJC_04029 note conserved protein product hypothetical protein 4259553 4258882 CDS EC_number 3.1.21.7 gene nfi inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11915-MONOMER locus_tag OGMAPBJC_04030 product endonuclease V (deoxyinosine 3'-endonuclease) 4260627 4259563 CDS EC_number 4.1.1.37 gene hemE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UROGENDECARBOX-MONOMER locus_tag OGMAPBJC_04031 product uroporphyrinogen decarboxylase 4261440 4260667 CDS EC_number 3.6.1.22 gene nudC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11702-MONOMER locus_tag OGMAPBJC_04032 product NADH pyrophosphatase 4261535 4262011 CDS gene rsd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11738-MONOMER locus_tag OGMAPBJC_04033 product stationary phase protein, binds sigma 70 RNA polymerase subunit 4262245 4264140 CDS gene thiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIC-MONOMER locus_tag OGMAPBJC_04034 product thiamin biosynthesis protein ThiC 4264140 4264775 CDS EC_number 2.5.1.3 gene thiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIE-MONOMER locus_tag OGMAPBJC_04035 product thiamine phosphate synthase 4264768 4265523 CDS gene thiF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIF-MONOMER locus_tag OGMAPBJC_04036 product sulfur carrier protein ThiS adenylyltransferase 4265507 4265707 CDS db_xref COG:COG2104 gene thiS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:O32583 locus_tag OGMAPBJC_04037 product Sulfur carrier protein ThiS 4265709 4266479 CDS gene thiG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIG-MONOMER locus_tag OGMAPBJC_04038 product thiazole synthase 4266476 4267609 CDS gene thiH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THIH-MONOMER locus_tag OGMAPBJC_04039 product tyrosine lyase 4272074 4267851 CDS EC_number 2.7.7.6 gene rpoC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOC-MONOMER locus_tag OGMAPBJC_04040 product RNA polymerase, beta' subunit 4276179 4272151 CDS EC_number 2.7.7.6 gene rpoB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RPOB-MONOMER locus_tag OGMAPBJC_04041 product RNA polymerase, beta subunit 4276864 4276499 CDS db_xref COG:COG0222 gene rplL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0A7K2 locus_tag OGMAPBJC_04042 product 50S ribosomal protein L7/L12 4277428 4276931 CDS gene rplJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10871-MONOMER locus_tag OGMAPBJC_04043 product 50S ribosomal subunit protein L10 4278545 4277841 CDS gene rplA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10864-MONOMER locus_tag OGMAPBJC_04044 product 50S ribosomal subunit protein L1 4278977 4278549 CDS gene rplK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10872-MONOMER locus_tag OGMAPBJC_04045 product 50S ribosomal subunit protein L11 4279681 4279136 CDS gene nusG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10667-MONOMER locus_tag OGMAPBJC_04046 product transcription termination factor NusG 4280066 4279683 CDS gene secE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SECE locus_tag OGMAPBJC_04047 product Sec Translocation Complex 4281480 4280296 CDS gene tufB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11037-MONOMER locus_tag OGMAPBJC_04048 product elongation factor Tu 4281670 4281595 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04049 product tRNA-Thr(ggt) 4281751 4281677 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04050 product tRNA-Gly(tcc) 4281952 4281868 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04051 product tRNA-Tyr(gta) 4282036 4281961 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04052 product tRNA-Thr(tgt) 4282422 4283348 CDS EC_number 2.7.1.33 gene coaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PANTOTHENATE-KIN-MONOMER locus_tag OGMAPBJC_04053 product pantothenate kinase monomer 4284342 4283377 CDS EC_number 6.3.4.15 gene birA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BIOTINLIG-MONOMER locus_tag OGMAPBJC_04054 product bifunctional biotin-[acetyl-CoA-carboxylase] ligase and transcriptional repressor 4285367 4284339 CDS EC_number 1.1.1.158 gene murB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPNACETYLMURAMATEDEHYDROG-MONOMER locus_tag OGMAPBJC_04055 product UDP-N-acetylenolpyruvoylglucosamine reductase 4285615 4285505 rRNA locus_tag OGMAPBJC_04056 product 5S ribosomal RNA score 8e-12 4288614 4285714 rRNA locus_tag OGMAPBJC_04057 product 23S ribosomal RNA score 0 4288885 4288810 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04058 product tRNA-Glu(ttc) 4290509 4288972 rRNA locus_tag OGMAPBJC_04059 product 16S ribosomal RNA score 0 4291743 4290886 CDS EC_number 5.1.1.3 gene murI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLUTRACE-MONOMER locus_tag OGMAPBJC_04060 product glutamate racemase 4293532 4291688 CDS gene btuB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10126-MONOMER locus_tag OGMAPBJC_04061 product vitamin B12 / E colicin / bacteriophage BF23 outer membrane porin BtuB 4293901 4295001 CDS EC_number 2.1.1.35 gene trmA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11022-MONOMER locus_tag OGMAPBJC_04062 product tRNA m5U54 methyltransferase 4295400 4295041 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11395-MONOMER locus_tag OGMAPBJC_04063 note conserved inner membrane protein product hypothetical protein 4296104 4295400 CDS gene fabR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11394-MONOMER locus_tag OGMAPBJC_04064 product FabR DNA-binding transcriptional repressor 4296381 4297781 CDS EC_number 1.6.1.1 gene sthA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDHA-MONOMER locus_tag OGMAPBJC_04065 product pyridine nucleotide transhydrogenase 4298681 4297764 CDS gene oxyR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00214 locus_tag OGMAPBJC_04066 product OxyR DNA-binding transcriptional dual regulator 4300321 4298948 CDS EC_number 4.3.2.1 gene argH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARGSUCCINLYA-MONOMER locus_tag OGMAPBJC_04067 product argininosuccinate lyase 4301158 4300382 CDS EC_number 2.7.2.8 gene argB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETYLGLUTKIN-MONOMER locus_tag OGMAPBJC_04068 product acetylglutamate kinase monomer 4302170 4301166 CDS EC_number 1.2.1.38 gene argC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:N-ACETYLGLUTPREDUCT-MONOMER locus_tag OGMAPBJC_04069 product N-acetylglutamylphosphate reductase 4303513 4302380 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:ISfinder:ISHhu4 locus_tag OGMAPBJC_04070 product IS200/IS605 family transposase ISHhu4 4304013 4305164 CDS EC_number 3.5.1.16 gene argE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ACETYLORNDEACET-MONOMER locus_tag OGMAPBJC_04071 product acetylornithine deacetylase 4305516 4308167 CDS EC_number 4.1.1.31 gene ppc inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PEPCARBOX-MONOMER locus_tag OGMAPBJC_04072 product phosphoenolpyruvate carboxylase 4308350 4310083 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11914-MONOMER locus_tag OGMAPBJC_04073 note conserved inner membrane protein product hypothetical protein 4310298 4311149 CDS gene yijO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11913-MONOMER locus_tag OGMAPBJC_04074 product putative DNA-binding transcriptional regulator 4311477 4311136 CDS EC_number 2.7.1.69 gene frwD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11912-MONOMER locus_tag OGMAPBJC_04075 product PTS system fructose-like IIB component 2 4312357 4311479 CDS EC_number 1.97.1.4 gene pflC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11911-MONOMER locus_tag OGMAPBJC_04076 product putative pyruvate formate lyase 2 activating enzyme 4314620 4312323 CDS EC_number 2.3.1.54 gene pflD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11910-MONOMER locus_tag OGMAPBJC_04077 product formate acetyltransferase 2 4314991 4314671 CDS EC_number 2.7.1.69 gene frwB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRWB-MONOMER locus_tag OGMAPBJC_04078 product PTS permease - unknown specificity 4316085 4315006 CDS gene frwC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRWC-MONOMER locus_tag OGMAPBJC_04079 product PTS permease - unknown specificity 4316394 4318895 CDS EC_number 2.7.3.9 gene ptsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11906-MONOMER locus_tag OGMAPBJC_04080 product fused predicted PTS enzymes: HPr component / enzyme I component / enzyme IIA component 4318907 4319569 CDS gene fsaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11905-MONOMER locus_tag OGMAPBJC_04081 product fructose 6-phosphate aldolase 2 4319580 4320683 CDS EC_number 1.1.1.6 gene gldA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCDEH-MONOMER locus_tag OGMAPBJC_04082 product L-1,2-propanediol dehydrogenase / glycerol dehydrogenase 4320959 4321576 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11903-MONOMER locus_tag OGMAPBJC_04083 note conserved protein product hypothetical protein 4322508 4321603 CDS gene yijE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11902-MONOMER locus_tag OGMAPBJC_04084 product putative permease 4324782 4322602 CDS gene katG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HYDROPEROXIDI-MONOMER locus_tag OGMAPBJC_04085 product hydroperoxidase I 4326000 4325110 CDS EC_number 1.5.1.20 gene metF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:METHYLENETHFREDUCT-MONOMER locus_tag OGMAPBJC_04086 product 5,10-methylenetetrahydrofolate reductase 4328781 4326349 CDS EC_number 1.1.1.3 gene metL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASPKINIIHOMOSERDEHYDROGII-MONOMER locus_tag OGMAPBJC_04087 product aspartate kinase / homoserine dehydrogenase 4329944 4328784 CDS EC_number 2.5.1.48 gene metB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:O-SUCCHOMOSERLYASE-MONOMER locus_tag OGMAPBJC_04088 product O-succinylhomoserine lyase / O-succinylhomoserine(thiol)-lyase 4330221 4330538 CDS gene metJ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD04032 locus_tag OGMAPBJC_04089 product MetJ transcriptional repressor 4330722 4331006 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11882-MONOMER locus_tag OGMAPBJC_04090 note conserved hypothetical protein of the NlpC/P60 peptidase superfamily product hypothetical protein 4331602 4331390 CDS gene rpmE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10889-MONOMER locus_tag OGMAPBJC_04091 product 50S ribosomal subunit protein L31 4331805 4334003 CDS gene priA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10763-MONOMER locus_tag OGMAPBJC_04092 product primosome factor N' 4334159 4335184 CDS gene cytR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD04028 locus_tag OGMAPBJC_04093 product CytR-cytidine 4335381 4336235 CDS gene ftsN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11529-MONOMER locus_tag OGMAPBJC_04094 product essential cell division protein FtsN 4336328 4336858 CDS gene hslV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11676-MONOMER locus_tag OGMAPBJC_04095 product peptidase component of the HslVU protease 4336868 4338199 CDS gene hslU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11881-MONOMER locus_tag OGMAPBJC_04096 product ATPase component of the HslVU protease 4338266 4339192 CDS gene menA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DMK-MONOMER locus_tag OGMAPBJC_04097 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase 4339285 4339770 CDS gene rraA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11879-MONOMER locus_tag OGMAPBJC_04098 product ribonuclease E inhibitor protein 4340094 4339855 CDS gene zapB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11878-MONOMER locus_tag OGMAPBJC_04099 product cell division factor ZapB 4340525 4341370 CDS gene glpF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLPF-MONOMER locus_tag OGMAPBJC_04100 product glycerol channel GlpF 4341393 4342901 CDS EC_number 2.7.1.30 gene glpK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLYCEROL-KIN-MONOMER locus_tag OGMAPBJC_04101 product glycerol kinase 4343036 4344046 CDS EC_number 3.1.3.11 gene glpX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11517-MONOMER locus_tag OGMAPBJC_04102 product fructose 1,6-bisphosphatase II 4344143 4344889 CDS EC_number 1.18.1.2 gene fpr inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FLAVONADPREDUCT-MONOMER locus_tag OGMAPBJC_04103 product flavodoxin NADP+ reductase 4345322 4344894 CDS gene uspD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11877-MONOMER locus_tag OGMAPBJC_04104 product stress protein involved in resistance to UV irradiation 4345648 4345349 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11876-MONOMER locus_tag OGMAPBJC_04105 note conserved protein product hypothetical protein 4346300 4345860 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11875-MONOMER locus_tag OGMAPBJC_04106 note conserved inner membrane protein product hypothetical protein 4346401 4347000 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11874-MONOMER locus_tag OGMAPBJC_04107 note conserved protein product hypothetical protein 4347108 4347875 CDS EC_number 5.3.1.1 gene tpiA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TPI-MONOMER locus_tag OGMAPBJC_04108 product triose phosphate isomerase monomer 4348685 4347930 CDS EC_number 3.6.1.26 gene cdh inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CDPDIGLYPYPHOSPHA-MONOMER locus_tag OGMAPBJC_04109 product CDP-diglyceride hydrolase / CDP-diacylglycerol pyrophosphatase 4349781 4348792 CDS gene sbp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SBP-MONOMER locus_tag OGMAPBJC_04110 product sulfate / thiosulfate ABC transporter - periplasmic binding protein Sbp 4351063 4350101 CDS EC_number 2.7.1.11 gene pfkA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:6PFK-1-MONOMER locus_tag OGMAPBJC_04111 product 6-phosphofructokinase-1 monomer 4352146 4351244 CDS gene fieF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIIP-MONOMER locus_tag OGMAPBJC_04112 product Zn2+ / Fe2+ / Cd2+ efflux transporter FieF 4352795 4352295 CDS gene cpxP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7816-MONOMER locus_tag OGMAPBJC_04113 product regulator of the Cpx response and possible chaperone involved in resistance to extracytoplasmic stress 4352945 4353643 CDS gene yedW_11 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7057-MONOMER locus_tag OGMAPBJC_04114 product putative DNA-binding response regulator in two-component system with YedV 4353640 4355013 CDS EC_number 2.7.13.3 gene cpxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AE82 locus_tag OGMAPBJC_04115 product Sensor histidine kinase CpxA 4355793 4355119 CDS gene yiiM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11870-MONOMER locus_tag OGMAPBJC_04116 product protein involved in base analog detoxification 4356925 4355942 CDS gene kdgT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KDGT-MONOMER locus_tag OGMAPBJC_04117 product 2-dehydro-3-deoxy-D-gluconate:H+ symporter 4357805 4357185 CDS EC_number 1.15.1.1 gene sodA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SUPEROX-DISMUTMN-MONOMER locus_tag OGMAPBJC_04118 product superoxide dismutase (Mn) 4358090 4359124 CDS gene rhaT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RHAT-MONOMER locus_tag OGMAPBJC_04119 product rhamnose / lyxose:H+ symporter 4360059 4359121 CDS gene rhaR_3 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00222 locus_tag OGMAPBJC_04120 product RhaR transcriptional activator 4360879 4360043 CDS gene rhaS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00221 locus_tag OGMAPBJC_04121 product RhaS-L-rhamnose DNA-binding transcriptional activator 4361167 4362636 CDS EC_number 2.7.1.5 gene rhaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RHAMNULOKIN-MONOMER locus_tag OGMAPBJC_04122 product L-rhamnulose kinase 4362633 4363892 CDS EC_number 5.3.1.14 gene rhaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RHAMNISOM-MONOMER locus_tag OGMAPBJC_04123 product L-rhamnose isomerase 4364343 4365167 CDS EC_number 4.1.2.19 gene rhaD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RHAMNULPALDOL-MONOMER locus_tag OGMAPBJC_04124 product rhamnulose-1-phosphate aldolase monomer 4365177 4365491 CDS EC_number 5.1.3 gene rhaM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11865-MONOMER locus_tag OGMAPBJC_04125 product L-rhamnose mutarotase 4366926 4365532 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04126 product hypothetical protein 4367403 4367849 CDS gene frvA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRVA-MONOMER locus_tag OGMAPBJC_04127 product PTS permease - unknown specificity 4367860 4369311 CDS EC_number 2.7.1.69 gene frvB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FRVB-MONOMER locus_tag OGMAPBJC_04128 product PTS permease - unknown specificity 4369301 4370371 CDS gene frvX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11862-MONOMER locus_tag OGMAPBJC_04129 product frv operon protein 4370371 4372119 CDS gene frvR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11861-MONOMER locus_tag OGMAPBJC_04130 product FrvR predicted transcriptional regulator 4373224 4372169 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11860-MONOMER locus_tag OGMAPBJC_04131 note conserved protein product hypothetical protein 4374210 4373377 CDS gene fdhD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11859-MONOMER locus_tag OGMAPBJC_04132 product affects formate dehydrogenase-N 4374404 4374991 CDS EC_number 1.2.1.2 gene fdoG_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDOG-MONOMER locus_tag OGMAPBJC_04133 product formate dehydrogenase-O, alpha subunit 4375040 4377454 CDS EC_number 1.2.1.2 gene fdoG_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDOG-MONOMER locus_tag OGMAPBJC_04134 product formate dehydrogenase-O, alpha subunit 4377467 4378369 CDS gene fdoH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDOH-MONOMER locus_tag OGMAPBJC_04135 product formate dehydrogenase-O, beta subunit 4378366 4379001 CDS gene fdoI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FDOI-MONOMER locus_tag OGMAPBJC_04136 product formate dehydrogenase-O, gamma subunit 4378998 4379927 CDS gene fdhE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10284-MONOMER locus_tag OGMAPBJC_04137 product formate dehydrogenase formation protein 4380257 4380075 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04138 product hypothetical protein 4380499 4380257 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11855-MONOMER locus_tag OGMAPBJC_04139 note conserved protein product hypothetical protein 4380935 4380717 CDS gene yiiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11854-MONOMER locus_tag OGMAPBJC_04140 product putative transcriptional regulator 4381377 4381270 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04141 product hypothetical protein 4382729 4381788 CDS gene yiiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11853-MONOMER locus_tag OGMAPBJC_04142 product putative acetyltransferase 4383211 4382774 CDS gene dtd inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11852-MONOMER locus_tag OGMAPBJC_04143 product D-Tyr-tRNATyr deacylase 4384080 4383208 CDS gene yihY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11851-MONOMER locus_tag OGMAPBJC_04144 product putative inner membrane protein 4384673 4384074 CDS gene yihX inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11850-MONOMER locus_tag OGMAPBJC_04145 product alpha-D-glucose-1-phosphatase 4385557 4384772 CDS gene yihW inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11849-MONOMER locus_tag OGMAPBJC_04146 product putative DNA-binding transcriptional regulator 4386487 4385591 CDS gene yihV inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11848-MONOMER locus_tag OGMAPBJC_04147 product putative sugar kinase 4386655 4387551 CDS gene yihU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11847-MONOMER locus_tag OGMAPBJC_04148 product succinate semialdehyde reductase 4387575 4388453 CDS gene yihT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11846-MONOMER locus_tag OGMAPBJC_04149 product putative aldolase 4388470 4389711 CDS gene yihS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11845-MONOMER locus_tag OGMAPBJC_04150 product mannose isomerase 4389825 4390751 CDS gene yihR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11844-MONOMER locus_tag OGMAPBJC_04151 product putative aldose-1-epimerase 4390950 4392986 CDS EC_number 3.2.1.20 gene yihQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11843-MONOMER locus_tag OGMAPBJC_04152 product alpha-glucosidase 4393032 4394417 CDS gene yihP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIHP-MONOMER locus_tag OGMAPBJC_04153 product YihP GPH transporter 4394460 4395863 CDS gene yihO inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIHO-MONOMER locus_tag OGMAPBJC_04154 product YihO GPH transporter 4395931 4396623 CDS gene ompL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7814-MONOMER locus_tag OGMAPBJC_04155 product putative outer membrane porin L 4397979 4396714 CDS gene yihN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIHN-MONOMER locus_tag OGMAPBJC_04156 product YihN MFS transporter 4399061 4398081 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11839-MONOMER locus_tag OGMAPBJC_04157 note conserved protein product hypothetical protein 4399779 4399069 CDS gene yihL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11838-MONOMER locus_tag OGMAPBJC_04158 product YihL putative transcriptional regulator 4401819 4399996 CDS gene typA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11837-MONOMER locus_tag OGMAPBJC_04159 product protein possibly involved in ribosome structure or function 4402192 4403601 CDS EC_number 6.3.1.11 gene puuA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G6644-MONOMER locus_tag OGMAPBJC_04160 product glutamate-putrescine ligase 4403775 4404824 CDS gene glnL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROTEIN-NRII locus_tag OGMAPBJC_04161 product NtrB 4404836 4406245 CDS db_xref COG:COG2204 gene glnG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AFB8 locus_tag OGMAPBJC_04162 product DNA-binding transcriptional regulator NtrC 4406357 4406467 CDS gene yshB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2884 locus_tag OGMAPBJC_04163 product small predicted membrane protein 4408030 4406657 CDS EC_number 1.3.99.22 gene hemN inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HEMN-MONOMER locus_tag OGMAPBJC_04164 product coproporphyrinogen III dehydrogenase 4408728 4408219 CDS gene yihI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11835-MONOMER locus_tag OGMAPBJC_04165 product GAP-like protein that activates GTPase activity of Der 4409310 4409942 CDS gene yihA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11203-MONOMER locus_tag OGMAPBJC_04166 product cell division protein; predicted checkpoint GTPase 4413110 4410324 CDS EC_number 2.7.7.7 gene polA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10746-MONOMER locus_tag OGMAPBJC_04167 product DNA polymerase I, 5' --> 3' polymerase, 5' --> 3' and 3' --> 5' exonuclease 4413169 4413354 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04168 product hypothetical protein 4413474 4414406 CDS gene yihG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11833-MONOMER locus_tag OGMAPBJC_04169 product putative endonuclease 4415877 4414447 CDS gene yihF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11832-MONOMER locus_tag OGMAPBJC_04170 product putative GTP-binding protein 4416658 4416032 CDS db_xref COG:COG0526 gene dsbA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AEG4 locus_tag OGMAPBJC_04171 product Thiol:disulfide interchange protein DsbA 4417661 4416675 CDS gene rdoA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11831-MONOMER locus_tag OGMAPBJC_04172 product serine/threonine protein kinase 4418007 4417738 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11830-MONOMER locus_tag OGMAPBJC_04173 note conserved protein product hypothetical protein 4418077 4418661 CDS gene mobA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11829-MONOMER locus_tag OGMAPBJC_04174 product molybdopterin guanine dinucleotide synthase 4418643 4419170 CDS gene mobB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11828-MONOMER locus_tag OGMAPBJC_04175 product molybdopterin-guanine dinucleotide biosynthesis protein B 4419555 4419445 rRNA locus_tag OGMAPBJC_04176 product 5S ribosomal RNA score 7e-12 4422554 4419654 rRNA locus_tag OGMAPBJC_04177 product 23S ribosomal RNA score 0 4422815 4422740 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04178 product tRNA-Ala(tgc) 4422934 4422858 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04179 product tRNA-Ile(gat) 4424541 4423004 rRNA locus_tag OGMAPBJC_04180 product 16S ribosomal RNA score 0 4425467 4424922 CDS gene hemG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PROTOPORGENOXI-MONOMER locus_tag OGMAPBJC_04181 product protoporphyrinogen oxidase 4426930 4425479 CDS gene trkH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRKH-MONOMER locus_tag OGMAPBJC_04182 product K+ transporter TrkH 4427583 4426969 CDS gene yigZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11484-MONOMER locus_tag OGMAPBJC_04183 product putative elongation factor 4428914 4427583 CDS gene pepQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10698-MONOMER locus_tag OGMAPBJC_04184 product proline dipeptidase 4429104 4431293 CDS EC_number 5.3.3.8 gene fadB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FADB-MONOMER locus_tag OGMAPBJC_04185 product dodecenoyl-CoA delta-isomerase, enoyl-CoA hydratase, 3-hydroxybutyryl-CoA epimerase, 3-hydroxyacyl-CoA dehydrogenase 4431303 4432466 CDS EC_number 2.3.1.16 gene fadA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FADA-MONOMER locus_tag OGMAPBJC_04186 product 3-ketoacyl-CoA thiolase 4433548 4432847 CDS EC_number 1.16.1.3 gene fre inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FMNREDUCT-MONOMER locus_tag OGMAPBJC_04187 product riboflavin reductase [NAD(P)H] / FMN reductase 4435087 4433594 CDS gene ubiD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11396-MONOMER locus_tag OGMAPBJC_04188 product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase monomer 4435254 4435742 CDS gene rfaH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10839-MONOMER locus_tag OGMAPBJC_04189 product RfaH transcriptional antiterminator 4436521 4435739 CDS gene tatD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11481-MONOMER locus_tag OGMAPBJC_04190 product Tat-linked protein quality control 4437339 4436563 CDS gene tatC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11479-MONOMER locus_tag OGMAPBJC_04191 product TatABCE protein export complex 4437857 4437342 CDS gene tatB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7808-MONOMER locus_tag OGMAPBJC_04192 product TatABCE protein export complex 4438130 4437861 CDS gene tatA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TATA locus_tag OGMAPBJC_04193 product TatABCE protein export complex 4439849 4438209 CDS gene ubiB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:2-OCTAPRENYLPHENOL-HYDROX-MONOMER locus_tag OGMAPBJC_04194 product 2-octaprenylphenol hydroxylase 4440451 4439846 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11474-MONOMER locus_tag OGMAPBJC_04195 note conserved protein product hypothetical protein 4441220 4440465 CDS gene ubiE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:2-OCTAPRENYL-METHOXY-BENZOQ-METH-MONOMER locus_tag OGMAPBJC_04196 product bifunctional 2-octaprenyl-6-methoxy-1,4-benzoquinone methylase and S-adenosylmethionine:2-DMK methyltransferase 4442742 4441315 CDS gene rmuC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11472-MONOMER locus_tag OGMAPBJC_04197 product putative recombination limiting protein 4443644 4442883 CDS EC_number 2.4.2.3 gene udp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:URPHOS-MONOMER locus_tag OGMAPBJC_04198 product uridine phosphorylase 4443906 4444721 CDS EC_number 3.1.1.45 gene ysgA_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7804-MONOMER locus_tag OGMAPBJC_04199 product putative hydrolase 4447022 4444761 CDS EC_number 2.1.1.14 gene metE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HOMOCYSMET-MONOMER locus_tag OGMAPBJC_04200 product cobalamin-independent homocysteine transmethylase 4447259 4448212 CDS gene metR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03938 locus_tag OGMAPBJC_04201 product MetR-L-homocysteine 4448999 4448100 CDS gene yigM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11471-MONOMER locus_tag OGMAPBJC_04202 product putative inner membrane protein 4449875 4449075 CDS EC_number 3.1.3.23 gene yigL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11470-MONOMER locus_tag OGMAPBJC_04203 product sugar phosphatase 4450905 4449883 CDS EC_number 3.1.1.5 gene pldB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10739-MONOMER locus_tag OGMAPBJC_04204 product lysophospholipase L(2) 4451016 4451636 CDS gene rhtB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RHTB-MONOMER locus_tag OGMAPBJC_04205 product homoserine / homoserine lactone efflux transporter 4452318 4451698 CDS gene rhtC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RHTC-MONOMER locus_tag OGMAPBJC_04206 product RhtC threonine Rht Transporter 4454217 4452382 CDS gene recQ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10833-MONOMER locus_tag OGMAPBJC_04207 product ATP-dependent DNA helicase 4455213 4454344 CDS EC_number 3.1.1.4 gene pldA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-341 locus_tag OGMAPBJC_04208 product outer membrane phospholipase 4455378 4455845 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11467-MONOMER locus_tag OGMAPBJC_04209 note conserved protein product hypothetical protein 4455897 4456787 CDS gene rarD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11466-MONOMER locus_tag OGMAPBJC_04210 product putative chloramphenicol resistance permease 4456882 4457262 CDS gene yigG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11465-MONOMER locus_tag OGMAPBJC_04211 product inner membrane protein 4457276 4457656 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11464-MONOMER locus_tag OGMAPBJC_04212 note conserved inner membrane protein product hypothetical protein 4458649 4457699 CDS gene corA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:CORA-MONOMER locus_tag OGMAPBJC_04213 product Ni2+ / Co2+ / Mg2+ transporter 4459019 4459783 CDS gene yigE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11462-MONOMER locus_tag OGMAPBJC_04214 product putative protein 4462092 4459930 CDS gene uvrD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11064-MONOMER locus_tag OGMAPBJC_04215 product DNA-dependent ATPase I and helicase II 4462892 4462176 CDS gene yigB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11202-MONOMER locus_tag OGMAPBJC_04216 product FMN phosphatase 4463788 4462892 CDS gene xerC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11069-MONOMER locus_tag OGMAPBJC_04217 product site-specific recombinase, acts on cer sequence of ColE1, effects chromosome segregation at cell division 4464492 4463785 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11201-MONOMER locus_tag OGMAPBJC_04218 note conserved protein product hypothetical protein 4465313 4464489 CDS EC_number 5.1.1.7 gene dapF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIAMINOPIMEPIM-MONOMER locus_tag OGMAPBJC_04219 product diaminopimelate epimerase 4465553 4465350 CDS gene yifL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:MONOMER0-2693 locus_tag OGMAPBJC_04220 product putative lipoprotein 4466016 4466336 CDS gene cyaY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11653-MONOMER locus_tag OGMAPBJC_04221 product frataxin, iron-binding and oxidizing protein 4468922 4466376 CDS EC_number 4.6.1.1 gene cyaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ADENYLATECYC-MONOMER locus_tag OGMAPBJC_04222 product adenylate cyclase 4469288 4470250 CDS EC_number 2.5.1.61 gene hemC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:OHMETHYLBILANESYN-MONOMER locus_tag OGMAPBJC_04223 product hydroxymethylbilane synthase 4470247 4470987 CDS EC_number 4.2.1.75 gene hemD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UROGENIIISYN-MONOMER locus_tag OGMAPBJC_04224 product uroporphyrinogen III synthase 4471009 4472190 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:HEMX-MONOMER locus_tag OGMAPBJC_04225 note conserved protein product hypothetical protein 4472193 4473389 CDS gene hemY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10434-MONOMER locus_tag OGMAPBJC_04226 product putative protoheme IX synthesis protein 4474068 4475723 CDS EC_number 3.1.6.1 gene aslA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ARYLSULFAT-MONOMER locus_tag OGMAPBJC_04227 product arylsulfatase 4477117 4475882 CDS gene aslB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10090-MONOMER locus_tag OGMAPBJC_04228 product putative anaerobic sulfatase maturation enzyme 4477340 4477264 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04229 product tRNA-Pro(tgg) 4477469 4477383 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04230 product tRNA-Leu(cag) 4477565 4477490 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04231 product tRNA-His(gtg) 4477700 4477624 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04232 product tRNA-Arg(ccg) 4479188 4477803 CDS gene yifK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIFK-MONOMER locus_tag OGMAPBJC_04233 product YifK APC transporter 4480119 4479379 CDS gene rffM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPMANACATRANS-MONOMER locus_tag OGMAPBJC_04234 product UDP-N-acetyl-D-mannosaminuronic acid transferase 4481474 4480122 CDS gene wzyE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:FUC4NACTRANS-MONOMER locus_tag OGMAPBJC_04235 product putative Wzy protein involved in ECA polysaccharide chain elongation 4482550 4481471 CDS gene rffT inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:G7800-MONOMER locus_tag OGMAPBJC_04236 product 4-acetamido-4,6-dideoxy-D-galactose transferase 4483797 4482547 CDS gene wzxE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11486-MONOMER locus_tag OGMAPBJC_04237 product lipid III flippase 4484929 4483799 CDS gene rffA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RFFTRANS-MONOMER locus_tag OGMAPBJC_04238 product dTDP-4-oxo-6-deoxy-D-glucose transaminase 4485608 4484934 CDS gene rffC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TDPFUCACTRANS-MONOMER locus_tag OGMAPBJC_04239 product dTDP-fucosamine acetyltransferase 4486467 4485586 CDS EC_number 2.7.7.24 gene rffH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPGLUCOSEPP2-MONOMER locus_tag OGMAPBJC_04240 product dTDP-glucose pyrophosphorylase 2 4487553 4486486 CDS EC_number 4.2.1.46 gene rffG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DTDPGLUCDEHYDRAT2-MONOMER locus_tag OGMAPBJC_04241 product dTDP-glucose 4,6-dehydratase 2 4488815 4487553 CDS EC_number 1.1.1 gene rffD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPMANNACADEHYDROG-MONOMER locus_tag OGMAPBJC_04242 product UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase 4489942 4488812 CDS EC_number 5.1.3.14 gene rffE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:UDPGLCNACEPIM-MONOMER locus_tag OGMAPBJC_04243 product UDP-N-acetylglucosamine-2-epimerase 4491044 4489998 CDS gene wzzE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11295-MONOMER locus_tag OGMAPBJC_04244 product Enterobacterial Common Antigen polysaccharide chain length modulation protein 4492159 4491056 CDS gene rfe inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:GLCNACPTRANS-MONOMER locus_tag OGMAPBJC_04245 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl transferase 4492389 4492171 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04246 product hypothetical protein 4493658 4492399 CDS gene rho inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10845-MONOMER locus_tag OGMAPBJC_04247 product transcription termination factor Rho monomer; polarity suppressor 4494314 4493985 CDS db_xref COG:COG0526 gene trxA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:UniProtKB:P0AA28 locus_tag OGMAPBJC_04248 product Thioredoxin 1 4494445 4495710 CDS gene rhlB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10844-MONOMER locus_tag OGMAPBJC_04249 product degradosome 4495844 4497328 CDS EC_number 3.6.1.40 gene gpp inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PPPGPPHYDRO-MONOMER locus_tag OGMAPBJC_04250 product guanosine-5'-triphosphate, 3'-diphosphate pyrophosphatase 4499396 4497375 CDS gene rep inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10837-MONOMER locus_tag OGMAPBJC_04251 product Rep helicase, a single-stranded DNA dependent ATPase 4499613 4500062 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04252 product hypothetical protein 4500261 4500542 CDS EC_number 5.2.1.8 gene ppiC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG12352-MONOMER locus_tag OGMAPBJC_04253 product peptidyl-prolyl cis-trans isomerase C (rotamase C) 4502063 4500588 CDS EC_number 1.1.1.86 gene ilvC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KETOLREDUCTOISOM-MONOMER locus_tag OGMAPBJC_04254 product acetohydroxy acid isomeroreductase 4502213 4503106 CDS gene ilvY inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00200 locus_tag OGMAPBJC_04255 product IlvY DNA-binding transcriptional dual regulator 4504702 4503158 CDS EC_number 4.3.1.19 gene ilvA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:THREDEHYDSYN-MONOMER locus_tag OGMAPBJC_04256 product threonine deaminase 4506555 4504705 CDS EC_number 4.2.1.9 gene ilvD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:DIHYDROXYACIDDEHYDRAT-MONOMER locus_tag OGMAPBJC_04257 product dihydroxy acid dehydratase 4507549 4506620 CDS EC_number 2.6.1.42 gene ilvE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BRANCHED-CHAINAMINOTRANSFER-MONOMER locus_tag OGMAPBJC_04258 product branched-chain amino-acid aminotransferase 4507832 4507569 CDS EC_number 2.2.1.6 gene ilvM inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:SMALLILVM-MONOMER locus_tag OGMAPBJC_04259 product acetohydroxybutanoate synthase / acetolactate synthase 4509475 4507829 CDS EC_number 2.2.1.6 gene ilvB_2 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:LARGEILVB-MONOMER locus_tag OGMAPBJC_04260 product acetohydroxybutanoate synthase / acetolactate synthase 4509911 4509822 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04261 product hypothetical protein 4510066 4511586 CDS gene yifB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11260-MONOMER locus_tag OGMAPBJC_04262 product putative ATP-dependent protease 4511949 4511611 CDS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11450-MONOMER locus_tag OGMAPBJC_04263 note conserved protein product hypothetical protein 4512068 4512907 CDS gene hdfR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11449-MONOMER locus_tag OGMAPBJC_04264 product HdfR DNA-binding transcriptional dual regulator 4513078 4513003 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04265 product tRNA-Trp(cca) 4513163 4513087 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04266 product tRNA-Asp(gtc) 4513331 4513221 rRNA locus_tag OGMAPBJC_04267 product 5S ribosomal RNA score 6.4e-11 4516329 4513430 rRNA locus_tag OGMAPBJC_04268 product 23S ribosomal RNA score 0 4516600 4516525 tRNA inference COORDINATES:profile:Aragorn:001002 locus_tag OGMAPBJC_04269 product tRNA-Glu(ttc) 4518224 4516687 rRNA locus_tag OGMAPBJC_04270 product 16S ribosomal RNA score 0 4518708 4519400 CDS gene yieP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11733-MONOMER locus_tag OGMAPBJC_04271 product putative transcriptional regulator 4519423 4520850 CDS gene hsrA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIEO-MONOMER locus_tag OGMAPBJC_04272 product inner membrane protein HsrA 4521793 4520816 CDS gene rbsR inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD03867 locus_tag OGMAPBJC_04273 product RbsR DNA-binding transcriptional repressor 4522726 4521797 CDS EC_number 2.7.1.15 gene rbsK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RIBOKIN-MONOMER locus_tag OGMAPBJC_04274 product ribokinase 4523742 4522852 CDS gene rbsB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RBSB-MONOMER locus_tag OGMAPBJC_04275 product ribose ABC transporter - putative periplasmic binding protein 4524732 4523767 CDS gene rbsC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RBSC-MONOMER locus_tag OGMAPBJC_04276 product ribose ABC transporter - membrane subunit 4526242 4524737 CDS EC_number 3.6.3.17 gene rbsA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:RBSA-MONOMER locus_tag OGMAPBJC_04277 product ribose ABC transporter - putative ATP binding subunit 4526516 4526250 CDS gene rbsD_1 inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10817-MONOMER locus_tag OGMAPBJC_04278 product ribose pyranase 4526706 4526488 CDS EC_number 5.4.99.62 gene rbsD_2 inference ab initio prediction:Prodigal:002006 inference protein motif:HAMAP:MF_01661 locus_tag OGMAPBJC_04279 product D-ribose pyranase 4528705 4526837 CDS gene kup inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:KUP-MONOMER locus_tag OGMAPBJC_04280 product K+ transporter Kup 4528928 4530424 CDS gene ravA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11731-MONOMER locus_tag OGMAPBJC_04281 product regulatory ATPase 4530418 4531869 CDS gene viaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11730-MONOMER locus_tag OGMAPBJC_04282 product stimulator of RavA ATPase activity 4532866 4531874 CDS EC_number 6.3.1.1 gene asnA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ASNSYNA-MONOMER locus_tag OGMAPBJC_04283 product asparagine synthetase A 4533018 4533476 CDS gene asnC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PD00250 locus_tag OGMAPBJC_04284 product AsnC-L-asparagine 4533566 4534009 CDS gene mioC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11199-MONOMER locus_tag OGMAPBJC_04285 product flavoprotein involved in biotin synthesis 4534388 4536277 CDS gene mnmG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10375-MONOMER locus_tag OGMAPBJC_04286 product protein involved in a tRNA modification pathway 4536341 4536964 CDS gene rsmG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10376-MONOMER locus_tag OGMAPBJC_04287 product 16S rRNA m7G527 methyltransferase 4537581 4537961 CDS gene atpI inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10106-MONOMER locus_tag OGMAPBJC_04288 product AtpI 4537970 4538785 CDS gene atpB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPB-MONOMER locus_tag OGMAPBJC_04289 product ATP synthase F0 complex - a subunit 4538832 4539071 CDS gene atpE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPE-MONOMER locus_tag OGMAPBJC_04290 product ATP synthase 4539133 4539603 CDS gene atpF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPF-MONOMER locus_tag OGMAPBJC_04291 product ATP synthase F0 complex - b subunit 4539618 4540151 CDS gene atpH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPH-MONOMER locus_tag OGMAPBJC_04292 product ATP synthase F1 complex - delta subunit 4540164 4541705 CDS gene atpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPA-MONOMER locus_tag OGMAPBJC_04293 product ATP synthase F1 complex - alpha subunit 4541756 4542619 CDS gene atpG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPG-MONOMER locus_tag OGMAPBJC_04294 product ATP synthase F1 complex - gamma subunit 4542646 4544028 CDS gene atpD inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPD-MONOMER locus_tag OGMAPBJC_04295 product ATP synthase F1 complex - beta subunit 4544049 4544468 CDS gene atpC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:ATPC-MONOMER locus_tag OGMAPBJC_04296 product ATP synthase F1 complex - epsilon subunit 4544821 4546191 CDS EC_number 2.7.7.23 gene glmU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:NAG1P-URIDYLTRANS-MONOMER locus_tag OGMAPBJC_04297 product fused N-acetylglucosamine-1-phosphate uridyltransferase and glucosamine-1-phosphate acetyltransferase 4546353 4548182 CDS EC_number 2.6.1.16 gene glmS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:L-GLN-FRUCT-6-P-AMINOTRANS-MONOMER locus_tag OGMAPBJC_04298 product L-glutamine:D-fructose-6-phosphate aminotransferase 4548496 4549536 CDS gene pstS inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSTS-MONOMER locus_tag OGMAPBJC_04299 product phosphate ABC transporter - periplasmic binding protein 4549623 4550582 CDS gene pstC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSTC-MONOMER locus_tag OGMAPBJC_04300 product phosphate ABC transporter - membrane subunit 4550582 4551472 CDS gene pstA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSTA-MONOMER locus_tag OGMAPBJC_04301 product phosphate ABC transporter - membrane subunit 4551655 4552428 CDS EC_number 3.6.3.27 gene pstB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:PSTB-MONOMER locus_tag OGMAPBJC_04302 product phosphate ABC transporter - ATP binding subunit 4552443 4553168 CDS gene phoU inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10735-MONOMER locus_tag OGMAPBJC_04303 product PhoU phosphate transport system protein 4553454 4554290 CDS gene bglG inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10116-MONOMER locus_tag OGMAPBJC_04304 product BglG transcriptional antiterminator (monomer) 4554423 4556300 CDS EC_number 2.7.1.69 gene bglF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:BGLF-MONOMER locus_tag OGMAPBJC_04305 product beta-glucoside PTS permease BglF - cryptic 4556319 4557731 CDS EC_number 3.2.1.86 gene bglB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10114-MONOMER locus_tag OGMAPBJC_04306 product 6-phospho-beta-glucosidase B; cryptic 4557800 4559416 CDS gene bglH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11364-MONOMER locus_tag OGMAPBJC_04307 product carbohydrate-specific outer membrane porin, cryptic 4559443 4560612 CDS gene yieL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11729-MONOMER locus_tag OGMAPBJC_04308 product putative xylanase 4560627 4561349 CDS gene yieK inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11728-MONOMER locus_tag OGMAPBJC_04309 product putative 6-phosphogluconolactonase 4561998 4561411 CDS gene cbrC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11727-MONOMER locus_tag OGMAPBJC_04310 product colicin E2 tolerance protein 4562514 4562047 CDS gene cbrB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11726-MONOMER locus_tag OGMAPBJC_04311 product putative inner membrane protein 4563246 4562581 CDS gene yieH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11725-MONOMER locus_tag OGMAPBJC_04312 product 6-phosphogluconate phosphatase 4563411 4564748 CDS gene purP inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11724-MONOMER locus_tag OGMAPBJC_04313 product adenine:H+ symporter 4565368 4564802 CDS gene yieF inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11723-MONOMER locus_tag OGMAPBJC_04314 product chromate reductase monomer 4566139 4565390 CDS gene yieE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11722-MONOMER locus_tag OGMAPBJC_04315 product putative phosphopantetheinyl transferase 4567255 4566296 CDS gene yidZ inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG11721-MONOMER locus_tag OGMAPBJC_04316 product putative transcriptional regulator LysR-type 4568405 4567230 CDS gene mdtL inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIDY-MONOMER locus_tag OGMAPBJC_04317 product multidrug efflux transporter MdtL 4569784 4568537 CDS gene tnaB inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TNAB-MONOMER locus_tag OGMAPBJC_04318 product tryptophan:H+ symporter TnaB 4571290 4569875 CDS EC_number 4.1.99.1 gene tnaA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:TRYPTOPHAN-MONOMER locus_tag OGMAPBJC_04319 product tryptophanase / L-cysteine desulfhydrase 4573192 4571828 CDS gene mnmE inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10997-MONOMER locus_tag OGMAPBJC_04320 product GTP-binding protein with a role in modification of tRNA 4574944 4573298 CDS gene yidC inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:YIDC locus_tag OGMAPBJC_04321 product inner-membrane protein insertion factor 4575494 4575168 CDS EC_number 3.1.26.5 gene rnpA inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10862-MONOMER locus_tag OGMAPBJC_04322 product RNase P protein component; processes tRNA, 4.5S RNA 4575684 4575544 CDS gene rpmH inference ab initio prediction:Prodigal:002006 inference similar to AA sequence:RefSeq:EG10892-MONOMER locus_tag OGMAPBJC_04323 product 50S ribosomal subunit protein L34 >Feature 2 95 1120 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04324 product hypothetical protein 1374 1832 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04325 product hypothetical protein 1832 1948 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04326 product hypothetical protein 1985 3268 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04327 product hypothetical protein 3379 3906 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04328 product hypothetical protein 3915 4901 CDS inference ab initio prediction:Prodigal:002006 locus_tag OGMAPBJC_04329 product hypothetical protein